Вы находитесь на странице: 1из 260

Молодой учёный

№ 12 ( 35 )

Том I

Чита
12
2011
2011 Том I
ISSN 2072-0297

Молодой учёный
Ежемесячный научный журнал
№ 12 (35) / 2011
Том I
Журнал зарегистрирован Федеральной службой по надзору в сфере связи, информационных технологий
и массовых коммуникаций.
Свидетельство о регистрации средства массовой информации ПИ № ФС77-38059 от 11 ноября 2009 г.

Редакционная коллегия:

Главный редактор:
Ахметова Галия Дуфаровна, доктор филологических наук
Члены редакционной коллегии:
Ахметова Мария Николаевна, доктор педагогических наук
Иванова Юлия Валентиновна, доктор философских наук
Лактионов Константин Станиславович, доктор биологических наук
Воложанина Олеся Александровна, кандидат технических наук
Комогорцев Максим Геннадьевич, кандидат технических наук
Драчева Светлана Николаевна, кандидат экономических наук
Ахметова Валерия Валерьевна, кандидат медицинских наук

Ответственный редактор: Шульга Олеся Анатольевна

Художник: Евгений Шишков

Верстка: Павел Бурьянов

Статьи, поступающие в редакцию, рецензируются.


За достоверность сведений, изложенных в статьях, ответственность несут авторы.
Мнение редакции может не совпадать с мнением авторов материалов.
При перепечатке ссылка на журнал обязательна.
Материалы публикуются в авторской редакции.

Адрес редакции:

672000, г. Чита, ул. Бутина, 37, а/я 417.


E-mail: info@moluch.ru
http://www.moluch.ru/
Учредитель и издатель: ООО «Издательство Молодой ученый»
Тираж 1000 экз.
Отпечатано в ООО «Формат»,
г. Чита, ул. 9-го Января, д. 6.
“Young Scientist” . #12 (35) . Vol. I . December 2011 Contents 3

Содержание

физика Николюкин М.М., Кондрашков А.С., Соколов


М.В., Клинков А.С., Болдырев Д.В.
Емельянов А.А., Кобзев А.В., Медведев А.В., Способ девулканизации резиновой крошки
Кобзев А.В. на валковом оборудовании............................34
Модель асинхронного двигателя с переменными
ψ S – iR в Delphi............................................. 6 Плотников М.П.
Компенсация реактивной мощности
в районных сетях.......................................... 37
М А Т Е М А Т И ка
Притула А.Н., Полуянович Н.К.
Мальцева Т.В. Управляемый импульсный источник
О выборе параметрической модели в задаче электропитания частотно-регулируемого
непараметрической идентификации замкнутой озонатора....................................................39
системы.......................................................13 Иванов В.В., Пряжникова А.А., Сметанин А.С.
Эксплуатационные показатели современных
ТЕХНИЧЕСКИЕ НАУКИ твердосплавных СМП производства ОАО «КЗТС»...45

Григоров А.С. Садуллаев А.Б.


О способе интеграции системы обнаружения Состояние примесных атомов с глубокими
аномалий в SQL‑запросах к базе данных уровнями в полупроводниках в условиях
на основе результатов выполнения запроса сильной компенсации....................................48
с приложениями, использующими СУБД Бейбулатова С.И., Селиверов Д.И.
в качестве хранилища данных......................... 21 Современные приборы бесконтактного
Иоффе А.М., Куц М.Л., Пискаев К.Ю., Куц А.В. кодирования рельсовых цепей....................... 50
Вопросы повышения точности АЦП в системах Соловьев Д.Е.
контроля показателей качества электроэнергии... 24 Тепловой режим в горной выработке при ведении
Лоскутников А.А., Сенюшкин Н.С., проходческих работ в условиях криолитозоны... 53
Ялчибаева Л.Н. Токарь О.В.
Управление техническими системами с помощью Технология оценки качества полиграфического
web-интерфейса...........................................28 шрифта........................................................56
Набиуллин А.Ф. Токарь О.В.
Моделирование систем с распределенными Классификация современных полиграфических
параметрами............................................... 30 шрифтов методами поиска латентных
Николаев А.В. факторов.....................................................58
Применение калориферной установки на Шальнова Н.С.
вентиляционном стволе для подогрева воздуха Проблемы и перспективы развития
при реверсии ГВУ в холодное время года.........32 пассажирского транспорта............................. 61
4 Содержание «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Эбзеев М.Б. Дебков Н.М.


Анализ современной концепции эксплуатации Сравнительный анализ структуры
объектов недвижимости.................................64 и производительности древостоев,
сформировавшихся из подроста.................... 112
Юшков В.С.
Диагностика и оценка состояния автомобильных Тарасов С.С.
дорог........................................................... 67 Влияние разных типов питания на степень
окислительной модификации белков плазмы
И нфо р матика крови кролика (Oryctolaguscuniculus)............ 116

Беляков И.А. ГЕОЛОГИЯ


Подход к оцениванию сложности проведения
сертификационных испытаний программного M.H. Ali.
обеспечения................................................ 70 The relation of stream sediment grain sizes and its
geochemical composition: a case study from Wadi
Ершеева Р.М. Himur Area, South Egypt................................ 121
Обзор методов интеграции информационных
ресурсов высших учебных заведений..............75
ГЕOГРАФИЯ
Левандовский В.И.
Прогноз финансового состояния методом Атаев З.В.
сравнения тенденций показателей..................79 Высокогорные ландшафты Восточного Кавказа
и их современное экологическое состояние...130
Макарова О.С.
Способ оценки зависимости качества связи Атаев З.В., Сулейманов А.А.
в системах IP-телефонии от критических Высокогорные озерные геосистемы
параметров IP-сети.......................................83 Джурмутского отрезка Главного Кавказского
хребта....................................................... 134
Миненков А.М., Усатюк В.С.
Методология объектно-ориентированного
программирования на примере модели сетевых
ЭКОНОМИКА И УПРАВЛЕНИЕ
протоколов OSI.............................................86 Ван Нана
Мордвинов А.А. Проблемы экспортной торговли Китая
Triangulation method of projection scanning as и стратегии их решения...............................138
a basis of the combined system for input of three- Велиев З.Т.
dimensional images........................................92 Государственный сектор экономики
Прончев Г.Б., Прончева Н.Г., Гришков А.В. или государственные финансы?.................... 141
Автоматизированная информационная система Домарацкая Т.Ф.
контроля знаний удаленного доступа...............95 Факторинг как перспективный вид банковских
услуг.........................................................148
ХИМИЯ Звягин Л.С.
Системы поддержки принятия управленческих
Струк Н.А.
решений на основе байесовских
Получение атмосферостойкого полимерного
интеллектуальных технологий (БИТ).............. 151
материала с магнитными свойствами.............100
Кудишов О.Г.
БИОЛОГИЯ Меры совершенствования налогообложения
малого бизнеса России................................ 154
Айрапетян М.В. Кузьмичев К.Е., Кузьмичева Е.Е.
Экологическая характеристика зеленой жабы Неполные контракты и дивидендная политика
при обитании в степной зоне Предкавказья.... 103 компаний: теоретические и эмпирические
Гришин Д.В. выводы...................................................... 157
R/K – инверсия клеток или концепция Нестеренко Л.А.
неоднородности жизненной стратегии высших Процессы повышения качества жизни:
эукариот на клеточном уровне...................... 106 региональный аспект................................... 161
“Young Scientist” . #12 (35) . Vol. I . December 2011 Contents 5

Омельченко А.А. Барышникова И.Ю.


Инновационное развитие российской Снятие шестой таинственной печати
экономики................................................. 167 Апокалипсиса (6, 12–17) в стихотворениях
Орлова М.А. И.А. Бунина и иеромонаха Романа................. 217
Зарубежный опыт оценки и отбора персонала,
Биккулова А.Ш.
или как попасть на работу в иностранную
Е.Д. Поливанов – один из первых теоретиков
копанию....................................................170
советской языковой политики...................... 219
Помелова Е.В.
Качество услуг индустрии гостеприимства Бозрикова С.А.
и его оценка............................................... 175 Особенности представления пространства
Рябиченко Д. А. в журналистском нарративе («Хладнокровное
Методы анализа ликвидности банка убийство» Т. Капоте и «101-й километр»
в современных экономических условиях........ 179 М. Осипова)................................................ 224
Рябова М.А. Братчикова Е.А.
Стратегическое планирование – центральное Некоторые аспекты теории и методологии
место стратегического управления современных фоносемантических
агропромышленным комплексом................... 184 исследований............................................. 226
Строганова В.И., Трунина В.Ф. Будкова С.С.
Направления развития аэропортовой
Определение параметров терминологического
инфраструктуры.........................................188
справочника на основе анализа словарных
Turlai I.S. источников................................................230
Die Analyse des Zusammenhangs zwischen
der regionalen Integration und dem ausländischen Видяева А.В.
Direktinvestitionszufluss...............................190 Политические репрессии 1930-х гг. против
писателей Мордовии................................... 233
ФИЛОСОФИЯ Защепкина В.В.
Егоров В.В. Соотношение понятий драматический,
Концепт времени в трудах философов драматургический, театральный текст............ 234
разных эпох............................................... 195 Зотова Л.И.
Челомбицкая М.П., Лавинский Н.Г. «Индийская» новелла и ее своеобразие
Ценностные ориентиры современного в системе прозы Р. Киплинга 1880-х гг........... 237
общества...................................................198
Иванова А.И.
Мартьянов Е.Ю. «Язык книг» и «язык людей»: средства создания
Мораль как конструктная единица создания языкового и художественного параллелизма
художественного образа.............................. 201
в повести Алексея Самойлова «ЯКнига»
Усалко В.О. и особенности его перевода на английский
Мантика как неотъемлемая часть религиозно- язык.......................................................... 244
философской культуры Китая....................... 204
Лафтими И.
Федорова Ю.В.
Общая характеристика и критерии
Анализ основных тенденций институциональных
трансформаций науки.................................. 207 классификации словаря тезаурусного типа..... 252
Саттарова А.Ф.
ФИЛОЛОГИЯ Члены предложения в составе ремы............... 255
Бакмансурова А.Б. Субракова Е.В.
Концепт «азартная игра» в эпоху Средневековья Из топонимики Таштыпского района Республики
(на материале средневерхненемецкого)......... 211 Хакасия (о мотивации некоторых названий)...258
6 Физика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

фи з и к а

Модель асинхронного двигателя с переменными ψ S – iR в Delphi


Емельянов Александр Александрович, ст. преподаватель;
Кобзев Андрей Валерьевич, студент;
Медведев Алексей Владимирович, студент;
Кобзев Антон Валерьевич, студент
Российский государственный профессионально-педагогический университет (г. Екатеринбург)

В работе [2] дан вывод математической модели асинхронного двигателя в векторной форме. В [3] получены диффе-
ренциальные уравнения с переменными ψ S – iR и даны их решения в Matlab-Simulink и Mathcad. В данной статье
приведем решение дифференциальных уравнений в Delphi [5,6] методом Рунге-Кутты четвертого порядка и модифици-
рованным методом Эйлера (Рунге-Кутты второго порядка).
Основные уравнения математической модели асинхронного двигателя, записаны в векторной форме в относительных
единицах, имеют следующий вид [2]:

dψ S
u S = rS ⋅ i S + + j ⋅ α k ⋅ψ S (1)
dt
dψ R
0 = rR ⋅ i R + + j ⋅ (α k - ν ⋅ p ) ⋅ψ R (2)
dt
ψ S = xS ⋅ i S + xm ⋅ i R (3)

ψ R = xR ⋅ i R + xm ⋅ i S (4)
После несложных преобразований, приведенных в [3], получим следующую систему дифференциальных уравнений:

dψ Sα T S 5 ⋅ uSα - ψ Sα + T S 5 ⋅ rS ⋅ k S ⋅ iRα
=
dt T S5
dψ S β T S 5 ⋅ uS β - ψ S β + T S 5 ⋅ rS ⋅ kS ⋅ iRβ
=
dt T S5
k kS k
-iRα - S ⋅ uSα + ⋅ψ Sα - ν ⋅ p ⋅ T R 5 ⋅ iRβ - ν ⋅ p ⋅ S ⋅ψ S β
diRα r5 T S 5 ⋅ r5 r5
=
dt T R5
k kS k
-iRβ - S ⋅ uS β + ⋅ψ S β + ν ⋅ p ⋅ T R 5 ⋅ iRα + ν ⋅ p ⋅ S ⋅ψ Sα
diRβ r5 T S 5 ⋅ r5 r5
=
dt T R5
dv m - mc
=
dt Tm
m ks (ψ S β ⋅ iRα - ψ Sα ⋅ iRβ )
=
“Young Scientist” . #12 (35) . Vol. I . December 2011 Physics 7

Для моделирования выберем АКЗ со следующими паспортными данными и параметрами [4, с. 292] и [1]: P = 320 кВт,
U1 = 380 B, I1 = 324 A, f = 50 Гц, p = 3, RS = 0.0178 Ом, Rr = 0.0194 Ом, LsS = 0.118 Гн, Lsr = 0.123 Гн, Xs = 4.67 Ом,
Xr = 4.675 Ом, Xm = 4.552 Ом, J = 28 кг∙м2. Перевод паспортных данных и параметров из абсолютных в относительные
единицы, а также расчет коэффициентов приведены в [3].
Решение дифференциальных уравнений на языке программирования Delphi методом Рунге-Кутты четвер-
того порядка. Для реализации поставленной задачи запишем вышеуказанные уравнения как функции в разделе
«private»:

private
function dpsisa (psisa,psisb,ira,irb,v,t:real):real;
function dpsisb (psisa,psisb,ira,irb,v,t:real):real;
function dira (psisa,psisb,ira,irb,v,t:real):real;
function dirb (psisa,psisb,ira,irb,v,t:real):real;
function dv (psisa,psisb,ira,irb,v,t:real):real;
function M (psisa,psisb,ira,irb,v,t:real):real;
function usx (t1:real):real;
function usy (t1:real):real;

После нажатия на сочетание клавиш Ctrl+Shift+C получим заготовки, которые компилятор создаст сам. В эти за-
готовки запишем уравнения:

function TMainForm.M (psisa, psisb, ira, irb, v, t: real): real;


begin
M:=ks* (psisb*ira-psisa*irb);
end;

function TMainForm.dira (psisa, psisb, ira, irb, v, t: real): real;


begin
dira:= (-ira-ks*usx (t)/r5+ks*psisa/ (Ts5*r5)-v*p*Tr5*irb-v*p*ks*psisb/r5)/Tr5;
end;

function TMainForm.dirb (psisa, psisb, ira, irb, v, t: real): real;


begin
dirb:= (-irb-ks*usy (t)/r5+ks*psisb/ (Ts5*r5)+v*p*Tr5*ira+v*p*ks*psisa/r5)/Tr5;
end;

function TMainForm.dpsisa (psisa, psisb, ira, irb, v, t: real): real;


begin
dpsisa:= (Ts5*usx (t)-psisa+Ts5*rs*ks*ira)/Ts5;
end;

function TMainForm.dpsisb (psisa, psisb, ira, irb, v, t: real): real;


begin
dpsisb:= (Ts5*usy (t)-psisb+Ts5*rs*ks*irb)/Ts5;
end;

function TMainForm.dv (psisa, psisb, ira, irb, v, t: real): real;


begin
dv:= ((ks* (psisb*ira-psisa*irb))-mc)/Tm;
end;

function TMainForm.usx (t1: real): real;


begin
usx:=cos (t1);
end;
8 Физика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

function TMainForm.usy (t1: real): real;


begin
usy:=sin (t1);
end;

