Title:

Heart worm infections in canines

By
Dr. S. Samanta, Dr. O. K. Raina and Dr. Joken Bam Samanta,
Division of Parasitology, Parasitology, Indian Veterinary Research Institute, Izatnagar, Izatnagar, India.

INTRODUCTION


Dirofilaria immitis

heartworm of dog

Class: Nematoda Subclass: Secernentea Order: Spirurida Superfamily: Filarioidea Family: Filariidea Scientific name - Dirofilaria immitis Common name Heartworm of dog

Most

pathogenic filarial parasite of dogs

(Mehlhorn et al., 2001) al.,

Endemic in temperate, subtropics and tropical countries lives mainly in right ventricle and the pulmonary artery
(Quinn, 1997) 1997)

Worm

Other

locationslocations- Posterior vena cava, anterior chamber of the eye, interdigital cysts and other parts of the body
(Levine, 1980)

Mosquito

borne

Intermediate hosts- approx.70 spp. of mosquitoes hosts(Culex, Aedes, Anopheles, Mansonia etc.)
(Arellano et al.,2002). al.,2002).
In

recent years- gaining importance and yearsrecognised as an emerging zoonosis

(Rishnew et al., 2006 and Sabu et al., 2005) al., al.,

It causes exercise intolerance, pulmonary thromboembolism, hypertension,endarteritis and pneumonitis Zoonotic: causing Human pulmonary dirofilariosis around the globe Transmission takes place when a potential vector, reservoir of infection and favorable conditions coexist
(McCall et al., 2004) al.,

Reports from India

Heartworm disease has been recognised increasingly
(Sharma and Pachauri,1978)

-5-7% from Terai region - 33% from NE region of India - 7-24% from Kerala From wild animals: animals: Captive lions & tigers (Gupta et al 1996) Vulpes bengaliensis in Nandankanan (Rao & Acharya 1993) Leopard in BTR, WB (Samanta et al 2007)

In dogs:

In man: Occular Dirofilariosis Joseph et al. (1976)., George and Kurian(1978)., Sekhar et al. (2000)., Nadgir et al.(2001) and Gautam et al.(2001) al., 2002 al., Subcutaneous infection Badhe and Sane (1989)., Ittyerah and Mallik (2004)., Padmaja et al.(2005) and Sabu et al.(2005) al.(2005) al.(2005)

Reports from globe -15 % from Sydney, Australia -53.4 % Bahamas -55.9 % from Taichung -23.5 % from Argentina -9.3 % from Turkey -5-15 % from Italy -6 % from Serbia -48 % from Croatia ->50 % from Gran Canaria island -4-47 % from USA

Clinical presentation of H.W.D

Disease forms/subtypes: Class 1: few or no overt clinical signs Class 2: moderate clinical signs Class 3: severe clinical signs Class 4: caval syndrome Symptoms: - Coughing - Pneumonitis, endarteritis - pulmonary hypertension (PH) - pulmonary thromboembolism (PTE) - cor pulmonale other complaints includes : exercise intolerance, weight loss, syncope or collapse and manifestation of right sided congestive heart failure

DIAGNOSIS
  

   

History Clinical signs Demonstration of microfilariae in peripheral blood. Radiography Cardiography Serological diagnosis Molecular diagnosis

Microfilaria Detection

- Direct blood smear (wet,thick,thin) - Concentration technique a) Knotts method b) Filter method Each methodology: - advantages/disadvantages - efficacy is similar

Radiography
Degree of arterial disease Best assessed by dorsoventral projection Tortuisity and pruning of arteries Caudal lobar arteries-not to be exceed 9th rib Cranial lobal arteries- not to be exceed 3rd rib

Echocardiography Dilated pulmonary arteries Hyperechoic densities

High

velocity tricuspid regurgitation insufficiency on echodoppler with PH.

Pulmonic

Limitations
Not

efficient in making diagnosis in lightly infected dogs

( Sharma and Pachauri, 1987)

The

worms often are limited to the peripheral branches of the pulmonary arteries which are beyond the al., echocardiographic field of view. (Mc Call et al., 2004)

Serological tests
Kits available
ASSURE CH Dirocheck Petcheck HTWM PF Snap Canine Heartworm PF UNIUNI-TEC CHW ICT GOLD HW VetRED

Cross reaction with other dog nematodes

(Song et al., 2002) al.,

Live female worms with >5 months infection can be detected False positive results technical error False negative results low worm burden
(Courtney and Zeng, 2001)

Limitations


Cross reaction with other dog nematodes

(Song et al., 2002

False positive results technical error False negative results low worm burden
(Courtney and Zeng, 2001)

MOLECULAR DIAGNOSIS


ITS region generally display sequence variation between species (Guarro et al.,1999; Henry et al., 2000; al.,1999; al.,
and Turenne et al., 1999). al.,

PCR based differential diagnosis of D. immitis and D. reconditum using primer derived from internal transcribed spacer-2 (ITS2) region. spacerSensitivitySensitivity- 1x 10-2 microfilariae of each species of parasite or even with mixed samples could be detected Similarity of DNA sequence between the ITS2 region of two species was as low as 41.1%
(Mar et al.,2002) al.,2002)

PCRPCR-RFLP of ITS1 allowed differentiation down to the species level for D. immitis, D. repens, Wuchereria bancrofti, Brugia malayi and Brugia pahangi
(Nuchprayoon et al.,2005) al.,2005)

1pg of parasite DNA, which allows for the presence of only a single microfilaria in 250l blood sample to be detected
(Nuchprayoon et al.,2005) al.,2005)

Rishnew et al. (2006) developed molecular al. method based on 18S ribosomal DNA PanPan-filarial primers which amplified fragments of different fragment length of both D. immitis and D. reconditum Different microfilariae of six different filarial parasites of dogs could be detected
(Rishnew et al.,2006) al.,2006)

Critical gap
Conventional approaches for Microfilaria Detection  Not adequate  Potentially misleading (Mar et al.,2002) al.,2002)  Requires experienced personnel  Morphological alteration of microfilariae (Sawyer and Weinstein, 1963)  Over-estimated,if other species are identified wrongly Over(Scoles and Kambhampati, 1995)  No use in occult dirofilariosis ( Song et al., 2002) al.,

..( ..( undiagnosed/misdiagnosed)..

