Plant Biotechnology

Nono Carsono, PhD Dr. rer. nat. Suseno Amien Anas, PhD

Understand application of biotechnology for plant science, including: DNA isolation and cloning, Making DNA and cDNA library, Gene construct design Molecular marker technique (overview) Transfer gene techniques (transgenic plants) Analysis of transformants Current application: examples of transgenic plants with improved traits

Overview Biotech product- animal, plant, etc Tissue culture for crop improvement/production (overview) Marker assisted selection Genetic transformation Transgenic plant: an example

Variety improvement
Conventional breeding Selection Hybridization Mutation New developed tools (complement)
In vitro culture Molecular marker (marker assisted selection) Transfer gene

Source of Genetic Variation

The Ultimate Driving Force Behind All New Technologies

Faster Source for Genetic Variation Faster, more Efficient Assimilation of Traits High Through-put Screening

To Speed Variety Development

To Improve Quality

Purity/Hybridity Testing

Identity-preserved or specific-attribute crops (functional nutrient: vaccines, higher oil or starch content, additional amino acids) (Molecular marker, Transfer gene)

Animal growth hormones, e.g., bST (bovine Growth Hormone- to enhance milk production)

Herbicide tolerant crops, e.g., Roundup Ready soybeans and corn and Liberty Link corn

Insect resistant crops commercially available, e.g., Bt corn, cotton, and potatoes Corn rootworm resistance in 2001?

Insect resistant crops commercially available, e.g., Bt corn, cotton, and potatoes Corn rootworm resistance in 2001?

Herbicide tolerant crops, e.g., Roundup Ready soybeans and corn and Liberty Link corn

Wild type

Golden Rice

Engineered to produce more vitamin A precursor, beta-carotene In Southeast Asia, 70% of children under the age of five suffer from vitamin A deficiency

?
Green Revolution Chemical Agriculture
Predicted Production Actual Production Population Growth

Mendel

1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000

30,000
metabolite

What does the term cloning mean? What is gene cloning? How does it differ from cloning an entire organism? Why is gene cloning done? How is gene cloning accomplished ? What is a DNA Library? A cDNA Library? What are some of the ethical considerations regarding gene cloning?

From the Greek - klon, a twig An aggregate of the asexually produced progeny of an individual;a group of replicas of all or part of a macromolecule (such as DNA or an antibody) An individual grown from a single somatic cell of its parent & genetically identical to it www.mw/cgi-bin/dictionary

When DNA is extracted from an organism, all its genes are obtained In gene (DNA) cloning a particular gene is copied (cloned)

A particular gene can be isolated and its nucleotide sequence determined Control sequences of DNA can be identified & analyzed Protein/enzyme/RNA function can be investigated Mutations can be identified, e.g. gene defects related to specific diseases Organisms can be engineered for specific purposes, e.g. insulin production, insect resistance, etc.

DNA isolation Cutting DNA with Endonucleases (cutting) Join DNA with Ligases (ligation) DNA entry into cell (competence cells; transformation) Identifying recombinants from nontransformants (Screening) Identifying the correct recombinant colony (confirmation)

Plant DNA

DNA is extracted Restriction enzymes, e.g. EcoRI, HindIII, etc., cut the DNA into small pieces

Restriction enzyme action

Bacterial plasmids (small circular DNA additional to a bacterias regular DNA) are cut with the same restriction enzyme A chunk of DNA can thus be inserted into the plasmid DNA to form a recombinant

The recombinant plasmids are then mixed with bacteria which have been treated to make them competent, or capable of taking in the plasmids This insertion is called transformation

The plasmids have naturally occurring genes for antibiotic resistance Bacteria containing plasmids with these genes will grow on a medium containing the antibiotic- the others die, so only transformed bacteria survive

Bacteria containing an Amp resistant plasmid

Bacteria with no Amp resistant plasmid

Culture medium containing Ampicillin

The transformed bacterial cells form colonies on the medium Each cell in a given colony has the same plasmid (& the same DNA) Cells in different colonies have different plasmids (& different DNA fragments)

A gene library is defined as a collection of living bacterial colonies that have been transformed with different pieces of DNA from the organism that is the source of the gene of interest The gene library then must be screened to find the colony with the gene in which the researchers are interested

Screening can involve: 1. Phenotypic screeningthe protein encoded by the gene changes the colour of the colony 2. Using antibodies that recognize the protein produced by a particular gene

3. Detecting the DNA sequence of a cloned gene with a probe (DNA hybridization)

Once colonies are identified, they are cultured in broth to increase numbers and therefore the amount of DNA Samples are also prepared for storage at -80 degrees. They can be kept for many years this way.