Для определения математических функций Sin и Cos необходимо прописать модуль «Math» в разделе «uses». Со-
здадим раздел констант между разделами «type» и «var» с постоянными mc и p:
const
mc=0;
p=3;
В разделе «var» опишем глобальные переменные:
var
MainForm: TMainForm; – Эта строка создается автоматически.
rr,rs,r5,ks,kr,Tr5,Ts5,Tm:real;
Поместим на форму 2 компонента TChart из вкладки Additional и компонент Button из вкладки Standart.
Щелкнув два раза на каждом компоненте TChart левой кнопкой мыши, появится окно, в котором на вкладке Series
нужно нажать на кнопку Add. Далее выбираем тип графика FastLine, убираем галочку 3D и нажимаем ОК. На вкладке
Legend убираем галочку напротив Visible и нажимаем Close.
Перейдем на вкладку Events в окне Object Inspector, предварительно выделив кнопку.
Щелкнув два раза по позиции OnClick будет автоматически создана процедура по нажатии данной кнопки:
procedure TMainForm.Button1Click (Sender: TObject);
begin
end;
Опишем переменные необходимые только для данной процедуры:
var
dpsisa0,dpsisb0,dira0,dirb0,dv0,t0,M0,
dpsisa1,dpsisb1,dira1,dirb1,dv1,M1,M2,
k1psisa,k2psisa,k3psisa,k4psisa,
k1psisb,k2psisb,k3psisb,k4psisb,
k1ira,k2ira,k3ira,k4ira,
k1irb,k2irb,k3irb,k4irb,
k1v,k2v,k3v,k4v,
dt:Real;
i:Integer;
Зададим начальные условия:
dpsisa0:=0;
dpsisb0:=0;
dira0:=0;
dirb0:=0;
M0:=0;
dv0:=0;
t0:=0;
А также параметры двигателя, необходимые для расчета в относительных единицах:
rr:=0.0165;
rs:=0.015;
r5:=0.031;
ks:=0.975;
kr:=0.974;
Ts5:=223.696;
Tr5:=5.607;
Tm:=783.496;
Назначим шаг интегрирования:
dt:=0.05;
Далее зададим цикл:
i:=0;
while i<10000 do
“Young Scientist” . #12 (35) . Vol. I . December 2011 Physics 9

begin
end;
В данном цикле опишем процедуру расчета системы дифференциальных уравнений методом Рунге-Кутты 4-го по-
рядка. Из курса высшей математики известно, что этот метод описывается следующим образом:
k1 = τ*f (y0)
k2 = τ*f (y0 + 0.5 k1)
k3 = τ*f (y0 + 0.5 k2)
k4 = τ*f (y0 + k3)
y1 = y0 + (k1 + 2 k2 + 2 k3 + k4) / 6
Тогда:
while i<10000 do
begin
// dpsisa
k1psisa:=dpsisa (dpsisa0,dpsisb0,dira0,dirb0,dv0,t0)*dt;
k2psisa:=dpsisa (dpsisa0+0.5*k1psisa,dpsisb0,dira0,dirb0,dv0,t0)*dt;
k3psisa:=dpsisa (dpsisa0+0.5*k2psisa,dpsisb0,dira0,dirb0,dv0,t0)*dt;
k4psisa:=dpsisa (dpsisa0+k3psisa,dpsisb0,dira0,dirb0,dv0,t0)*dt;
dpsisa1:=dpsisa0+ (k1psisa+2*k2psisa+2*k3psisa+k4psisa)/6;
// dpsisb
k1psisb:=dpsisb (dpsisa0,dpsisb0,dira0,dirb0,dv0,t0)*dt;
k2psisb:=dpsisb (dpsisa0,dpsisb0+0.5*k1psisb,dira0,dirb0,dv0,t0)*dt;
k3psisb:=dpsisb (dpsisa0,dpsisb0+0.5*k2psisb,dira0,dirb0,dv0,t0)*dt;
k4psisb:=dpsisb (dpsisa0,dpsisb0+k3psisb,dira0,dirb0,dv0,t0)*dt;
dpsisb1:=dpsisb0+ (k1psisb+2*k2psisb+2*k3psisb+k4psisb)/6;
// dira
k1ira:=dira (dpsisa0,dpsisb0,dira0,dirb0,dv0,t0)*dt;
k2ira:=dira (dpsisa0,dpsisb0,dira0+0.5*k1ira,dirb0,dv0,t0)*dt;
k3ira:=dira (dpsisa0,dpsisb0,dira0+0.5*k2ira,dirb0,dv0,t0)*dt;
k4ira:=dira (dpsisa0,dpsisb0,dira0+k3ira,dirb0,dv0,t0)*dt;
dira1:=dira0+ (k1ira+2*k2ira+2*k3ira+k4ira)/6;
// dirb
k1irb:=dirb (dpsisa0,dpsisb0,dira0,dirb0,dv0,t0)*dt;
k2irb:=dirb (dpsisa0,dpsisb0,dira0,dirb0+0.5*k1irb,dv0,t0)*dt;
k3irb:=dirb (dpsisa0,dpsisb0,dira0,dirb0+0.5*k2irb,dv0,t0)*dt;
k4irb:=dirb (dpsisa0,dpsisb0,dira0,dirb0+k3irb,dv0,t0)*dt;
dirb1:=dirb0+ (k1irb+2*k2irb+2*k3irb+k4irb)/6;
// dv
k1v:=dv (dpsisa0,dpsisb0,dira0,dirb0,dv0,t0)*dt;
k2v:=dv (dpsisa0,dpsisb0,dira0,dirb0,dv0+0.5*k1v,t0)*dt;
k3v:=dv (dpsisa0,dpsisb0,dira0,dirb0,dv0+0.5*k2v,t0)*dt;
k4v:=dv (dpsisa0,dpsisb0,dira0,dirb0,dv0+k3v,t0)*dt;
dv1:=dv0+ (k1v+2*k2v+2*k3v+k4v)/6;
// M
M1:=M0+M (dpsisa0,dpsisb0,dira0,dirb0,dv0,t0)*dt;
M2:= (M1-M0)/dt;
Series1.AddXY (t0,dv1); // График скорости
Series2.AddXY (t0,M2); // График момента
t0:=t0+dt;
dpsisa0:=dpsisa1;
dpsisb0:=dpsisb1;
dira0:=dira1;
dirb0:=dirb1;
M0:=M1;
dv0:=dv1;
Inc (i);
end;
10 Физика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

После нажатия на кнопку Run (F9) получим следующие графики:

Проверим полученный результат решения поставленной задачи модифицированным методом Эйлера.


Модифицированный метод Эйлера (метод рунге-Кутты второго порядка) описывается следующим образом:
уi+1=уi+ (h/2) [f (xi,yi)+f (xi,+h,yi+hf (xi,yi))],
xi+1=xi+h.
Тогда:
while i<10000 do
begin
// dpsisa
dpsisa1:=dpsisa0+ (dpsisa (dpsisa0,dpsisb0,dira0,dirb0,dv0,t0)+
dpsisa (dpsisa0+dpsisa (dpsisa0,dpsisb0,dira0,dirb0,dv0,t0)*dt,
dpsisb0,dira0,dirb0,dv0,t0+dt))*0.5*dt;
// dpsisb
dpsisb1:=dpsisb0+ (dpsisb (dpsisa0,dpsisb0,dira0,dirb0,dv0,t0)+
dpsisb (dpsisa0,dpsisb0+dpsisb (dpsisa0,dpsisb0,dira0,dirb0,dv0,t0)*dt,
dira0,dirb0,dv0,t0+dt))*0.5*dt;
// dira
dira1:=dira0+ (dira (dpsisa0,dpsisb0,dira0,dirb0,dv0,t0)+
dira (dpsisa0,dpsisb0,dira0+dira (dpsisa0,dpsisb0,dira0,dirb0,dv0,t0)*dt,
dirb0,dv0,t0+dt))*0.5*dt;
// dirb
dirb1:=dirb0+ (dirb (dpsisa0,dpsisb0,dira0,dirb0,dv0,t0)+
dirb (dpsisa0,dpsisb0,dira0,dirb0+dirb (dpsisa0,dpsisb0,
dira0,dirb0,dv0,t0)*dt,dv0,t0+dt))*0.5*dt;
// dv
dv1:=dv0+ (dv (dpsisa0,dpsisb0,dira0,dirb0,dv0,t0)+
“Young Scientist” . #12 (35) . Vol. I . December 2011 Physics 11

dv (dpsisa0,dpsisb0,dira0,dirb0,dv0+dv (dpsisa0,dpsisb0,dira0,dirb0,
dv0,t0)*dt,t0+dt))*0.5*dt;
// M
M1:=M0+M (dpsisa0,dpsisb0,dira0,dirb0,dv0,t0)*dt;
M2:= (M1-M0)/dt;
Series1.AddXY (t0,dv1); // График скорости
Series2.AddXY (t0,M2); // График момента
t0:=t0+dt;
dpsisa0:=dpsisa1;
dpsisb0:=dpsisb1;
dira0:=dira1;
dirb0:=dirb1;
M0:=M1;
dv0:=dv1;
Inc (i);
end;

После нажатия на кнопку Run (F9) получим следующие графики:

После сравнения полученных результатов можно сделать следующий вывод: результаты решения методом рунге-
Кутты четвертого порядка и модифицированным методом Эйлера (метод рунге-Кутты второго порядка) полностью
идентичны.

Литература:

1. Шрейнер р.Т. Математическое моделирование электроприводов переменного тока с полупроводниковыми


преобразователями частоты. – Екатеринбург: УрО рАН, 2000. – 654 с.
12 Физика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

2. Емельянов А.А., Клишин А.В., Медведев А.В. Математическая модель АД в неподвижной системе координат с
переменными ψ R – iR // Молодой ученый. – 2010. –№4. – С. 8–24.
3. Емельянов А.А., Медведев А.В., Кобзев А.В., Медведев А.В., Шепельков А.В., Зарубин Е.А., Воробьев А.Н..
Математическая модель АД в неподвижной системе координат в переменныхψ S – iR // Молодой ученый.–
2011.–№4.– С. 7–15.
4. Шрейнер Р.Т. Электромеханические и тепловые режимы асинхронных двигателей в системах частотного управ-
ления. Екатеринбург: ГОУ ВПО «Рос. гос. проф.-пед. ун-т», 2008. –361 с.
5. Фаронов В.В. Delphi. Программирование на языке высокого уровня. – СПб.: Лидер, 2010. – 640 с.
6. Архангельский А.Я. Программирование в Delphi для Windows. Версии 2006, 2007, Turbo Delphi. – М.: ООО
«Бином-Пресс», 2007. – 1248 с.
“Young Scientist” . #12 (35) . Vol. I . December 2011 Mathematics 13

МАТЕМАТИка

О выборе параметрической модели в задаче непараметрической идентификации


замкнутой системы
Мальцева Татьяна Валерьевна, аспирант
Сибирский государственный аэрокосмический университет имени академика М.Ф. Решетнева (г. Красноярск)

В настоящей работе рассматривается задача получения передаточной функции объекта управления по


математической модели замкнутой линейной динамической системы с целью настройки параметров управ-
ляющего устройства (регулятора). Структурный синтез модели замкнутого контура осуществляется ме-
тодами непараметрического моделирования.

В ведение. Несмотря на то, что в последнее время все большее значение приобретают цифровые управляющие
устройства, тем не менее, до сих пор управление многими технологическим процессами осуществляется посред-
ством или при помощи параметрических аналоговых регуляторов различных типов. Поэтому задача настройки параме-
тров таких регуляторов не теряет своей актуальности. Ежегодно разрабатываются различные методики, рекомендации
и инструкции по выбору управляющего устройства и настройке его параметров, которая может быть произведена со-
гласно критериям устойчивости А. Гурвица (1895 г.) и А.В. Михайлова [4] при наличии явного вида передаточных фун-
кций объекта и корректирующих звеньев. При этом предполагается знание передаточной функции объекта управления
или, по меньшей мере, возможность получения его переходной характеристики. В тех случаях, когда структура объекта
управления неизвестна, настройка параметров производится эмпирически, что представляет определенную сложность,
требует временных и финансовых затрат, а в ряде случаев и вовсе нежелательна. Знание явного вида передаточной
функции объекта позволяет довольно просто и качественно настраивать параметры регулятора не на самой системе
управления, а на ее модели [6].
В данной работе рассматривается метод, позволяющий получить передаточную функцию объекта управления в усло-
виях непараметрической неопределенности при любом задающем воздействии (не требует возможности снятия пере-
ходной характеристики). Идея метода заключается в построении модели объекта путем предварительного определения
порядка дифференциального уравнения замкнутой системы методами непараметрического моделирования.
Постановка задачи. Имеется замкнутая линейная динамическая система (ЛДС), корректирующим устройством ко-
торой является параметрический регулятор: пропорциональный (П-типа), пропорционально-интегральный (ПИ-типа)
или пропорционально-интегро-дифференциальный (ПИД-типа), структура которого известна, а значения параме-
тров устанавливаются проектировщиком или иным лицом, контролирующим работоспособность системы. Сведения о
структуре объекта управления отсутствуют, известны только некоторые качественные свойства – стационарный, ли-
нейный динамический объект, на вход которого поступает управляющее воздействие, выработанное параметрическим
*
регулятором (уровень непараметрической неопределенности). Датчики фиксируют значения сигнала x (t ) (задающее
воздействие), поступающего на замкнутую систему (макрообъект), и реакцию системы x(t ) на задающее воздействие
(рисунок 1). Измерения производятся в моменты времени t (i ) . В каналах измерения действует центрированная помеха
с ограниченной дисперсией, сведения о законе распределения помех отсутствуют. Данные измерений формируют об-
учающую выборку некоторого объема n.
Ставится задача получения явного вида передаточной функции объекта управления, которая сводится в свою оче-
редь к задаче построения математической модели замкнутого контура в случае малой априорной информации. Суще-
ствуют различные методы [1, 8], решающие эту задачу, однако сам процесс моделирования зачастую достаточно тру-
доемкий (в основном за счет сложности выбора структуры модели) и требует больших затрат. Задача моделирования
усложняется еще и тем, что измерению поддаются только задающее воздействие и выходной сигнал макрообъекта,
и нет возможности измерить то управление, которое подается на сам объект. В связи с последним обстоятельством
предлагается первоначально получить параметрическую модель замкнутой системы, а затем по ней определить переда-
точную функцию объекта управления.
Задача построения модели замкнутой системы представляет не меньшую сложность. При отсутствии каких-либо
сведений о структуре объекта управления построение параметрической модели весьма проблематично. При включении
14 Математика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Рис. 1. Схема замкнутой динамической системы как макрообъекта