HeartGard Plus
(Ivermectin/Pyrantal)

Sentinel (Milbemy cin/Lufen uron Revolution (Selamectin )

Interceptor (Milbemycin) Approved for cats

Female worms

Adult worms collected from heart of the dog

Male and female worms

Hind end of the male worm showing a characteristic spicules and pappillae

Hind end of the male worm

Microfilaria in Geimsa stain

Microfilaria in Geimsa stain

Microfilaria in Geimsa stain

Microfilariae recovered in Knott method

Knott method

Knott method

THANK YOU

Occurrence of Dirofilaria immitis in dogs (sex wise)

No. of positive dogs No. of female worms No. of male worms

Sex of dogs

No. of dogs examined

Male

26

7 (26.9%)

26 (50.0%)

16(30.8%)

Female

2 (25.0%)

6 (11.5%)

4 (7.7%)

Total

34

9 (26.5%)

32 (61.5%)

20(38.5%)

Worm burden and sex ratio of D. immitis worm in dogs at necropsy

Dog No. 1 2 3 4 5 6 7 8 9 Total Average Total worms recovered 3 1 8 16 7 5 9 1 2 52 5.7 Female worms 2 (66.7%) 0 6 (75.0%) 9 (56.2%) 4 (57.2%) 3 (60.0%) 6 (66.7%) 1 (100.0%) 1 (50.0%) 32 (61.5%) 3.5 (61.5%) Male worms 1 (33.3%) 1(100.0%) 2 (25.0%) 7 (43.8%) 3 (42.8%) 2 (40.0%) 3 (33.3%) 0 1 (50.0%) 20 (38.5%) 2.2 (38.5%) Sex ratio 2:1 3:1 1.2 : 1 1.3 : 1 1.5 : 1 2:1 1:1 1.6 : 1 1.6 : 1

 Isolation of DNA (Phenol Chloroform method) PCR amplification Primers

ITS1 F 5- CGAGCTTCAACAAACAACAAACACATC -3 5ITS1 R 5- GGTGATCCCCCGCTTAGAGTTATTG 3 5ITS2 F 5 GTCTGGTTGAGGGTCAATATCGATCAG 3 ITS2 R 5 CGGGTAATCACGACTGAGTTGAGGTC 3


Program for amplification For ITS1

94 C for 5 min - initial denaturation 94 C for 1 min - cycle denaturation 56 C for 30 s - annealing temperature 30 cycles 72 C for 30 s - extension 72 C for 10 min - final extension

For ITS2
94 C for 5 min - initial denaturation 94 C for 1 min - cycle denaturation 60 C for 30 s - annealing temperature 30 cycles 72 C for 45 s - extension 72 C for 10 min - final extension
M 1 2

M- 100 bp ladder 1- ITS2 2- ITS1

504 bp 465 bp

Elution of DNA
(PCR purification kit QIAGEN)

Ligation in pDrive cloning vector Preparation of competent cells by CaCl2 method

( Sambrook et al ., 1989)

Transformation in E.coli (DH5 ) Screening For Recombinant Clone

1.Blue White colony selection 2.RE digestion by Eco RI 3.Colony PCR

Plasmid isolation ( Conventional Phenol Chloroform method)

Restriction digestion
1 M M 1

520 bp

481 bp

M-100 bp ladder plus 1- EcoRl release of ITS1

M-100 bp ladder plus 1- EcoRl release of ITS2

Colony PCR
1 M M 1

504 bp

465 bp

M-100 bp ladder plus 1-ITS1

M-100 bp ladder plus 1-ITS2

Alignment report of ITS1

Alignment report of ITS2

Isolation of DNA from microfilaria

250 l of blood sample lyse RBCs with 2 % formalin
centrifuged and supernatant was discarded

pellet washed with 500 l chilled PBS twice pellet suspended in 400 l lysis buffer 370 C x 1 h proteinase K (@ 5 mg/ml) 560 C x 5 h standard phenol chloroform extraction
(Sambrook et al., 1989) al.,

final pellet was diluted in 25 l TE.

Program for amplification

For ITS1 and ITS2
94 C for 5 min - initial denaturation 94 C for 1 min - cycle denaturation 60 C for 30 s - annealing temperature 72 C for 45 s - extension 72 C for 10 min - final extension
30 cycles

Program for amplification

For ITS1 and ITS2
94 C for 5 min - initial denaturation 94 C for 1 min - cycle denaturation 60 C for 30 s - annealing temperature 72 C for 45 s - extension 72 C for 10 min - final extension
30 cycles

504 bp 465 465 bp

M- 100 bp ladder plus 1- ITS1

M- 100 bp ladder 1- ITS2

Conclusion


Overall incidence of 26.5% at necropsy was recorded Worm burden ranged from 1-16 worms per positive dog (Average 5.7) was 1recorded Female : Male worm- 1.6 : 1 wormNo significant variation in the prevalence rate due to sex of dog ITS1 and ITS2 regions of ribosomal gene of D. immitis was characterized ITS1 and ITS2 regions of ribosomal DNA of Mizoram isolate showed length and sequence polymorphisms ITS1 and ITS2 were used for specific diagnosis of D. immitis

Thank you