Eukaryotic DNA differs from bacterial (prokaryotic) DNA in that it has introns (intervening sequences) and exons (expressed or translated sequences). In order for a eukaryotic gene to be expressed, the introns are edited out of mRNA after transcription

A simplified diagram of transcription in eukaryotes

hnRNA = heterogenous nuclearRNA in the process of being cut and spliced into messenger RNA

Bacteria cant deal with introns, so in cases where a product (e.g. insulin) is to be expressed by the bacteria, an uninterrupted coding sequence is needed. Also, since introns can account for up to 90% of an eukaryotic gene, and cloning long fragments is difficult, it is sometimes desirable to work only with the expressed sequences (exons)

To deal with this, special DNA is synthesized using mRNA as a template. This process also requires a primer and an enzyme, reverse transcriptase (a DNA polymerase that synthesizes a DNA strand from the mRNA) This complementary DNA is called cDNA cDNA may be attached to a vector such as a plasmid and then introduced into bacterial cells.

Cc the cat, slide 5 courtesy of Texas A & M University, College of Veterinary Medicine Photos of sheep & tissue culture, slide 5, L. Macdonald 2003 Graphics on slides 8, & 12 , V. Ward, University of Auckland DNA Hybridization, slide 15, courtesy of Texas Tech University DNA cloning & screening, slides 10 & 14, courtesy of The University of Arizona

Micropropagation Germplasm preservation Somaclonal variation & mutation selection Embryo Culture Haploid & Dihaploid Production In vitro hybridization Protoplast Fusion Industrial Products from Cell Cultures

PERBANYAKAN MIKRO
Tahap III

Tahap I

Tahap II

Tahap IV

PERBANYAKAN MIKRO
Protocorm Like Bodies Anggrek
Tahap III

Tahap I

Tahap II

Tahap IV

What are molecular markers?

Genetic information resides in the genome A molecular marker is based on DNA sequence Polymorphisms arise by mutation

gtataagtgaaccactcagggtcctggccgggcacagtggctcacgcctgt aatcccagcctttgggaggccgaggtgggtggatcatgaggtcaggagttcaa gaccagcctggccaaatggcgaaacattgtctctactaaaagtacaaaaattag ccagacgtggtggtgctcactgtaatcccagctactcgggaggctgaggcagg aaaatcacttgaacccgggaggcggaggtcacagttagccaagatcacaccac tgtactccag

ATP5L2 ATP synthase C22orf11 chromosome 22 ORF PANX2 pannexin 2

DNA Fingerprinting Basics

Different individuals carry different alleles.

Most alleles useful for DNA fingerprinting differ on the basis of the number of repetitive DNA sequences they contain.

Co-dominant (distinguish between homozygotes and heterozygotes) Nondestructive assay Complete penetrance High polymorphism

Random distribution throughout the genome

Assay can be automated

Phenotypic markers
2-rowed 6-rowed Black white

hulled naked

non-waxy

waxy

Conversion of a phenotypic marker to a molecular marker

non-waxy

waxy

Restriction digest Polymerase chain reaction (PCR) Sequence analysis

DNA Fingerprinting Basics

Restriction Digest
If DNA is cut(by what ?), DNA fragments of different sizes will be produced. A DNA fingerprint is made by analyzing the sizes of DNA fragments produced from a number of different sites in the genome that vary in length. The more common the length variation at a particular site and the greater the number the sites analyzed, the more informative the fingerprint.

A Site With Three Alleles Useful for DNA Fingerprinting

DNA fragments of different size will be produced by a restriction enzyme that cuts at the points shown by the arrows.

The DNA Fragments Are Separated on the Basis of Size

The technique is gel electrophoresis. The pattern of DNA bands is compared between each sample loaded on the gel.

Possible Patterns for a Single Gene With Three Alleles

In a standard DNA fingerprint, about a dozen sites are analyzed, with each site having many possible alleles.