корректирующего устройства и замыкании отрицательной обратной связью структура исследуемой системы становится
сложнее структуры объекта управления, что в свою очередь увеличивает число определяемых параметров, а значит и
сложность параметрического моделирования.
В настоящей работе рассматривается подход, позволяющий избежать сложности подбора динамической структуры
посредством сочетания непараметрических и параметрических методов математического моделирования [3]. Идея за-
ключается в предварительном определении порядка дифференциального уравнения, описывающего объект и последу-
ющем использовании полученной информации в создании параметрической модели. Порядок уравнения предлагается
определять путем построения регрессионной непараметрической модели между входными и выходными сигналами объ-
екта, после чего задача моделирования сводится к определению значений параметров параметрической модели извест-
ными методами, например, методом наименьших квадратов.
Структурный синтез модели замкнутой ЛДС. Первая часть предлагаемого метода основана на определении по-
рядка дифференциального уравнения, описывающего макрообъект при помощи методов непараметрической аппрок-
симации стохастической зависимости входного (в общем случае входных) и выходного (выходных) сигналов. По данным
обучающей выборки строится многомерная непараметрическая оценка регрессии Надарая-Ватсона
[5, 11]:
n
x * (t ) - x * (i ) s x(t - j ) - x(t (i ) - j ) r x * (t - k ) - x * (t (i ) - k )

i =1
xi ⋅ Φ (
h x*
) ⋅ ∏ Φ(
j =1 hx (t - j )
) ⋅ ∏ Φ(
k =1 h x* ( t - k )
)
xˆ (t ) = ,
n
x * (t ) - x * (i ) s x(t - j ) - x(t (i ) - j ) r x * (t - k ) - x * (t (i ) - k )

i =1
Φ (
hx*
) ⋅ ∏
j =1
Φ (
hx (t - j )
) ⋅ ∏
k =1
Φ (
h x* ( t - k )
) (1)


где в качестве аргументов используется как входное воздействие на текущем шаге, так и значения входного и выход-
ного сигналов на предыдущих шагах. Такой подход позволяет учитывать динамику объекта, так как значения выходного
сигнала объекта на нескольких шагах, являясь аргументами оценки регрессии (1) на последующих шагах, влияют на
оценку выхода. Число s предыдущих выходных (r входных) сигналов (которые выступают в (1) в качестве аргументов),
включаемых в модель, является аналогом порядка дифференциального уравнения: чем выше порядок, тем длиннее пе-
риод функционирования объекта, влияющий на последующее его поведение, и тем больше данных, полученных на пре-
дыдущих шагах, мы должны учитывать.
Функция Ф (.) – ядро (колоколообразная, дельтаобразная функция) – удовлетворяет некоторым условиям сходи-
мости [5, 11], влияние же вида ядра на точность оценивания незначительно. В данной работе использовалось парабо-
лическое ядро [2]:
“Young Scientist” . #12 (35) . Vol. I . December 2011 Mathematics 15

( )
___ ___
Параметры h = hx* , hx* ( t - j ) , hx* ( t - k ) , j = 1, s, k = 1, r в формуле (1) – коэффициенты размытости, настройка ко-
торых производится согласно условию минимума среднеквадратичного критерия методом скользящего экзамена. За-
метим, что с ростом h сглаживающие свойства оценки нарастают, по h для каждого конечного объема выборки сущест-
вует некоторый оптимум (при малых h оценка представляет собой набор непересекающихся или слабо пересекающихся
дельтаобразных функций и теряет свой смысл, а при больших h оценка становится сильно сглаженной и не отражает
индивидуальных особенностей оцениваемой зависимости) [7].
Настройка значений коэффициентов размытости в (1) осуществляется одним из методов оптимизации путем мини-
мизации среднеквадратичного критерия:
1 n
W (ñ ) = ⋅ ∑ ( x(i ) - xˆ (t , u , x(t - j ), ñ )
→ min . 2
(4)
n i =1 ñ

В настоящей работе использовался метод случайного спуска, где в качестве алгоритма поиска локального минимума
был выбран последовательный симплексный метод [9].
Последовательно строятся непараметрические модели (1), включающие все большее и большее число аргументов.
Модель, значение критерия (4) для которой оказывается минимальным, считается наилучшей, а число предыдущих из-
мерений выходного s и входного r сигналов, включенных в эту модель, определяют структуру параметрической модели.
Работоспособность описанного алгоритма уже проверялась ранее [3]. В настоящей работе рассмотрим влияние таких
факторов, как частота дискретных измерений входного и выходного сигналов и величина помехи на точность опреде-
ления порядка.
Первоначально рассмотрим вопрос о влиянии шага дискретизации на процесс моделирования. Первоначально рас-
смотрим не зашумленную выборку. Объект управления описывался дифференциальным уравнением второго порядка,
в качестве управляющего устройства использовался ПИ-регулятор. В этом случае дифференциальное уравнение, опи-
сывающее поведение замкнутой системы управления, имело третий порядок. Графические результаты работы непара-
метрического алгоритма в случае, когда шаг дискретизации ∆t = 0.1 , приведены на рисунке 2.

Рис. 2. Результаты непараметрического моделирования

В случае отсутствия помехи при включении в модель двух предыдущих шагов происходит резкое улучшение каче-
ства модели (назовем этот эффект «переломным моментом»), которое, тем не менее, начинает незначительно ухуд-
шаться с дальнейшим увеличением порядка (численные значения критерия (4) при разном значении ∆t представлены
в таблице 1).
Из данных таблицы 1 можно увидеть, что в случае чрезмерно малого значения ∆t непараметрический алгоритм
имеет тенденцию к «занижению» порядка. При увеличении ∆t до определенного значения сначала наблюдается точ-
ность в определении порядка. При чрезмерно большом значении ∆t динамика прослеживается хуже, что приводит к
снижению точности оптимизационной процедуры настройки параметров моделей, а это, в свою очередь, влияет на точ-
ность определения порядка дифференциального уравнения. Малая представительность выборки приводит к тому, что
число измерений становится недостаточным для оптимальной настройки параметров моделей, и «переломный момент»
пропадает. Наблюдается тенденция «мнимого» улучшения качества непараметрических моделей за счет введения до-
полнительных членов, а, следовательно, завышение порядка.
16 Математика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Таблица 1. Зависимость среднеквадратичной ошибки моделирования от шага дискретизации

Число измерений выхода в модели


Шаг выхода в модели
0 1 2 3 4
дискретизации
измерений
0.1 0.5560 0.1352 0.0129 0.0158 0.0166
0.2 0.9889 0.1404 0.0250 0.0171 0.0244
0.4 1.1575 0.1451 0.0301 0.0174 0.0290
0.5 1.2870 0.4270 0.2202 0.1975 0.2266
1 1.0954 0.5676 0.4871 0.4019 0.2506
2 0.9265 0.8976 0.7481 0.5797 0.3915

Далее проведем исследование влияния уровня помехи на точность определения порядка. Для чистоты эксперимента
используем шаг дискретизации ∆t = 0.4 , при котором, как было установлено ранее, для рассматриваемой системы
порядок определяется правильно. По выборочным данным было проведено непараметрическое исследование путем по-
строения моделей (1), графические результаты которого в случае 10%-ой1 помехи приведены на рисунке 3, а численные
значения критерия занесены в таблицу 2.

Рис. 3. Результаты непараметрического моделирования

Таблица 2. Зависимость среднеквадратичной ошибки моделирования от уровня помехи

Число измерений выхода


в модели 0 1 2 3 4
Уровень помехи, %
0 1.1575 0.1451 0.0301 0.0174 0.0290
5 1.1535 0.1283 0.0502 0.0373 0.0438
10 1.1759 0.1559 0.0651 0.0530 0.0705
20 1.1690 0.1923 0.0853 0.0573 0.0779
30 1.2662 0.2120 0.1256 0.1127 0.1142
40 1.3112 0.2706 0.1983 0.1789 0.1834
50 1.4257 0.4531 0.3861 0.3724 0.3649
100 1.5020 0.9355 0.9206 0.8883 0.8461

1 Помеха накладывалась следующим образом: измерялся интервал изменения сигнальной части Δ, задавался уровень помех ρ (от 0 до 1). С по-
мощью генератора случайных чисел формировался вектор (размерность вектора совпадала с объемом выборки) значений равномерно распреде-
ленной на интервале [-Δ.ρ; Δ.ρ] случайной величины, который впоследствии складывался с вектором значений сигнальной части.
“Young Scientist” . #12 (35) . Vol. I . December 2011 Mathematics 17

В случае нулевой помехи (см. рисунок 2) при включении в модель двух предыдущих шагов происходит резкое улуч-
шение качества модели (назовем этот эффект «переломным моментом»), минимум же критерия достигается при вклю-
чении в модель трех предыдущих шагов. Увеличение помехи приводит сначала к тому, что пропадает «очевидность» вы-
бора структуры, а затем к завышению порядка, которое тем больше, чем выше уровень помехи. Отметим, что при этом
пропадает «переломный момент», наблюдаемый при небольших помехах: значение критерия достаточно равномерно
уменьшается с добавлением в модель все большего числа предыдущих шагов. Таким образом, в качестве вывода от-
метим общую тенденцию завышения порядка при больших помехах.
Таким образом, рассматриваемый непараметрический алгоритм структурного синтеза модели имеет тенденцию к за-
вышению порядка при увеличении помехи и шага дискретизации и тенденцию к занижению порядка при слишком ма-
леньком шаге дискретизации. Тем не менее, следует отметить, что «завышение» порядка модели происходит при плохом
качестве выборочных данных: очень высокий уровень помехи или малая представительность выборочных данных, тогда
как «занижение» порядка происходит вследствие неверного выбора ∆t даже при качественной выборке (достаточный
объем, низкий уровень помехи). В ряде случаев неточности определения порядка могут быть устранены на этапе пара-
метрического синтеза за счет исключения из модели тех составляющих, для соответствующих коэффициентов которых
подтверждается гипотеза равенства нулю (при завышении порядка). Однако при «заниженном» порядке проверка ука-
занной гипотезы не приведет к уточнению структуры. В данной работе нас интересует не столько сама модель, сколько
то, как ошибки в структурном синтезе модели могут повлиять на настройку параметров регулятора, а, следовательно,
на качество управления.
Получение передаточной функции объекта. Так как структура модели определена ранее методами непараметри-
ческого моделирования, задача сводится к нахождению оценок неизвестных параметров модели макрообъекта. Пред-
ставим структуру модели в виде разностного уравнения. [8]. Применяя метод наименьших квадратов (в работе рас-
сматривался наиболее простой случай некоррелированных равноточных измерений), получим уравнение для вектора
оптимальных оценок параметров модели [8]. В качестве характеристики точности параметрической модели регрессии
использовалось так называемое значение R2 [1]. Проверка значимости коэффициентов осуществлялась на основании
0.05 Результаты параметрического моделирования представлены на ри-
t-критерия [1], при уровне значимости α = 0.05.
сунке 4.

Рис. 4. Результаты параметрической идентификации моделей

На основании полученной параметрической модели замкнутой системы управления при известной модели управля-
ющего устройства можно получить модель объекта управления (см. пример 1).
Пример 1. Получение передаточной функции объекта управления по уравнению замкнутого контура. Пусть полу-
чена модель макрообъекта в следующем виде:

(5)

Применяя преобразование Лапласа, получим передаточную функцию замкнутой системы


18 Математика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

(6)

Разомкнутая система представляет собой последовательное соединение объекта управления и регулятора [10], а,
следовательно, передаточная функция разомкнутой системы имеет вид (в соответствии с правилом преобразования
цепей):

Используя правило Мейсона для замкнутого контура с единичной отрицательной обратной связью [10]:

и учитывая тот факт, что в качестве управляющего устройства используется ПИ-регулятор, передаточная функция ко-
торого имеет вид [6, 10]

(7)

получаем

(8)

где a = [a0 , a1 , a 2 , a3 ], b0 – коэффициенты объекта управления.


Таким образом, передаточная функция объекта управления имеет вид

(9)

Зная передаточную функцию объекта управления, можно получить значения параметров конкретного типа ре-
гулятора исходя из требования устойчивости замкнутой системы [6, 10]. Таким образом, получение адекватной мо-
дели объекта как минимум позволяет избежать проблем, связанных с «выпадением» системы управления из области
устойчивости, и как максимум обеспечивает возможность выбора таких значений параметров регулятора, которые бы
обеспечивали желаемый результат управления.
Влияние выбора структуры на настройку регулятора. Возникает закономерный вопрос, как влияют установленные
ранее тенденции завышения или занижения порядка при непараметрическом структурном синтезе модели замкнутой
системы на применимость получаемой при этом модели объекта управления к настройке параметров регулятора.
Для того чтобы исследовать это влияние, по построенным ранее параметрическим моделям замкнутой системы (см.
рисунок 4) определим передаточные функции вида (9) соответствующих моделей объекта управления (см. пример 1) и
рассмотрим, как согласуется настройка параметров регулятора на каждой из моделей с тем, что мы при этом получим
на истинном объекте. Следует отметить, что в связи со спецификой задачи идентификации параметров дифференциаль-
ного уравнения, а также с тем фактом, что в каналах измерений действует помеха, коэффициенты передаточной фун-
кции объекта (9) получаются не однозначными и сильно зависят от параметров модели замкнутой системы, полученных
на этапе параметрического синтеза модели. Тем не менее, характер поведения выхода моделей в зависимости от струк-
туры можно проследить (таблица 3).
Таким образом, можно сделать вывод о том, что использование модели, порядок дифференциального уравнения ко-
торой превосходит порядок дифференциального уравнения истинного объекта, при настройке параметров регулятора
значительно «сужает» область устойчивости системы и, следовательно, может не привести к получению качественного
управления (в случае, если оптимальные значения параметров регулятора для истинной системы не принадлежат об-
ласти устойчивости системы управления моделью). В то же время, «занижение» порядка модели может привести к тому,
что при качественном управлении моделью, истинная система даже не окажется устойчивой. При совпадающей струк-
туре модели и истинного объекта область устойчивости оказывается примерно одинаковой, и результаты настройки па-
раметров регулятора на такой модели могут привести к значительному повышению качества управления истинным объ-
ектом. В связи с вышесказанным следует отметить, что при выборе структуры лучше завысить порядок модели, чтобы
избежать неустойчивости истинной системы при полученных на модельной системе параметрах регулятора.
“Young Scientist” . #12 (35) . Vol. I . December 2011 Mathematics 19

Таблица 3. Настройка параметров регулятора на различных моделях объекта

Порядок модели ниже Структуры модели и объекта Порядок модели выше Истинный объект
порядка объекта совпадают порядка объекта
Случай 1

При исходных настройках регулятора выход замкнутой системы в случае управления истинным объектом и всеми полу‑
ченными моделями расходится с задающим воздействием: требуется корректировка параметров регулятора. Система
при этом устойчива во всех случаях.
Случай 2

Изменение параметров регулятора привело к повышению качества управления при использовании моделей более низ‑
кого и совпадающего порядка, однако система управления моделью более высокого порядка, нежели порядок объекта,
оказалась неустойчивой. Управление истинным объектов при этом улучшилось. Там не менее, все еще наблюдается рас‑
хождение выхода системы с задающим воздействием при управлении как моделями с более низким и совпадающим по‑
рядком, так и истинным объектом.
Случай 3

