Вы находитесь на странице: 1из 18

Copyright & A K-C

CUCURBITA PEPO L.

06.01.11

-2002

Copyright & A K-C


,
.
,

:
, ,
,

- ()
^ "* . " .?:?.^'. . ..2002
"/*- " 220 043 04
127550, -550, , 49



, , ,
t

^ \ ^>

..

Copyright & A K-C

.
, - , .
, , , .
, ," .
,

.
1

'

.
: , ,
;
;
.
. :
.

; /"1. >-^?. ; *1

. .
. .
.

Copyright & A K-C

; , -
, ,
,
Xanthomonas cucurbitae
: ,
, F]
-70
, , .
. 6
. 134
3 , , ,
26 34 . 231
, 129

. (1997 - 2001 .),

Copyright & A K-C

(19972001 .) ( , , ); . .. (1999-2000 .), (2001 .),


- .

.


.
. ,
- , .
- , , ,
,
, , , . 1056 .
240 , 59 . ,
Xanthomonas winia . .. . :

Copyright & A K-C

8684 Xanthomonas campestns pv cucurbitae, 8982 Erwinia carotovora


subsp carotovora, ATCC 15713 Ervvuua carotovora subsp carotovora, NCPPB
402 Erwinia chrysantherm subsp chrysanthemi,
Xanthomonas cucurbitae K552 ( ), Xanthomonas translucens - -3004, -3005, -1008, 26-2, 150-6, 168-2, Xanthomonas campestns pv campestns 1279a ( 4), 5212*
(NCPPB 528 ), 5212- (NCPPB 528
), Xanthomonas campestns pv rapham 1946 (NCPPB 1946), a
Pantoea sp -1-3 ( )

, ,
(1997)
Xanthomonas cucurbitae RAPD

( 1
/) -

, -

(-

Copyright & A K-C

4 )
( 1 /).
. ,
. 2-4 1 * 108 /.

.-.,

. . . , ,
. .
.
5% . -.

- .
X. cucurbitae,
, RAPD PCR.
,
. StatSoft Statistica 4.3 Treecon for Windows ver. 1.3b
,'.

, .-

, , thomonas cucurbitae (ex Bryan 1926), Vauterin et al, 1995.


"'5

Copyright & A K-C

, , 011 0 7

,
,

- -
,
, ,
2-4 , , , ,

,
,
, -
.

, ,

, -
6- 10-15
1998 - 2000 . ( !)

Copyright & A K-C

, , F| , F) ,
, Corsaire.
. 1.

' -.

, %

, %

' '

, %

*>

00 010510

20

30 40

00010510

20 30 40

00010510

20 30

. 1. : - 2-4 ; - -;
''
'
.

2.

. 2. , 1998-2000 .
7

Copyright & A K-C

, , Fi , Fi ,
, Corsaire
I.
1

, 1998 - 2000

0
0.4
0,3
1,2
1.4
1,5

0,5

0,3

1,2

1,5

1,4

Ft

0,5

0,3

1,6

2,0

1,6

F]

0,2

0,5

1.0

2,0

1,5

0,1

0,4

1.4

1,9

2,1

Corsaire

0,2

0,6

1.0

1,6

1,6

0,27

0,22

0,32

0,46

0,55


12 2 5 % ( 2)
, , ,
, vn , ,
X

cucurbitae Ecbalhum elatenum

, Ecballium elatenum
Solanaceae (, , ),
8

Copyright & A K-C

Brassicaceae (, , ), (,
) .
2
,
1998-2000
1

, %

-38

19,8

15,5

4,3

21,8

F|

24,5

21,6

2,9

11,9

23,4

17,6

5,8

14,6

Makita

17,6

13,2

4,4

24,9

Opaline

17,8

14,0

3,8

21,1

Corsair

22 2

18,8

3,4

15,3

Saray

18,6

14,4

4,2

22,5

17,2

13,1

4,1

23,9

1 1

'

'

{4,2

14,9

4,3

22,4

10

Sudan

18,4

12,4

6,0

23,8

Black Beauty

21,6

17,3

4,3

19,8

4,02

3,25

Fara

HCPos

Xanthomonas cucurbitae
'
.
Xanthomonas cucurbitae 3

'

'

Copyright & A K-C

.3
Xanthomonas cucurbitae

I I-a

89

- (O-F )
2% NaCl

0(96)

100

82

:
2,8

100

(99)

100

100

95

100

99

()

100

84

100

100

19

93


- Xanthomonas campestris;
'
: - - ; + - ; - ; . -
; - ; - ;
; .
10

Copyright & A K-C

12 , 3 -152 (CTGGCGGCTG), D50


(ATGTGGAAGCTGCCCATGTT) D27 (AACGCGCAAC)

, Xanthomonas cucurbitae, ( 3) ,
,
, Xamhomonas cucurbitae

()
, Erwima i.arotovora subsp carotovora ^
, ,
, , , , , , 5%
, Xanthomonas cucurbitae
, Erwmia carotovora
, , , , , , , , , 1 , ,
, 1, ,

11

Copyright & A K-C

X, cucurbitae

xcoso

XC1040
XC7S7
XC044
XC086
XC1051D
XCK5S2
XCIMV868 J
XCCS212M1
XCC5212

X campestris

XTY300SJ x

traB1

, a e f , (

X trans luce ns ()
Pantoea agglomerans

. 3. ( , ), 25
Xanthomonas cucurbitae ( I), 4 X. campestris ( ) 6 X. translucens ( III IV) 59
RAPD . 1 3 Pantoea agglomerans .
,
Erwinia carotovora , , , , ,
, , , , , , ;
, , , ; , , , , ; , , .
Erwinia carotovora subsp. carotovora , .

12

Copyright & A K-C

1 , ( Xanthomonas cucurbitae) ( Erwmia carotovora


subsp carotovora)
2 Xanthomonas cucurbitae
, ,

3 ,
100% 12 25%
4 Xanthomonas cucurbitae -
, , X cucurbitae, , , , (, ),
5 X cucurbitae,

Cucurbitaceae

13-

, 12- - 62,4-83,2% , - 2- 3-

6 ,
13

Copyright & A K-C

X. cucurbitae , X. translucens X. campestris, thomonas cucurbitae , .


7. ,
Envinia carotovora subsp. carotovora no .
8. . carotovora
subsp. carotovora - , ,
. Enterobacteriaceae. 79,6 - 90,3%.
.
9. 150 .
19,7% , 61,2% 19% .
10.
.
3 1,3 .
11.
,
( = 0,67).

1. . moschata -70, ,
- F]
14

Copyright & A K-C

2
, ,
.
:
1. , , ., .,
-

// , 1998 2, 137-143

2 , ., , ,

// , 1999 .Y 1, 114-122
3 , , , ,

// , 1999 I, 127-133
4 , ,
, // XXI
. -. , 2000,
95-97
5 , , ,
// . -
- , 2001, 56-57.
6 , , .. Erwinia carotovora subsp carotovora (Jones, 1901)
Dye 1969, //
- : , 2001, . 54-56.
15

Copyright & A K-C

3aic.2V3

127550, , . , 44

'