1. What for Plant Breeder use biotechnology 2. What are the new products of agricultural biotechnology use Plant Biotechnology ? 3. What does the term cloning mean? 4. What is gene cloning? How does it differ from cloning an entire organism? 5. Why is gene cloning done? 6. How is gene cloning accomplished ? 7. What is a DNA Library? A cDNA Library? 8. What are some of the ethical considerations regarding gene cloning?

References Kreuzer, H., Massey, A.,2001, Recombinant DNA & Biotechnology, ASM Press, Washington Turner, P.C., et al, 1997, Instant Notes n MolecularBiology, Bios, Oxford www.agbiosafety.unl.edu/education/clone.htm http://avery.rutgers.edu/WSSP/Student Scholars/Session12/Session12html http://www.pssc.ttu.edu/pss3421/gene%20cloning%20Strategies.htm

http://www.uic.edu/classes/phar/phar331/lecture7
http://www.biology.arizona.edu

Presentasi 8 topik review - Cari journal yang terkait dengan topik di bawah ini

DNA cloning (isolation & characterization) DNA fingerprinting (AFLP, SSR, etc). Particle bombardment: myths and realities Marker assisted selection in plant breeding Tissue culture application Generation of transgenic plant with improved quality trait Generation of transgenic plant with improved quality trait Characterization of transgenic plant

Buat makalah kelompok

Terdiri dari: 4 Bab 1. Pendahuluan (uraian ttg pentingnya masalah dan tujuan) 2. Bahan dan metode 3. Hasil dan pembahasan 4. Kesimpulan Jurnal yang dijadikan acuan: 5 tahun terakhir dan dilampirkan dalam makalah tersebut. Tugas dikumpulkan minggu depan 31 Maret 2010

Digital library yang bisa diakses http://search.ebscohost.com User ID: s2483204 Password: unipad

Accelerate the breeding process

Introduce/enhance desired trait in an established genetic background Select genes from any Kingdom (with care, especially if potential for entry into the food chain)

Extend the gene pool

Research

Largest number of transgenic plants are currently created for research purposes
Knock-outs, over-expression, modified proteins

stress-inducible promoter driving drought- and cold-responsive transcription factor

wild type

K. Yamaguchi-Shinozaki, JIRCAS, Japan

Commercial Applications

Altered agronomic traits

Disease/insect

time

resistance Virus resistance Herbicide resistance Salt/drought tolerance 2007 Cold tolerance Enhanced yields, other quantitative traits Phytoremediation Production of vaccine

Application of Roundup herbicide

Field following application

Bioreactors / Molecular farming Therapeutic proteins

Human lactoferrin to treat

iron deficiencies Antibodies

Vaccine production
Antigen expression

HepC, HIV
Dow AgroSciences Achieves Worlds First Registration for Plant-Made Vaccines Indianapolis, IN - January 31, 2006 Dow AgroSciences LLC, a wholly owned subsidiary of The Dow Chemical Company, (NYSE: DOW), announced today that it has received the world's first regulatory approval for a plant-made vaccine from the United States Department of Agriculture (USDA) Center for Veterinary Biologics. This approval represents an innovative milestone for the company and the industry...

How do we transfer a gene (genes) to the plant ? What is the requirement for this purpose?

Nature Biotechnology 25: 271 (2007)

Nature Biotechnology 25: 271 (2007)

Nature Biotechnology 25: 271 (2007)

Functional foods (humans and livestock)

Today: Golden rice

Vitamin A enriched

Future directions:
Boosted antioxidants Elevated content of

specific minerals Removal of food allergens, carcinogens

Greater public acceptance when the technology is shown to more greatly benefit consumers?

Metode konvensional (persilangan+seleksi) menghadapi kendala teknis; Tidak dijumpai sumber gen pengendali karakter yg dituju pada kerabatnya, spt gen ketahanan thd hama & penyakit, tahan herbisida, penghasil vit. tertentu; Manipulasi karakter baru/unik, yg tidak dapat dilakukan dgn metode konvensional, misalnya tnm penghasil antibodi, dll Metode konvensional relative membutuhkan waktu yg lebih lama (time consuming); Gen pengendali karakter yg dipindahkan tidak melanggar etika, agama ataupun sistem nilai yg sudah ada.

Parameter

PT konvens

Rekayasa gen

Tingkat Ketepatan Batasan taksonomi Kepastian

Tnm utuh Sekumpulan gen Satu species/genus

Sel/molekul Satu gen Tdk ada batasan

Perubahan genetika Perubahan sulit diestimasi genetika dpt diestimasi