Оптимальные параметры регулятора для системы управления моделью совпадающего порядка привели к улучшению ка‑
чества управления моделью более низкого порядка, а также истинным объектом. Система управления моделью более
высокого порядка неустойчива.
Случай 4

Оптимальные параметры регулятора для системы управления моделью более низкого, чем порядок объекта, порядка
приводят к тому, что система управления моделью совпадающего порядка перестает быть устойчивой. Истинная система
также становится неустойчивой.
Замечание: на всех графиках, приведенных в таблице, сравнивается выход замкнутой системы с задающим воздейст‑
вием; по оси абсцисс – время, по оси ординат – выход системы.
20 Математика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Литература:

1. Дрейпер Н., Смит Г. Прикладной регрессионный анализ, 3-е изд.: Пер с англ. – М.: Издательский дом «Ви-
льямс», 2007. – 912 с.
2. Лагутин М.Б. Наглядная математическая статистика: Учеб. пособие / М.Б. Лагутин. – М.: БИНОМ. Лабора-
тория знаний, 2007. – 427 с.
3. Мальцева Т.В. Об одном методе построения математической модели линейного динамического объекта /
Т.В. Мальцева// Материалы журнала «Молодой ученый», 2008, с. 40–48.
4. Михайлов А.В. Метод гармонического анализа в теории регулирования//Автоматика и телемеханика. – 1938. –
№3. – с. 27–81.
5. Надарая Э.А. О непараметрических оценках плотности вероятности и регрессии// Теория вероятностей и ее
применение. 1965. Т.10 (1). с. 199–203.
6. Ротач В.Я. Теория автоматического управления: Учеб. пособие / В.Я. Ротач. – М.: МЭИ, 2004. – 395 с.
7. Рубан А.И. Идентификация стохастических объектов на основе непараметрического подхода// Автоматика и
телемеханика. – 1979. – N 11. – с. 106–118.
8. Пащенко Ф.Ф. Введение в состоятельные методы моделирования систем: Учеб. пособие: В 2-х ч. Ч. 2. Иденти-
фикация нелинейных систем. – М.: Финансы и статистика, 2007. – 288 с.
9. Химмельблау Д. Прикладное нелинейное программирование.– М.: Мир, 1975. – 534 с.
10. Юревич Е.И. Теория автоматического управления/ Е.И.Юревич. – СПб: БХВ-Петербург, 2007. – 560 с.
11. Watson G. Smooth regression analysis //Sankhya, ser.A. 1965. Vol.26, part 4. P.~359–372.
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 21

Т Е Х Н И Ч Е С К И Е НА У К И

О способе интеграции системы обнаружения аномалий в SQL‑запросах


к базе данных на основе результатов выполнения запроса с приложениями,
использующими СУБД в качестве хранилища данных
Григоров Андрей Сергеевич, аспирант
Череповецкий государственный университет

И нформационные системы активно входят в нашу по-


вседневную жизнь: большое количество информации
и документов переносится в электронный вид, всё больше
На сегодняшний день одной из самых распространённых
архитектур информационных систем является архитек-
тура «клиент-сервер». Данная архитектура подразуме-
услуг можно получить через интернет, а бизнес процессы вает разделение информационной системы на поставщика
современного предприятия становится сложно представить услуг (сервер) и потребителя (клиент). Информационная
без использования новейших информационных технологий. система, построенная на базе клиент-серверного подхода,
Но наряду с несомненными выгодами, которые даёт исполь- может быть реализована в виде двухзвенной или многоз-
зование информационных систем, существует и ряд про- венного приложения. Так, например, при двухзвенной ар-
блем. Одной из таких проблем является проблема инфор- хитектуре в качестве сервера может выступать СУБД, а
мационной безопасности и защиты информации. Ущерб от в качестве клиента – программа, взаимодействующая
раскрытия конфиденциальной или секретной информации с СУБД посредством специализированных компонент
может быть значительным и даже может привести к разо- (драйверов) и отвечающая за представление данных поль-
рению предприятий, коммерческий успех которых основан зователю. Развитие двухзвенной архитектуры привело к
на использовании «ноу-хау». Поэтому грамотно про- выделению дополнительных звеньев. Среди многозвенных
ведённые мероприятия по организации информационной архитектур «клиент-сервер» остановимся на трёхзвенной
безопасности становятся залогом успеха в деятельности архитектуре, в которой функция обработки данных выне-
многих организаций. Одной из возможных составляющих сена в отдельное звено. При таком подходе происходит
комплексной защиты может выступать использование спе- разделение функций хранения, обработки и представ-
циализированных систем обнаружения вторжений (СОВ) ления данных. Примером использования трёхзвенной ар-
в базы данных, целью работы которых является выявление хитектуры являются приложения, разработанные в соот-
действий способных нарушить конфиденциальность, це- ветствии с рекомендациями технологической платформы
лостность и доступность хранящихся данных. Java EE [4]. Так распределённое многоуровневое Java EE
Среди перспективных направлений развития СОВ приложение состоит из:
можно выделить СОВ, которые базируются на методах 1. клиентский уровень (клиентское приложение);
обнаружения аномалий в SQL-запросах к базе данных, в 2. сервер приложений Java EE (web-уровень и уровень
частности в последние годы получили развитие идеи вы- бизнес логики);
явления аномалий в SQL-запросе на основе оценки ре- 3. сервер хранения данных (СУБД).
зультатов его выполнения [1, 2, 3]. Отметим, что пред- При подобной архитектуре клиентское приложение
лагаемые подходы являются логичным расширением напрямую не взаимодействует с СУБД и, вообще говоря,
методов, основная идея которых заключается в детекти- в общем случае не обладает информацией о типе храни-
ровании аномального поведения пользователей путём лища данных (это может быть как СУБД, так и другие
осуществления синтаксического анализа текста запроса источники данных, например, файловый репозиторий
до его непосредственной передачи на обработку в систему или удалённый веб-сервис). В данной ситуации посред-
управления базами данных (СУБД). Согласно [3], ме- ником между клиентским приложением и СУБД высту-
тоды, основанные на оценке результатов выполнения за- пает сервер приложения, который получает запросы от
просов, позволяют более эффективно обнаруживать не- клиентского приложения, в случае необходимости обра-
которые виды атак, нежели методы, базирующиеся на щается к СУБД и возвращает сформированный ответ.
синтаксическом анализе, что говорит об актуальности за- Многоуровневая архитектура помимо декомпозиции,
дачи использования данных методов в СОВ и, как след- приводящей к уменьшению зависимости между отдель-
ствие, организации интеграции подобных СОВ с различ- ными элементами, позволяет и более гибко организо-
ными информационными системами. вать защиту отдельных компонентов, например, «спря-
22 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

тать» сервер СУБД за серверами приложений. Зачастую Одним из вариантов добавления функции проверки
интеграция модуля обнаружения аномалий в уже сущест- данных, возвращаемых из хранилища данных, может
вующую программу, которая проектировалась и разраба- быть экранирование хранилища данных специальным
тывалась без учёта возможности подобных расширений, объектом, реализующим интерфейс источника данных.
представляет собой сложную и подчас неразрешимую за- Данный объект становиться посредником между моду-
дачу. Наибольшие трудности возникают при работе с мо- лями системы и хранилищем данных. Так все запросы,
нолитными системами, программные компоненты которых адресованные хранилищу данных, и все возвращаемые
сильно связаны и зацеплены между собой, что приводит данные будут проходить через этот объект-посредник.
к отсутствию возможности замены одной части системы Причём для модулей, обращающихся к источнику данных,
на другую, выполняющую ту же функцию. Одним из спо- видимых изменений не будет – объект-посредник станет
собов избежать подобной проблемы является проектиро- для них лишь новой реализацией интерфейса доступа к
вание системы, как набора слабо связанных модулей, вы- данным. Описанная модель представлена на рисунке 2.
полняющих строго определённые задачи. Причём задачи, На диаграмме представлен класс IDSDataSource, ко-
выполняемые в рамках одного модуля, должны быть од- торый реализует интерфейс источника данных DataSource.
нотипными и логически связанными. Удачным реше- Все запросы, поступающие к IDSDataSource через интер-
нием может быть определение для каждого модуля про- фейс DataSource, делегируются классу RealDataSource,
граммы строго определённого интерфейса, через который который непосредственно осуществляет предоставление
другие модули смогут к нему обращаться. Применение та- данных. Последовательность действий, выполняющихся
кого подхода позволит при необходимости заменить одну при обращении к источнику данных, показана рисунке 3.
реализацию интерфейса модуля на другую, при этом из- Как видно из рисунка, сначала запрос за данными по-
менения других модулей не потребуется, так как все вза- ступает к объекту-посреднику, который затем передаёт
имодействия между модулями производятся через неиз- этот запрос далее «спрятанному» источнику данных, ко-
менный интерфейс. торый в свою очередь обрабатывает запрос и возвращает
Продолжая рассматривать трёхзвенную архитектуру запрашиваемые данные. Эти данные передаются объекту-
Java EE, можно сказать, что наиболее удачным местом для посреднику, который выполняет их анализ и по итогам
встраивания СОВ является место между сервером прило- анализа, в случае если результат признаётся допустимым,
жений Java EE и СУБД. Действительно, в такой ситуации передаёт данные тому, кто их запрашивал.
СОВ может контролировать все запросы, которые сервер При таком подходе возможно организовать различное
приложений адресует СУБД, и все результаты выпол- поведение системы обнаружение аномалий. Так объект-
нения запросов, которые СУБД направляет в ответ. посредник может работать в следующих режимах:
В общем виде СУБД можно представить как модуль – Синхронный режим. При таком подходе объект-по-
программы, который отвечает за предоставление данных средник выполняет оценку переданного ему результата и
в соответствии с протоколом взаимодействия, опреде- только после завершения анализа передаёт данные далее
лённым строгим интерфейсом. Обращение других мо- по цепочке.
дулей программы к данному модулю представляют – Асинхронный режим. При асинхронном режиме
наибольший интерес, ведь именно во время этого взаимо- объект-посредник, получив результат выполнения за-
действия происходит передача данных из СУБД к компо- проса, не задерживает его, а сразу передаёт его тому ком-
нентам программы, которые занимаются подготовкой от- поненту, от которого поступил запрос. При этом анализ
вета пользователю системы. На рисунке 1 представлена результата запроса производится в отдельном потоке.
модель обращения модулей программы к СУБД через У каждого подхода есть как преимущества, так и недо-
определённый интерфейс. статки. При работе в синхронном режиме у объекта-по-

DataSourceClient1
<<Interface>>
DataSource

DataSourceClient2 getData()

RealDataSource

Рис. 1. Организация доступа к данным через определённый интерфейс


“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 23

DataS ourceClient1
<<Interface>>
DataSource

DataS ourceClient2 getData()

delegate
IDSDataSource RealDat aSource

Рис. 2. Использование объекта-посредника для добавления проверки возвращаемых данных

Рис. 3. Процесс обработки запроса к базе данных

средника есть возможность прервать дальнейшую пере- В заключении следует сказать, что в настоящее время
дачу данных в случае, если при анализе будет выявлена спектр архитектурных решений и подходов, применяемых
аномалия. Однако при синхронной обработке может су- при создании программного обеспечения, весьма широк.
щественно увеличиться время отклика системы на за- Инструментальных арсенал разработчиков ежедневно по-
просы. С другой стороны работа в асинхронном режиме полняется новыми утилитами, библиотеками, фреймвор-
позволяет производить оценку результата параллельно ками, охватывающими и упрощающими различные этапы
основному процессу выполнения запросов, что должно разработки и эксплуатации информационных систем. Но,
снизить временные задержки. Но в то же время может несмотря на это, интеграция информационных систем и
оказаться так, что процесс обнаружение аномалий в ре- систем обнаружения вторжений зачастую затруднена в
зультате запроса завершиться уже позже того, как данные виду ряда возможных причин:
будут переданы пользователю. В таком случае системе об- – Используемое архитектурное решение не позволяет
наружения вторжений остаётся лишь зафиксировать факт расширять функционал приложения, подключая или за-
аномалий и, возможно, предпринять меры для предотвра- меняя в нём существующие модули и компоненты.
щения выполнения впредь подобных запросов. – Разнородность программно-аппаратного окружения,
24 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

в котором функционирует СОВ и приложение. Таким образом, разработка архитектурных подходов и


– Отсутствие возможности предоставления приложе- методов разрешение подобных проблем является необхо-
нием информации, необходимой для полноценного фун- димым условием успешной интеграции информационных
кционирования СОВ. систем и систем обнаружения вторжений в базы данных.

Литература:

1. Mathew S., Petropoulos M., Hung Q. Ngo, Shambhu Upadhyaya. A Data-Centric Approach to Insider Attack
Detection in Database Systems // Recent Advances in Intrusion Detection: 13th International Symposium, RAID,
2010 – P. 382–401.
2. Григоров А.С. Обнаружение аномалий запросов к базе данных методом определения уровня связанности ре-
зультата выполнения запроса // Вузовская наука – региону. Материалы 8-й всеросс. научно-техн. конф. – Во-
логда: ВоГТУ, 2010.
3. Григоров А.С. Метод обнаружения аномалий запросов к базе данных на основе кластеризации результата вы-
полнения запросов // Материалы всероссийской научно-практической конференции «Череповецкие научные
чтения – 2010» – Череповец: ГОУ ВПО ЧГУ, 2010.
4. Java EE Technical Documentation [http://download.oracle.com/javaee/]

Вопросы повышения точности АЦП


в системах контроля показателей качества электроэнергии
Иоффе Антон Михайлович, студент;
Куц Максим Леонидович, студент;
Пискаев Кирилл Юрьевич, ст.преподаватель
Пензенская государственная технологическая академия

Куц Александр Валентинович, начальник сектора программно-технических комплексов НТЦ-4


ОАО «НПП «Рубин» (г. Пенза)

П роблема контроля качества электрической энергии


всегда являлась актуальной и в настоящее время ей
уделяется всё большее внимание. Это связано с тем, что
Использованиеавтоматизированных информационных
систем обусловлено тем, что они могут гораздо быстрее и
по большему количеству характеристик определить уро-
использование современного технологического (станки и вень качества поставляемой электроэнергии, а так же ор-
автоматизированные системы управления) и информаци- ганизовать не только контроль качества, но и контроль
онного оборудования (персональные компьютеры, сети расхода энергоресурсов.
и средства связи), приводит к увеличению потребления Анализ ряда публикаций [1–7] по теме показал на-
электрической энергии и повышении требований к её ка- личие тенденции наприменение интеллектуальных ин-
честву, а также к необходимости использования более эф- формационных систем, позволяющих реализовать раз-
фективных источников питания. личные методы интеллектуальной обработки и анализа
На рынке существует большое число устройств по- данныхдля мониторинга показателей качества электроэ-
зволяющих, контролировать качество электроэнергии. нергии (ПКЭ).Выражение «интеллектуальная система»
Среди всего этого многообразия можно выделить как от- сегодня применяют, чтобы представить любуюкомбина-
дельные устройства, так и целые системыконтроля каче- циюс использованием искусственных нейронных сетей,
ства электроэнергии. экспертных систем, систем нечеткой логики, а также
С точки зрения руководства предприятий контроль других технологий, например, таких как генетические ал-
качества электроэнергии необходим, потому что элек- горитмы [7].
троэнергия низкого качества вызывает прерывание Очевидно, что в ближайшеевремя для контроля каче-
производственных процессов, приводящее к большим ства электрической энергии на предприятиях будут ис-
убыткам. Системы контроля качества электроэ- пользовать полностью автоматизированные информа-
нергии помогают предотвратить опасность остановки ционные системы, осуществляющиемониторинг ПКЭ с
производства,а так же необходимы для осуществления помощью различных интеллектуальных технологий ана-
контроля и учета финансовых затрат на получение ко- лиза данных.Основными составляющими подобных си-
нечного продукта. стем выступают устройства первичного сбора (УПС) и
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 25

центры обработки и анализа данных. Основные функции Согласно ГОСТ 13109–97 и ГОСТ Р 51317.4.30–
УПС целесообразно ограничить оцифровкой сигналов 2008 анализу должны подвергаться сетевые сигналы в
электрической энергии, их первичной обработкой и пере- диапазоне до 3 кГц. Для анализа сигналов с целью вы-
дачей в центр обработки и анализа, в качестве которого числения ПКЭ необходимо обеспечить получение как ми-
может использоваться вычислительный центр (ВЦ) пред- нимум 8–10 отсчетов на период анализируемого сигнала,
приятия. Уменьшение функций УПС и современный уро- а,следовательно,частота дискретизации должна быть
вень развития элементной базы позволяет снизить стои- более 25 кГц.
мость и габаритные размеры данных устройств, что в свою В линейке микросхем АЦП компания AnalogDevices
очередь позволит использовать большее число УПС в со- (одного из лидеров в отрасли производства высокоточных
ставе системы, повысив её эффективность за счет увели- АЦП) имеется серия интегральных микросхем ADE, пред-
чения числа точек контроля. назначенных для создания устройств контроля ПКЭ.
Повышение точности и, как следствие, эффективности Среди интегральных микросхем данной серии можно вы-
работы рассматриваемых систем, возможно за счет по- делить модель ADE7754, как имеющую наиболее расши-
вышения точности первичных измерительных данных, на ренный функционал для анализа сигнала электрических
основе которых производится вычисление ПКЭ, что под- сетей и определения ПКЭ. В ADE7754 аналого-цифровое
тверждается анализом работ [8,9].Врассмотренных пу- преобразование производится посредством ΣΔ-АЦП вто-
бликациях, посвященных разработке интеллектуальных рого порядка, работающего на частоте передискрети-
информационных системконтроля ПКЭ, вопросам по- зации 833кГц и позволяющего оцифровывать входные
строения УПС обеспечивающих повышенную точность сигналы с частотами 26 кГц, 13 кГц и 6,5 кГц [10].
первичных измерительных данных уделяется недоста- Несмотря на то, что выходные кодовые слова представ-
точно внимания. ляют собой 24-разрядные числа, согласно особенностям
Точность получаемых вУПС цифровых сигналов опре- сигма-дельта архитектуры и данным таблицы 1можно ут-
деляется характеристиками аналого-цифрового преобра- верждать, что эффективная разрядность данной микрос-
зователя (АЦП) и понижающего трансформатора, ис- хемы в процессе эксплуатации будет ниже номинальной.
пользуемого для согласования сетевого напряжения с Стоит вопрос о возможности повышения точности полу-
входным диапазоном АЦП. В данной работе рассмотрим чаемой измерительной информации без изменения имею-
вопросы повышения точности АЦП, считая, что имеем щейся структуры АЦП. Решение данной задачи возможно
идеальный понижающий трансформатор. с помощью алгоритмов адаптивной обработки, предло-
Самыми точными АЦП на данный момент являются женных в [14,15].
АЦП ссигма-дельта архитектурой (ΣΔ-АЦП). Однако Проверка эффективности применения метода адап-
особенностью данной архитектуры является повышение тивной обработки проводилась с помощью математи-
точности преобразования,за счет увеличения времени ческой модели в среде математического моделирования
преобразования, что влечет за собой понижение быстро- MATLAB версии R2010b. Структурная схема модели пока-
действия. В таблице 1 приведены технические характери- зана на рисунке 1. Она состоит из источника входного сиг-
стики ряда интегральных микросхем ΣΔ-АЦП [10,11], ил- нала, сигма-дельта модулятора первого порядка и усред-
люстрирующие данную особенность. Из таблицы видно, няющего цифрового децимационного фильтра с АЧХ вида
что эффективная разрядность АЦП уменьшается с увели- sin (x)/x. Использование в моделиданной структуры пра-
чением частоты дискретизации преобразуемых сигналов. вомерно, так как алгоритм может аналогично приме-

Таблица 1. Зависимость точностных характеристик микросхем ΣΔ-АЦП от частоты преобразования

Модель АЦП Характеристики


Эффективная разрешающая способность:
22 бита, при частоте 9,5 Гц
AD7791
20 бит, при частоте 33,3 Гц
18 бит, при частоте 120 Гц
Эффективная разрешающая способность:
AD7195 24 бита, при частоте 4,7 Гц
20 бит, при частоте 4,8 кГц
Динамический диапазон:
AD7765 115 дБ, при частоте 78 кГц
112 дБ, при частоте 156 кГц
Отношение сигнал/шум:
ADS1274 111 дБ, при частоте 52 кГц
106 дБ, при частоте 144 кГц
26 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Рис. 1. Структурная схема исследуемой модели ΣΔ-АЦП


x (t) – входной аналоговый сигнал; k – коэффициент передискретизации; fд , Tд – частота и период дискретизации
входного сигнала; y (nTд) – выходной код преобразователя.

а) Входной аналоговый сигнал.

б) Полученные после преобразования сигналы.

в) Графики абсолютной погрешности результатов преобразования.

Рис. 2. Результаты математического моделирования


“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 27

няться со структурами более высоких порядков и со слож- (структуры модулятора, входных усилителей, источников
ными системами фильтрации, что обусловлено самим опорных напрряжений и т.д.), и может выполнятся циф-
принципом используемой адаптивнойобработки. ровым процессором, являющимся обязательнойсостав-
В качестве входного сигнала использовался полигар- ляющейлюбого ΣΔ-преобразователя.
монический сигнал имитирующий сумму идеального сете- Таким образом, при проектировании УПС систем
вого напряжения с частотой 50Гц и 40-ой гармоникивели- контроля ПКЭ,повышение точности преобразуемых
чиной 10 % от сетевого напряжения (рисунок 2).Частота данных возможно за счет использования ΣΔ-АЦП более
дискретизации fд выбрана равной 40 кГц, для получения 20 высокого класса точности. Однако данное решение может
отсчетов цифрового сигнала на период 40-ой гармоники, а привести к увеличению конечной стоимости УПС, к тому
коэффициент передискретизации k = 100. Результаты ма- же большинство высокоточных АЦП, представленных
тематического моделирования приведены на рисунке 2. сегодня на рынке, не удовлетворяют решению
Проведенный анализ показал, что в рамках реша- поставленной задачи по быстродействию.Альтернативой
емой задачи, для повышения точности измерительной может служить использование алгоритмов адаптивной об-
информации, могут быть использованы уже применя- работки вуже применяемых ΣΔ-преобразователях, обес-
емые ΣΔ-АЦП совместно с методами адаптивной обра- печивающих необходимое быстродействие, хотя данное
ботки. Адаптивная обработка производится в цифровом решение потребует больших затрат на процесс разра-
виде, что не требует изменения аналоговой части ΣΔ-АЦП ботки.

Литература:

1. М.Ю. Михеев, А.В. Коновалов, А.Г. Дмитриенко. Экспертная система контроля качества электрической
энергии. // Труды международной научно-технической конференции «Современные информационные техно-
логии». – Пенза: Пензенская государственная технологическая академия, 2005г, вып. 2., с. 62–66.
2. М.Ю. Михеев, А.В. Коновалов, А.Г. Дмитриенко. Имитационное моделирование системы контроля качества
электрической энергии. // Труды международной научно-технической конференции «Современные информаци-
онные технологии». – Пенза: Пензенская государственная технологическая академия, 2005г, вып. 2., с. 81–84.
3. М.Ю. Михеев, А.Г. Дмитриенко, Т.В. Жашкова. Нейросетевая идентификация показателей качества элек-
трической энергии. // Надежность и качество: труды Международного симпозиума:в 2-х томах/под ред. проф.
Н.К.Юркова. – Пенза: Информационно-издательский центр ПензГУ. 2009. – 1 т., с. 439–441.
4. О.В. Башкиров, П.П. Першенков, Е.А. Тюрин. Определение вклада потребителя в изменение показателей ка-
чества электрической энергии. // Надежность и качество: труды Международного симпозиума: в 2-х томах/под
ред. проф. Н.К.Юркова. – Пенза: Информационно-издательский центр ПензГУ. 2009. – 2 т., с. 77–78.
5. О.В. Башкиров, П.П. Першенков, Е.А. Тюрин. Один из путей повышения точности показаний счетчиков электри-
ческой энергии.//Надежность и качество: труды Международного симпозиума/под ред. проф. Н.К.Юркова. –
Пенза: Изд-во Пенз. гос. ун-та, 2005г, с. 362–365.
6. К.С. Ефремов, В.К. Барсуков. Измерительная система для определения качества электрической энергии. //
Труды международной научно-практической конференции «Образовательные, научные и инженерные прило-
жения в среде LabVIEW и технологии NationalInstruments». – Москва: Российский институт дружбы народов,
2006г, с. 200–207.
7. Ю. Е. Варецкий, Т.И. Наконечный, Н.Д. Федонюк, В.А. Комар. Архитектура интеллектуальной системы мони-
торинга несинусоидальных режимов электрической сети. // Научные труды ВНТУ, № 1, 2010 г.
8. Патент РФ № 2298194 Способ измерения действующего значения напряжения в электрических цепях пере-
менного тока // А.В. Кудашев, В.Д. Михотин, В.И. Чернецев (заявка № 2006108101, приоритет изобретения
15.03.2007 г.)
9. А.В. Кудашов. Измеритель параметров сетевого напряжения. // Диссертация на соискание ученой степени
кандидата наук. – Пенза: Пензенский государственный университет, 2007 г.
10. Официальный сайт компании AnalogDevices: http://www.analog.com
11. Официальный сайт компании TexasInstruments: http://www.ti.com
12. ГОСТ 13109–97 Электрическая энергия. Совместимость технических средств электромагнитная. Нормы каче-
ства электрической энергии в системах электроснабжения общего назначения.
13. ГОСТ Р 51317.4.30–2008 (МЭК 61000–4-30:2008) Электрическая энергия. Совместимость технических
средств электромагнитная. Методы измерения показателей качества электроэнергии.
14. Юрманов В.А., Пискаев К.Ю., Куц А.В. ∑∆-АЦП: адаптивная обработка результатов преобразования. // Во-
просы радиоэлектроники серия общетехническая выпуск 2, 2011 г., с. 84–101.
15. К.Ю. Пискаев, В.С. Подшивалов. Алгоритм адаптивной обработки для ΣΔ-АЦП на основе метода кодирования
Лемпеля-Зива-Велча. // Молодой ученый. – 2011. – № 9. – С. 48–53.
28 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Управление техническими системами с помощью web-интерфейса


Лоскутников Александр Александрович, кандидат технических наук, доцент;
Сенюшкин Николай Сергеевич, кандидат технических наук, старший научный сотрудник;
Ялчибаева Лиля Наильевна, студент
Уфимский государственный авиационный технический университет

Л юбую автоматическую систему управления техниче-


скими системами разных уровней сложности (от ро-
утера в домашней сети до гидроэлектростанции) можно в
бованиям работы в режиме реального времени, была
компактна и имела возможность запуска из ПЗУ или
флеш-памяти. Также операционная система должна под-
конечном итоге разделить на 3 основных уровня иерархии. держивать работу в сетях Ethernet, Arcnet, Serial и Token
Самым нижним уровнем является уровень датчиков и Ring и обеспечивать более чем один путь для коммуни-
исполнительных механизмов, которые устанавливаются кации, а также балансировку нагрузки в сетях. Если кабель
непосредственно на технологических объектах. Их дея- или сетевая плата выходят из строя и связь прекращается,
тельность заключается в получении параметров процесса, то система будет автоматически перенаправлять данные
преобразовании их в соответствующий вид для даль- через другую сеть. Это предоставляет пользователю авто-
нейшей передачи на более высокую ступень (функции матическую сетевую избыточность и увеличивает скорость
датчиков), а также в приеме управляющих сигналов и в и надежность коммуникаций во всей системе.
выполнении соответствующих действий (функции испол- Верхний уровень в системе автоматизации тесно связан
нительных механизмов). с понятием «web-интерфейс». Веб-интерфейс – это со-
Средний уровень – уровень производственного вокупность средств, при помощи которых пользователь
участка. взаимодействует с технической системой (сайтом, базой
Его функции: данных) через веб-приложение. Практически всегда над
– сбор информации, поступающей с нижнего уровня, его разработкой работает группа программистов. Веб-ин-
ее обработка и хранение; терфейсы удобны тем, что дают возможность вести сов-
– выработка управляющих сигналов на основе анализа местную работу сотрудникам, не находящимся в одном
информации; офисе, позволяют реализовать эргономичное управление
– передача информации о производственном участке на техническими системами, отводя управляющим и испол-
более высокий уровень. няющим системам наиболее удобные зоны расположения.
Верхний уровень в системе автоматизации занимает Основные требования к качественным интерфейсам:
т.н. уровень управления. На этом уровне осуществля- кроссбраузерность (адекватное отражение в разных бра-
ется контроль за производством продукции. Этот процесс узерах), удобность в пользовании для потребителя, на-
включает в себя сбор поступающих с производственных личие удобной панели навигации и еще многое другое.
участков данных, их накопление, обработку и выдачу ру- Рассмотрим основные принципы работы и создания
ководящих директив нижним ступеням. Атрибутом этого веб-интерфейса на примере системы управления базами
уровня является центр управления производством, ко- данных (СУБД). Приведенные ниже способы реализации
торый может состоять из трех взаимопроникающих частей: могут быть применены для любой системы, в том числе и
1) операторской части, технической.
2) системы подготовки отчетов, В последнее время существует тенденция создания
3) системы анализа тенденций. «красивых» мультимедийных Entranet приложений, со-
На верхнем уровне АСУ ТП размещены мощные держащих много документов и объектов со сложной
компьютеры, выполняющие функции серверов баз структурой. Для реализации таких приложений наиболее
данных и рабочих станций и обеспечивающие анализ и предпочтительно использовать объектные СУБД вслед-
хранение всей поступившей информации за любой за- ствие их способности быстро работать с данными сложной
данный интервал времени. а также визуализацию инфор- структуры. Основным протоколом при работе браузера
мации и взаимодействие с оператором. Основой програм- c Internet является протокол HTTP (HyperText Transfer
много обеспечения вырхнего уровня являются пакеты Protocol – протокол передачи гипертекста). Этот про-
SCADA (Supervisory Control And Data Acquisition – си- токол предполагает взаимодействие браузера (Web-кли-
стемы управления и доступа к данным). ента) c HTTP-сервером по принципу «вопрос – ответ»,
Промышленные контроллеры и компьютеры. располо- т.е. браузер посылает запрос HTTP-серверу на инфор-
женные на средне уровне АСУТП играют роль управля- мацию, а Web-сервер отсылает клиенту сформированную
ющих элементов. принимающих цифровую информацию и HTML (HyperText Markup Language – язык разметки ги-
передающих управляющие сигналы. пертекста страничку и «забывает» о клиенте.
Операционные системы контроллеров должны удов- Обычно, работа клиентов с базами данных также стро-
летворять не только требованиям открытости, но и тре- ится либо по принципу «вопрос – ответ», либо ориенти-
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 29

рована на поддержание постоянного соединения «Login – может пользоваться всеми ресурсами, доступными сер-
Logout». По принципу «вопрос – ответ» обычно работают веру. Это положительно сказывается на производитель-
различные поисковые системы Internet. При таком под- ности системы.
ходе пользователи подают запросы на Web-сервер, сервер Приложения ISAPI обеспечивают высокую произ-
обрабатывает их и отсылает обратно клиенту. водительность при использовании СУБД одновременно
Принцип поддержания постоянного соединения об- многими пользователями. Тем не менее, ISAPI расши-
ычно предполагает проверку паролей пользователей и рения имеют недостаток – при ошибке CGI расширения
применяется в системах, где важным является разграни- аварийно завершается сам процесс CGI-расширения,
чение прав доступа к информации. Такой принцип приме- ошибка же в ISAPI расширении может привести к ава-
няется в системах электронной почты, основанных на Web. рийному завершению процесса самого Web-сервера. По-
При таком подходе Web-сервер вынужден на протяжении этому необходима очень тщательная отладка ISAPI-рас-
всего сеанса работы с базой данных хранить информацию ширений.
о подключенном пользователе. По запросу Web-клиента Возможный вариант промежуточного использования
«Logout» Web-сервер «отключает» пользователя. По- CGI-процессов для передачи информации между Web-
добный подход позволяет производить однократную про- сервером и процессом-сервером СУБД позволяет уве-
верку пароля при подключении с последующей передачей личить надежность системы путем достаточно простого
(при работе с базой) уникального идентификатора, од- введения внешних систем перезапуска сервера СУБД
нозначно определяющего конкретного пользователя на при ошибках. Но этот вариант был отклонен из-за по-
время всего сеанса работы. Такой уникальный идентифи- терь в производительности, являющихся существенными
катор присваивается клиенту сервером и передается сер- при характере работы СУБД, ориентированном на посто-
веру при каждом запросе к базе данных. Если пользова- янное поддержание соединения с клиентами («Login –
тель забудет отключиться от системы, через некоторое Logout»).
время Web-сервер сам его отключит. Одним из примеров информационно-поисковой си-
При работе HTTP-сервера без СУБД его функции (с стемы является стандартный комплекс «Odb-Text»
точки зрения пользователя) в основном сводятся к пе- (сервер и клиенты), дополненный средствами разделения
редаче дисковых HTML-файлов по запросам браузеров прав доступа, репликации баз данных и ISAPI-Web-рас-
через сеть Internet/Intranet. Для работы с СУБД HTML- ширением с несколькими утилитами для администриро-
файлы должны формироваться динамически, заполняясь вания. Web-расширение может вызываться Web-серве-
данными из базы данных. Эти функции обычно выполняют рами, работающими на платформах Windows 9x, Windows
CGI (Common Gateway Interface – общий шлюзовой ин- NT в 32-х разрядном режиме. Такими Web-серверами на
терфейс) и ISAPI (Microsoft Internet Server Application сегодня являются Internet Information Server для плат-
Program Interface – интерфейс приложений Internet-сер- форм Windows NT и Personal Web Server для платформ
вера фирмы Microsoft) расширения. Оба типа расши- Windows 9x.
рений предназначены для придания «интерактивности» Web-расширение представляет собой выполненный
Web-сайту, возможности вести диалог с пользователем. в виде DLL сервер «Odb-Text», и снабженный средст-
Информация может быть введена пользователем в вами динамической генерации HTML-страниц по данным
управляющих элементах форм в HTML-страницах или из баз данных и стандартным интерфейсом ISAPI расши-
передана посредством параметров строки запроса на рения.
сервер. Преимуществами CGI-скриптов являются их от- Обычный сервер «Odb-Text» располагается на одной
носительная независимость от платформы и высокая машине с Web-сервером и расширением ISAPI. Клиенты
надежность. Под «надежностью» следует понимать без- «Odb-Text», подключаясь к серверу «Odb-Text», могут
опасность работы HTTP-сервера: при ошибке в CGI- просматривать, редактировать, удалять и добавлять до-
скрипте процесс скрипта будет аварийно завершен, а кументы в базы данных, с которыми работает сервер.
процесс HTTP-сервера не пострадает. Существенным не- Расширение ISAPI работает со своими базами. Когда
достатком CGI-скриптов является их относительно низкое администратор сочтет нужным, работа ISAPI-расши-
быстродействие, что связано с накладными расходами на рения корректно приостанавливается и происходит опе-
запуск процессов CGI-скрипта. Для каждого Web-кли- рация синхронизации – базы, с которыми работал сервер
ента HTTP-сервер запускает новый процесс CGI-расши- «Odb-Text», переписываются на место баз, с которыми
рения. После отработки запроса каждый CGI-процесс за- работалo ISAPI-расширение. Так как операция моди-
вершается. фицирования баз является сложной, то, с точки зрения
При обращении Web-клиента к ISAPI-расширению, надежности, целесообразно не ставить под угрозу ра-
соответствующая библиотека DLL загружается в адре- боту Web-расширения и целостность баз данных, с ко-
сное пространство сервера Microsoft Information Server торыми работает Web-расширение. Файлы баз, с кото-
и становится ее составной частью. Так как расширение рыми работает ISAPI-расширение, открываются только
ISAPI работает в рамках процесса сервера Microsoft на чтение, что исключает их порчу по вине программных
Information Server, а не в рамках отдельного процесса, оно ошибок.
30 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Ориентированный на поддержание постоянного соеди- «ODB – Text», чтобы получить от него информацию о на-
нения с клиентами сервер «Odb-Tеxt» заставляет ввести чале переключения баз.
для каждого конкретного пользователя уникальный иден- Данная проблема решается с помощью механизма
тификатор, вырабатываемый с помощью хэш-функции. событий (Events), функционирующего на платформе
Этот идентификатор присутствует во всех данных, при- Windows 32 бит. Отдельная вспомогательная процедура
ходящих от браузера и служит для однозначной иденти- принимает событие от обычного сервера, дожидается
фикации конкретного пользователя. При отправке поль- окончания обработки всех обрабатываемых в данный мо-
зователю сформированной HTML странички данный мент запросов и входит в критическую секцию, не допу-
идентификатор вписывается во все ссылки и формы. ская обработки новых запросов. После выполнения пере-
Пользователя нельзя однозначно идентифицировать с ключения баз и обновления соответствующих им структур
помощью IP адреса, так как некоторые программы могут данных происходит подключение работающих с системой
маскировать IP-адреса пользователей. Сам протокол пользователей к новым базам и устанавливается флаг об-
HTTP и специфика Internet изначально предназначены мена баз в структуре данных, хранящей информацию о
для работы в режиме «вопрос-ответ», а не рассчитаны на каждом конкретном пользователе. После очередного за-
поддержание постоянного соединения клиента с сервером. проса от какого-либо пользователя, если флаг обмена баз
Если пользователь забыл отключиться от системы, установлен, происходит отсылка пользователю уведом-
вспомогательный поток отключит его сам через устанав- ления об обновлении баз.
ливаемое в настройках ISAPI-расширения время. Таким образом, технологии объектных СУБД создают
Механизм синхронизации баз данных выдвигает до- предпосылки для создания распределенных корпора-
полнительное требование к ISAPI-расширению – оно тивных высоконадежных систем для критических прило-
должно уметь общаться с обычным сервером ИПС жений.

Литература:

1. Кирюшин О.В. Управление техническими системами: курс лекций. – Уфа: Изд-во УГНТУ, 2003. – 80 с.
2. Интернет источник: http://www.inteltec.ru

Моделирование систем с распределенными параметрами


Набиуллин Альберт Фларитович, магистрант
Уфимский государственный нефтяной технический университет

Е сли объект характеризуется некоторым параметром, бота реактора. Рассмотрим реактор в производстве, как
различным по своему значению в разных точках объ- объект управления, и системы автоматического управ-
екта, то можно сказать, что значения такого параметра ления с его температурным режимом.
распределены по объекту. Если таких параметров не- Основной, целью является, как можно лучше, точнее
сколько, то объект рассматривается как система с рас- определить параметрическое распределение температур
пределенными параметрами. в реакторе, для того чтобы, объект на технологической
К параметрам же относятся давление, температура, установке ЛЧ-24–7 работал с максимальной эффектив-
вязкость, трение и т.д. Рассмотрим объект – реактор, ностью.
на технологической установке ЛЧ-24–7, с характеризу- Данные о параметрическом распределении температур
ющим температурным параметром. Реактор же является – одно из основных требований. Знание параметрического
основным аппаратом для получения практически любого распределения температуры необходимо для понимания
нефтяного продукта. Его работа определяет зачастую про- работы реактора и его гарантированной производитель-
изводительность всего производства в целом, качество и ности. В индустрии нефтепереработки принято проводить
себестоимость получаемого продукта. Известно, что реак- измерения в нескольких контрольных точках и на их ос-
торы отличаются большим разнообразием протекающих нове рассчитывать средневзвешенную температуру слоя
в них реакций, принципом действий и конструкций. От для определения производительности реактора. Такой
статической, динамической точности поддержания тем- подход дает лишь косвенные указания о его реальной про-
ператур во многом и зависят все показатели работы ре- изводительности. Считается, что реакторы эксплуатиру-
актора: его производительность, определяемая катализа- ются в режиме, близким к оптимальным и не замечают
торами; качество получаемого бензина, определяемое, во никаких особенностей, влияющих на срок службы ката-
многом, от качества сырой нефти, а также безопасная ра- лизатора и его эффективность.
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 31

а) б) в)

Рис. 1. Расположение датчиков вследствие следующих явлений:


а) каналообразование; б) неравномерное распределение; в) локальный перегрев

Катализатор – вещество, которое вызывает или уско- приводящее к отклонениям явление при этом остается
ряет химическую реакцию. В ходе такой реакции тепло незамеченным и не устраняется. Это может вызывать по-
может выделяться (экзотермическая реакция) или погло- тери продукции.
щаться (эндотермическая реакция) [1].Для достижения Можно измерить изменения температуры в пределах
максимальной производительности реактора очень важно, слоя, это позволит обнаружить различия в ходе экзотер-
чтобы реакция протекала в управляемом и равномерном мической реакции. Другими словами, картина изменений
режиме. Тепло, выделяемое при экзотермической катали- температуры по всему реактору дает возможность ясно
тической реакции, в свою очередь способствует ее уско- представить, как он работает.
рению, что вызывает повышение температуры при дви- Если какие-то процессы в реакторе влияют на его га-
жении потока. рантированные рабочие характеристики, очень важно во-
Если катализатор не равномерно распределен, то ре- время выявить их и определить их сущность и устранить.
актор работает с минимально возможной эффективно- Типичное расположение датчиков не позволяет полу-
стью, так как оставшейся катализатор должен работать чить полную картину термопроцессов, которые могут про-
при более высокой температуре, чтобы компенсировать исходить вследствие следующих явлений: а) каналообра-
потери продукции. Таким образом, катализатор работает зование; б) неравномерное распределение; в) локальный
в более жестких условиях, чем планировалось, что при- перегрев; На рисунке 1 показаны расположение датчиков
водит к уменьшению его срока службы. в следствии выше перечисленных явлении.
Операторы измеряют температуру в нескольких контр- С целью повышения эффективности управления ре-
ольных точках, а пробы конечной продукции отправляют акторами предлагается на основе моделирования тем-
в лабораторию для анализа. Пока продукция соответст- пературных полей на основе информации, получаемой
вует спецификациям, считается, что реактор работает эф- по существующему плану расположения датчиков, вы-
фективно. Если характеристики продукции ухудшались, то являть области наибольшей неравномерности полей при
температуру на входе в реактор увеличивают, чтобы за- различных режимах работы реактора и различных со-
ставить катализатор работать активнее. Такое повышение ставах сырья и дополнять этот план датчиками, устанав-
температуры учитывается при прогнозировании срока за- ливаемыми в соответствующих областях неравномер-
мены катализатора. Проблема заключается в том, что ности [2,3].
32 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Рис. 2. Варианты расположения датчиков температуры в контрольных точках,


которые позволяют обнаружить различные особенности распределения катализатора.

В результате моделирования реактора на технологи- бирать режим работы реактора.


ческой установке ЛЧ-24–7, местоположение датчиков, Заметим, что существует возможность дополнить
которые позволят более точно прогнозировать темпера- предложенную систему оптимизации установки датчиков
турные поля, определено в виде (см. рисунок 2). моделью расчета пробега катализатора, что позволит по-
Уточнение параметров температурного поля, в свою высить эффективность управления установкой в смысле
очередь, позволяет операторам более обоснованно вы- экономических критериев.

Литература:

1. Химическая энциклопедия. – М.: Советская энциклопедия, 1990. – Т. 2. – С. 335, 337.


2. Вольтер Б.В., Сальников И.Е., Устойчивость режимов работы химических реакторов, 2 изд., М., 1981.
3. Закгейм А.Ю. Введение в моделирование химико-технологических процессов. – М.: Химия, 1982 г.

Применение калориферной установки на вентиляционном стволе


для подогрева воздуха при реверсии ГВУ в холодное время года
Николаев Александр Викторович, аспирант
Пермский национальный исследовательский политехнический университет

П ри возникновении нештатных ситуаций иногда воз-


никает необходимость осуществлять переход с нор-
мального режима проветривания на реверсивный. В этом
тиляционному (вентиляционным), а удаляться по воздухо-
подающим (воздухоподающему) стволам.
Нормативными документами [1] предписывается в
случае воздух в шахту (рудник) будет подаваться по вен- холодное время года подогревать воздух, подаваемый в
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 33

Рис. 1. Схема движения воздуха при реверсии


АЛ – атмосферная ляда; ДЛ – диффузорная ляда; ОЛ – канальная (общая) ляда;
ПЛ – ляда в подводящем канале вентилятора

шахту (рудник) до температуры не ниже + 2 0С. В связи При сечении вентиляционного канала – 56 м2 [2] и
с этим все воздухоподающие стволы оборудуются кало- максимально возможной скорости движения воздуха по
риферными установками (КУ), подогревающими воздух стволу 15 м3/с [1], пропускная способность его по воз-
в холодное время года. На вентиляционных стволах си- духу составит 840 м3/с, которую будет обеспечивать вен-
стема обогрева воздуха не предусмотрена, поэтому в тилятор ГВУ. При реверсии струи его производительность
случае необходимости выполнить реверсию в шахту будет составлять не менее 75 % от нормальной – QВ =
(рудник) будет подаваться холодный воздух, что проти- 630 м3/с.
воречит ПБ [1]. В связи с тем, что температура воздуха на выходе из
Для исключения подобной ситуации на проектируемом КУ с учетом теплопотерь через стены надстройки, двери и
руднике Усольского калийного комбината (УКК) (Перм- технологические проемы должна быть не ниже + 10°С [5],
ский край) планируется установить КУ, которая будет полная тепловая мощность КУ согласно [6, 7, 8]
подогревать холодный воздух в случае перехода главной Гкал/ч
вентиляторной установки (ГВУ) в реверсивный режим в = 34 944,04 кВт.
зимнее время года. где tнар – температура наружного воздуха, равная -36°C,
Предлагаемая схема расположения КУ приведена на tТО – требуемая температура на выходе из калори-
рис. 1. При реверсировании ГВУ диффузорная (ДЛ) и ферной установки, с учетом теплопотерь, равная +10°C;
общая (ОЛ) ляды будут закрыты. Подача воздуха будет ρ – плотность наружного воздуха, кг/м3, (для тех-
производиться через открытую атмосферную ляду (АЛ). нических расчетов ρ = 1,2 кг/м3);
Для подогрева воздуха в окнах надстройки над АЛ будут c – удельная теплоемкость воздуха, равная 0,24
установлены теплообменники (калориферы). ккал/ (кг∙°C).
Согласно [2] вентиляционный ствол рудника УКК пла- В результате расчетов [2] выяснилось, что для обеспе-
нируется оснастить КУ, состоящей из электрических те- чения подогрева воздуха при реверсии струи КУ необхо-
плообменников, выпускаемых компанией «Веза» [3]. димо оснастить 22-мя электрическими воздухонагрева-
КУ на вентиляционном стволе рассчитывалась так, тельными блоками КЦКП-100 [3], температура воздуха,
чтобы ее мощности хватило на подогрев всего объема на выходе из которых составит + 10,55°С. При этом
воздуха, проходящего через нее в наиболее холодное общая потребляемая электрическая энергия, затрачива-
время года (согласно [4] температура воздуха наиболее емая на работу КУ, составит NКУ = 35 362,8 кВт∙ч.
холодной пятидневки, с обеспеченностью 0,92 равна Характеристики воздухонагревательного блока КЦКП-
-36 °С). 100 приведены в табл. 1.
34 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Таблица 1. Характеристики электрического воздухонагревательного блока для КЦКП-100

Напряжение Мощность одного Кол-во Номинальный расход воздуха, QТО Суммарная мощность
питания, В ТЭНа, qТЭН, кВт ТЭНов, шт. м3/с м3/ч воздухонагревателя Pбл., кВт
220 2,85 564 27,778 100 000 1607,4

В виду того, что ТЭНы (трубчатые электронагрева- Несмотря на значительные затраты электроэнергии
тельные элементы) воздухонагревательных блоков КЦКП- при работе и расходы на приобретение и оснащение вен-
100 могут включаться ступенями мощностью 33; 66,5; тиляционного ствола КУ, можно с уверенностью гово-
100 % от установленной [3], тепловую мощность, а, следо- рить о том, что в случае возникновения аварии в холодное
вательно, и потребление электроэнергии можно будет регу- время года, температура воздуха, подаваемого в рудник
лировать в зависимости от температуры наружного воздуха. будет соответствовать правилам безопасности.

Литература:

1. Единые правила безопасности при разработке рудных, нерудных и россыпных месторождений полезных иско-
паемых подземным способом (ПБ 03–553–03). Серия 03. Вып. 33 / ГУП «НТЦ по безопасности в промыш-
ленности Госгортехнадзора России». – М., 2003. – 200 с.
2. Разработка исходных данных для проектной документации на строительство Усольского калийного комбината.
Исходные данные для разработки проектной документации на проветривание рудника. – Отчет о выполненной
услуге/ Отв. исполнитель Н.Н. Мохирев. – Пермь, 2009. – 52 с.
3. «Веза». Каталог продукции. Кондиционер центральный каркасно-панельный. Выпуск 1. Редакция № 10 от
01.04.2009.
4. СНиП 23–01–99 «Строительная климатология».
5. Малявина Е.Г. Теплопотери здания: справочное пособие. – М.: АВОК-ПРЕСС, 2007. – 144 с.
6. Методика определения потребности в топливе, электрической энергии и воде при производстве и передаче
тепловой энергии и теплоносителей в системах коммунального теплоснабжения. (Утв. Госстроем России
12.08.2003 г.).
7. Нестеренко А.В. Основы термодинамических расчетов вентиляции и кондиционирования воздуха. Изд. 2-е, пе-
рераб. и доп. – М.: Высшая школа, 1971. – 460 с.
8. Соколов В.Я., Бродянский В.М. Энергетические основы трансформации тепла и процессов охлаждения. – М.,
«Энергия», 1967.

Способ девулканизации резиновой крошки на валковом оборудовании


Николюкин Михаил Михайлович, аспирант;
Кондрашков Александр Сергеевич, магистрант;
Соколов Михаил Владимирович, доктор технических наук, доцент;
Клинков Алексей Степанович, кандидат технических наук, профессор;
Болдырев Дмитрий Владимирович, магистрант
Тамбовский государственный технический университет

В настоящее время в нашей стране количество поли-


мерных отходов составляет более одного миллиона
тонн в год, а процент их использования до сих пор мал.
блема их утилизации носит, прежде всего, экологический
характер. Общий объем захоронения твёрдых бытовых
отходов только в Москве составляет около 4 млн. т в год.
Учитывая специфические свойства полимерных мате- От общего уровня отходов перерабатывается только 5.7 %
риалов – они не подвергаются гниению, коррозии, про- от их массы [1].

Работа выполнялась в рамках ФЦП № 14.740.11.0141 по теме «Проведение научных исследований коллективами научно-образовательных центров
в области многофункционального приборостроения для промышленных систем управления».
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 35

По оценке специалистов компании «Профессио- Основной процесс производства регенерата – девул-


нальные Комплексные Решения» (ПКР), объем россий- канизация. Девулканизация – это процесс, в котором от-
ского рынка шин за 2010 год составил 35,2668 млн. штук, ходы вулканизованной резины преобразуются благодаря
что на 27 % больше, чем в 2009 г. механической, тепловой и (или) химической энергии до
В развитых странах процент утилизации исполь- состояния, в котором они могут смешиваться, перераба-
зованных покрышек приближается к 100  %, а в Фин- тываться и вулканизоваться снова [4].
ляндии – 101 %. Это значит, что в стране утилизируют В настоящее время широко распространён непре-
не только все пришедшие в негодность покрышки, но уже рывный термомеханический метод регенерации резины.
приступили к переработке накопившихся запасов. В Ев- Он включает в себя несколько основных стадий, таких как
ропе осознали потребность в использованных покрышках: подготовка резиновой крошки (дробление шин например),
та же Финляндия планирует импортировать 30 тыс. тонн смешивание крошки с химическими компонентами, непо-
использованных покрышек из Германии для дальнейшей средственная переработка на оборудовании.
переработки, так как потребность в данном материале Известно, что чем меньше размеры частиц крошки,
страны превышает образуемое количество на 40–45 тыс. тем более быстро и равномерно происходит набухание ре-
тонн [2]. зины в мягчителях и нагрев её до заданной температуры.
Известно, что изношенные шины могут быть источ- Это приводит к получению более равномерно деструкти-
ником дешёвого полимерного сырья при получении из рованного материала, уменьшению содержания в девул-
них регенерата. Регенератом называют продукт перера- канизате недостаточно девулканизованных частиц резины
ботки резиновых отходов, характеризующийся способно- («крупы») и, как следствие этого, – получению более од-
стью смешиваться с каучуком и ингредиентами и подвер- нородного по качеству регенерата, снижению количества
гаться повторной вулканизации. По структуре, составу отходов рафинирования и повышению производитель-
и свойствам регенерат подобен резиновым смесям, ис- ности рафинировочного оборудования. Однако по мере
пользуемым для изготовления новых изделий. При реге- уменьшения размеров частиц резиновой крошки возра-
нерации происходит термическая деструкция связей серы, стают затраты на её производство. В связи с этим при су-
в результате чего их содержание в регенерате уменьша- ществующих в настоящее время способах получения ре-
ется. Многие вновь образовавшиеся связи в регенерате зиновой крошки применение для получения регенерата
являются углерод-углеродными. Ускорители регенерации шинной резиновой крошки с размерами частиц 0,5 мм и
резин обеспечивают снижение длительности или темпе- менее, как правило, экономически нецелесообразно [1].
ратуры процесса, уменьшение расхода мягчителя, улуч- В нашем способе использовалась резиновая крошка раз-
шение технических качеств регенерата и резин с его до- мером до 2 мм.
бавками. Технологические свойства резиновых смесей, При получении регенерата на валковом оборудовании
содержащих регенерат, улучшаются. Поэтому при де- резиновую крошку предварительно смешивают с химиче-
лении регенерата на технические марки учитываются оба скими активаторами, мягчителями, такими например, как
этих фактора [3]. стеариновая кислота.

Рис. 1. Экспериментальная установка для исследования процесса девулканизации резиновой крошки.


1 – плиты; 2 – станина; 3 – стяжки; 4 и 5 – подшипники валков; нажимный винт; 7 – резьбовая втулка винта;
8 – траверса; 9 и 10 – валки; 11 – противень; 12 – ограничительная стрелка.
36 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Таблица 1. Зависимость степени девулканизации от потребляемой мощности оборудования

Оборудование Потр. мощность, Вт Степень девулканизации, %


Z-обр. смеситель 3750 2,31
Z-обр. смеситель+вальцы 9250 20,368
Z-обр. смеситель +вальцы+экструдер 11799,5 25,14

Температура валков в наших экспериментах варьиро- низации при этом достигается на валковом оборудовании,
валась от 30 до 55°C. Технологические режимы получения и из вышеописанных этапов возможно исключить наи-
регенерата и химические реагенты выбираются таким более энергоёмкий – обработку на z-образном смесителе.
образом, чтобы обеспечить девулканизацию резины, то Степень девулканизации переработанной смеси опре-
есть максимально разрушить поперечные, чаще всего c-s делялась методом ацетоно-хлороформенной экстракции.
и s-s связи, при этом максимально сохраняя от термоде- Результаты её измерения представлены в таблице 1.
струкции молекулу каучука. Это позволяет получить вы- В дальнейших исследованиях планируется получить
сокомолекулярную резиновую смесь, обладающую пла- более высокую степень девулканизации с целью полу-
стичностью, а после повторной вулканизации – резину с чения из регенерата резинотехнических изделий.
высоким уровнем механических свойств [5]. Процесс регенерации, описанный выше, отличается
На рисунке 1 представлена схема лабораторной уста- от подобных тем, что при его использовании применяется
новки, на которой проводились экспериментальные ис- минимум химических компонентов, при этом затрачива-
следования. ется достаточно мало энергии и аппаратурное оформление
Эксперимент проводился следующим образом. Подго- не занимает больших площадей. Все вышеописанные ка-
товленная шинная крошка смешивалась первоначально чества положительно влияют как на экологическую со-
со стеариновой кислотой, затем эта смесь подавалась на ставляющую процесса, так и экономическую.
уже нагретые вальцы. В течение некоторого времени об- Интенсификация технологических процессов, заклю-
работки на вальцах в смеси под действием давления и тем- чающаяся в повышении скорости и сокращении их про-
пературы происходила девулканизация. В результате об- должительности, уменьшении удельных энергетических
работки смесь превращалась в лист, который возможно и трудовых затрат, необходимых для их осуществления,
в дальнейшем использовать для последующей перера- в увеличении калибров и улучшении конфекционных
ботки, например для загрузки в экструдер с целью по- свойств резиновых заготовок и технологических свойств
лучения длинномерных профильных изделий. Предвари- резиновых смесей на участке вулканизации, а также улуч-
тельные эксперименты включали в себя несколько этапов шение некоторых качественных показателей готовых из-
обработки резиновой смеси со стеариновой кислотой: об- делий – тот технический эффект, который в той или иной
работка на z-образном смесителе при температуре более степени может сопровождать применение регенерата в
150 °С, далее на вальцах, а после в червячной машине. Эк- резиновой промышленности и служить дополнительным
сперименты показали, что наибольшая степень девулка- источником экономической эффективности [1].

Литература:

1. Клинков А.С. Утилизация и вторичная переработка полимерных материалов / Клинков А.С., Беляев П.С., Со-
колов М.В. – Тамбов: изд-во Тамб. гос. техн. ун-та, 2005. – 80 с.
2. РБК. Исследования рынков [Электронный ресурс] / Мировой объем шинного рынка – Режим доступа: http://
marketing.rbc.ru/news_research/23/09/2011/562949981557212.shtml, свободный. – Загл. с экрана.
3. Шеин В.С., Основные процессы резинового производства: Учеб. пособие для вузов/ В.С. Шеин, Ю.Ф. Шу-
тилин, А.П. Гриб. – Л.: Химия, 1988. – 160 с., ил.
4. Садан К.Д. Справочник технолога по изготовлению РТИ/ Садан К.Д., Джим Р. Уайт. – Рапра Текнолоджи Ли-
митед: Шобери, Шрусбери, Шропшир, Великобритания, 2001. – 576 с.
5. Пат. 2130952 РФ, МКИ C08J11/10, C08L17/00. Способ получения шинного регенерата / Гавриленко Г.Я.;
Зубков В.М.; Штейнберг Ю.М. – № 2130952; заявлено 19.02.1997; опубл. 27.05.1999.
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 37

Компенсация реактивной мощности в районных сетях


Плотников Михаил Павлович, аспирант
Братский государственный университет

В опросы экономного использования всех видов энергии,


в том числе электрической, и повышения экономич-
ности работы электроустановок являются важной госу-
мощности будет меньше номинальной. Таким образом,
при низких коэффициентах мощности у потребителей
для обеспечения передачи им заданной активной мощ-
дарственной проблемой. В последние годы повышению ности приходится вкладывать дополнительные затраты
качества электроэнергии уделяют большое внимание, т.к. в сооружение более мощных электростанций, увеличи-
качество электроэнергии может существенно влияет на вать пропускную мощность сетей и трансформаторов и
расход электроэнергии, надежность систем электроснаб- вследствие этого нести дополнительные эксплуатаци-
жения, технологический процесс производства. онные расходы.
Одним из основных вопросов, связанных с повыше- Так как в современные электрические системы входит
нием качества электроэнергии в районных сетях явля- большое количество трансформаторов и протяженных
ется вопрос о компенсации реактивной мощности, вклю- воздушных линий, то реактивное сопротивление пере-
чающий выбор целесообразных источников, расчет и дающего устройства получается весьма значительным, а
регулирование их мощности, размещение источников в это вызывает немалые потери напряжения и реактивной
системе электроснабжения. Передача реактивной мощ- мощности. Передача реактивной мощности по сети при-
ности на значительные расстояния от мест генерации до водит к дополнительным потерям напряжения, из выра-
мест потребления существенно ухудшает технико-эконо- жения [3, с. 168]:
мические показатели систем электроснабжения. Поэтому
P⋅R+Q⋅ X
генераторы электростанций должны вырабатывать, на- ∆U = (2)
ряду с активной мощностью, также и реактивную, переда-

ваемую по электрический сети потребителям. видно, что передаваемая по сети реактивная мощ-
Потребителями реактивной мощности, необходимой ность Q и реактивное сопротивление сети Х существенно
для создания магнитных полей, являются как отдельные влияют на уровень напряжения у потребителей.
звенья электропередачи (трансформаторы, линии, ре- Размер передаваемой реактивной мощности влияет
акторы), так и такие электроприёмники, преобразу- также на потери активной мощности и энергии в электро-
ющие электроэнергию в другой вид энергии, которые по передаче, что следует из формулы:
принципу своего действия используют магнитное поле
S2 P2 + Q2
(асинхронные двигатели, индукционные печи и т.п.). До ∆P = ⋅ R = ⋅R (3)
80–85 % всей реактивной мощности, связанной с обра- U Í2 U Í2
зованием магнитных полей, потребляют асинхронные Величиной, характеризующей передаваемую реак-
двигатели и трансформаторы. Относительно небольшая тивную мощность, является коэффициент мощности
часть в общем балансе реактивной мощности приходится
P
на долю прочих её потребителей, например на индукци- cos j = .
онные печи, сварочные трансформаторы, преобразова- P + Q2
2

тельные установки, люминисцентное освещение и т.п. Подставляя в формулу потерь значение полной мощ-
Полная мощность, выдаваемая генераторами в сеть [1, ности, выраженной через cosj, получаем:
с. 140]:
P2
∆P = ⋅R (4)
P U ⋅ cos j 2
2
S= = P + jQ
jQ (1) Í

cos j Отсюда видно, что зависимость мощности конденса-


где P и Q – активная и реактивная мощности прием- торных батарей обратно пропорциональна квадрату на-
ников с учетом потери мощности в сетях; пряжения сети, поэтому невозможно плавно регулировать
cosj – результирующий коэффициент мощности при- реактивную мощность, а следовательно, и напряжение
емников электроэнергии. установки. Таким образом, сos (j) уменьшается, когда
Генераторы рассчитываются для работы с их номи- потребление реактивной мощности нагрузкой увеличива-
нальным коэффициентом мощности, равным 0,8–0,85, ется. Необходимо стремиться к повышению сos (j), т.к.
при котором они способны выдавать номинальную ак- низкий сos (j) несет следующие проблемы:
тивную мощность [2, с. 180]. Снижение cosj у потреби- – высокие потери мощности в электрических линиях
телей ниже определенного значения может привести к (протекание тока реактивной мощности);
тому, что cosj генераторов окажется ниже номинального – большие перепады напряжения в электрических ли-
и выдаваемая ими активная мощность при той же полной ниях;
38 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

– необходимость увеличения габаритной мощности ге- применяют установки, состоящие из нескольких групп
нераторов, сечения кабелей, мощности силовых тран- или секций батарей конденсаторов, что делает воз-
сформаторов. можным ступенчатое регулирование мощности конденса-
Из всего выше приведенного, понятно, что компен- торов, а стало быть, и напряжения установки.
сация реактивной мощности необходима. Что легко можно Батарея конденсаторов должна быть снабжена раз-
достичь применением активных компенсирующих уста- рядным сопротивлением, наглухо присоединенным к ее за-
новок. Основными источниками реактивной мощности, жимам. Разрядным сопротивлением для конденсаторных
устанавливаемыми на месте потребления, являются син- установок напряжением 6–10 кВ служат трансформа-
хронные компенсаторы и статические конденсаторы. На- торы напряжения ТН, а для конденсаторных батарей на-
иболее широко используют статические конденсаторы на пряжением до 380 В – лампы накаливания. Необходи-
напряжении до 1000 В и 6–10 кВ. Синхронные конденса- мость в разрядных сопротивлениях диктуется тем, что при
торы устанавливаются на напряжении 6–10 кВ районных отключении конденсаторов от сети в них остается электри-
подстанций. ческий заряд и сохраняется напряжение, близкое по вели-
чине к напряжению сети. Будучи же замкнутыми (после
отключения) на разрядное сопротивление, конденсаторы
быстро теряют свой электрический заряд, спадает до нуля
и напряжение, что обеспечивает безопасность обслужи-
вания установки. От других компенсирующих устройств
конденсаторные установки выгодно отличаются простотой
устройства и обслуживания, отсутствием вращающихся
частей и малыми потерями активной мощности.

Рис. 1. Схемы электропередачи


а – без компенсации; б – с компенсацией.

Все эти устройства являются потребителями опере-


жающей (емкостной) реактивной мощности или, что то
же самое, – источниками отстающей реактивной мощ-
ности, выдаваемой ими в сеть. Сказанное иллюстрируется
схемой на рис. 1. Так, на схеме рис. 1 а изображена пере-
дача электроэнергии от электростанции А к потребитель-
ской подстанции Б. Передаваемая мощность составляет
P + jQ. При установке у потребителя статических кон- Рис. 2. Схема включения конденсаторной батареи
денсаторов мощностью QК (рис. 1 б) мощность, передава-
емая по сети, будет Р + j (Q – QК) При выборе мощности компенсирующих устройств
Мы видим, что реактивная мощность, передаваемая надо стремиться к правильному распределению источ-
от электростанции, уменьшилась или, как говорят, стала ников реактивной мощности и к наиболее экономичной
скомпенсированной на величину мощности, вырабатыва- загрузке сетей. Различают:
емой конденсаторной батареей. Эту мощность потреби- а) мгновенный коэффициент мощности, подсчитыва-
тель получает теперь в значительной части непосредст- емый по формуле
венно от компенсирующей установки. При компенсации
P
реактивной мощности уменьшаются и потери напряжения cos j = (7)
в электропередачах. Если до компенсации мы имели по- 3 ⋅U ⋅ I
терю напряжения в районной сети исходя из одновременных показаний ваттметра (Р), воль-
тметра (U} и амперметра (I) для данного момента времени
P⋅R+Q⋅ X
∆U = (5) или из показаний фазометра,
U б) средний коэффициент мощности, представляющий
то при наличии компенсации она будет снижена до ве- собой среднее арифметическое значение мгновенных ко-
личины эффициентов мощности за равные промежутки времени,
определяемый по формуле:
(6)
(8)
где R и Х – сопротивления сети.
Так как мощность отдельных конденсаторов сравни- где n – число промежутков времени;
тельно невелика, то обычно их соединяют параллельно в) средневзвешенный коэффициент мощности, опре-
в батареи, размещаемые в комплектных шкафах. Часто деляемый по показаниям счетчиков активной Wa и реак-
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 39

тивной Wr энергии за определенный промежуток времени Критерием экономичности является минимум приве-
(сутки, месяц, год) с помощью формулы: денных затрат, при определении которых следует учиты-
вать:
а) затраты на установку компенсирующих устройств и
(9) дополнительного оборудования к ним;
б) снижение стоимости оборудования трансформа-

торных подстанций и сооружения распределительной и
Выбор типа, мощности, места установки и режима ра- питающей сети, а также потерь электроэнергии в них и
боты компенсирующих устройств должен обеспечивать в) снижение установленной мощности электро-
наибольшую экономичность при соблюдении: станций, обусловленное уменьшением потерь активной
а) допустимых режимов напряжения в питающей и мощности.
распределительных сетях; Из всего вышесказанного, можно сделать вывод, что
б) допустимых токовых нагрузок во всех элементах компенсация реактивной мощности в районных сетях с
сети; помощью конденсаторных батарей позволит увеличить
в) режимов работы источников реактивной мощности в пропускную способность линии, без изменения электро-
допустимых пределах; технического оборудования. Кроме того, это целесоо-
г) необходимого резерва реактивной мощности. бразно с экономической точки зрения.

Литература:

1. Копылов И.П. Электрические машины. – М.: Энергоиздат, 2004. 456 с.


2. Кацман М.М. Электрические машины. – М.: Энергоиздат, 1990. 265 с.
3. Шидловский А.К., Кузнецов В.Г. Повышение качества электроэнергии в электрических сетях. Киев: Наукова
думка, 1985. 268 с.
4. Большанин Г.А, Плотников М.П. Особенности распределения электрической энергии по городским сетям.
Труды Братского государственного университета: Сер.: Естественные и инженерные науки – развитию реги-
онов Сибири: в 2 т. – Братск: Изд-во БрГУ, 2011. – Т.2., с. 48–51.

Управляемый импульсный источник электропитания


частотно-регулируемого озонатора
Притула Артем Николаевич, магистрант;
Полуянович Николай Константинович, кандидат технических наук, доцент
Таганрогский технологический институт Южного федерального университета

В статье представлены обобщенные результаты экспериментальных исследований, нацеленных на пре-


образование кислорода в озона. Выявлена и оптимизирована зависимость горения топлива с кислородом и
озоном. Разработана структурная схема системы озонирования воздуха для ДВС. Разработан адаптивный
алгоритм работы автоматизированной системы. Разработан опытный образец устройства озонирования
воздуха системы топливоподачи ДВС. Проведено внедрение системы в двигатель внутреннего сгорания. Про-
веден анализ результатов исследований концентрации отработанных газов, с использованием озонатора и
без него.
Ключевые слова: Озонатор, импульсный источник, регулировочная характеристика.

Введение ализации такой системы необходимо разработать качест-


венный и мощный источниках питания, преобразующий
Существенное увеличение количества автотранспор- напряжение бортовой сети автомобиля до десятков КВ [1].
тных средств, во всем мире приводит к необратимому за-
грязнению окружающей среды. Для снижения выбросов Постановка задачи
вредных веществ необходимо устанавливать на авто-
мобили системы озонирования воздуха, т.к. озон явля- Перед авторами стояла цель – разработать импуль-
ется сильным окислителем по сравнению с кислородом. сный источник питания системы синтеза озона, системы
При добавлении с озона топливо сгорает полнее, следо- топливоподачи ДВС, Для ее решения были поставлены
вательно увеличивается мощность и КПД ДВС. Для ре- следующие задачи:
40 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

• повысить коэффициент полезного действия суще- Проведение эксперимента на определение состава


ствующей системы [1]; выхлопных газов
• снизить энергопотребление установки;
• улучшить качество преобразования электроэ- На рис. 3 представлены временные диаграммы содер-
нергии; жания CH (углеводорода), CO (угарного газа), CO2 (угле-
• разработать адаптивный алгоритм управления; кислого газа), O2 (кислорода) в отработанных газах. В ка-
• упростить конструкцию самой установки и ее мон- честве топлива используется бензин. В выхлопной системе
тажа; автомобиля не имеется катализатора. Мощность потребля-
• снизить себестоимость системы. емая устройством для преобразования озона равна 60 Вт.
Новизна работы заключается в создании управляемого Полученные зависимости содержания CH, CO, CO2,
микроконтроллером импульсного источника питания с O2 в отработанных газах в результате эксперименталь-
высоким КПД и регулированием процесса синтеза озона. ного исследования системы воздухоподачи с объемом дви-
гателя 1,5 л на холостом ходу (ХХ) показывают, что:
Разработка устройства синтеза озона 1. без применения озонатора количество CO состав-
ляет 6,4 % и CH 335 ppm.;
Поступающий кислород в составе воздуха во время ра- 2. с использованием озонатора CO снизилось до
боты двигателя внутреннего сгорания проходит через озо- 4,48 % и CH до 235 ppm.
натор [2,3]. Озонатор представляет собой трубу в двумя Проведен эксперимент на том же автомобиле, но на
сетками (рис. 1), на которые подается высокое напря- 2000 об/мин двигателя (рис. 4). Без применения озона-
жение, несколько десятков кВ для создания барьерного тора (данные слева) количество CO составляет 9,83 % и
разряда. CH 410 ppm. При включении озонатора (данные справа)
CO снизилось до 8,69 % и CH до 290 ppm.
Описание принципиальной схемы двухкаскадного Сравнив полученные результаты рис. 5 видим, что в
импульсного источника питания проведенных экспериментах значение СН снизилось на
30 %, а СО, в первом случае (при ХХ) на 30 %, во втором
На рис. 2. приведена схема двухкаскадного импуль- (при 2000 об/мин) на 22 %.
сного источника. Трансформатор Т1, с помощью комму- Вывод: для снижения уровня загрязнения окружа-
татора, трансформирует напряжение бортовой сети ав- ющей среды в среднем на 30 % необходимы озонаторные
томобиля из 14В в 4500В. Такой трансформатор имеет устройства мощностью 60Вт.
высокий коэффициент трансформации, поэтому, пара-
зитная емкость, искажает усиливаемый сигнал. Комму- Исследование мощностных характеристик
татор реализован на транзисторе VT7 и является одно- устройства
тактным. Недостатки однотактного преобразовательного
источника: На рис. 5 представлены мощностные характеристики
1. Большой коэффициент трансформации повыша- автомобиля с объемом двигателя 1,5 л. Тонкими линиями
ющего трансформатора, приводящий к увеличению па- обозначены характеристики двигателя без применения
разитных емкостей, которые искажают усиливаемый озонатора, а жирными – с применением озонатора. На
сигнал. графике видно, что на низких оборотах двигателя (до 2400
2. Схемное решение преобразователя имеет следу- об/мин) мощность (P-норм) и момент (М-норм) с приме-
ющие существенные недостатки: нением озонатора возросли.
• работа с однополярными токами в обмотках тран- Жирная линия – эксперимент с применением озона-
сформатора требует мер по снижению одностороннего тора;
намагничения сердечника. Тонкая линия – эксперимент без применением озона-
• при размыкании ключа энергия, накопленная в ин- тора.
дуктивности намагничения трансформатора «повисают в Вывод: с применением озонатора мощность и момент
воздухе». В этом случае возникает индуктивный выброс – двигателя, до 2400 об/мин больше на 20 %, чем без него.
повышение напряжения на силовых электродах ключе- Т.е при увеличении мощности озонатора увеличится мощ-
вого транзистора, что может привести к его пробою. ность и момент двигателя на больших оборотах.
• короткое замыкание выходных клемм преобразова-
теля обязательно выведет силовую часть из строя, следо- Разработка трехкаскадной схемы преобразователя
вательно, требуются тщательные меры по защите от КЗ.
3. Отсутствие встречного транзистору, защитного Разработан импульсный преобразователь напряжения,
диода; принципиальная схема которого представлена на рис. 6,
4. Недостаточная производительность вырабатывае- системы синтеза озона, обладающая следующими досто-
мого озона связанная с низким КПД источника электро- инствами:
питания. • высокий КПД;
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 41

Отрицательный Положительный
электрод Uпит электрод

O2
O2
O- O-
O3
O2
3O2 O2
+ +
O2 2O3 O3
O2
O3 O3

Электрическое поле

Рис. 1. Структурная схема озонаторной установки

X2
Наименование

1 GND
X1
2 + 12 В C4 C5
Наименование FU1 GND +5В
in out
Кнопка включения 1
К142ЕН5А
Лямда- зонд “+” 2

Датчик влажности 3 R8
K1
Датчик оборотов
двигателя 4 R3
VT1
R4 VT5

R9
R1
VT4

VT2
C1 VD1 R2 R5

DA1
&
VT3 R12

out PA0 PA4 R6


VT6

PA1 PA5 C6

PA2 PA6
PA3
R10
X4
Наименование

MOSI 1 PA5

MISO 2 PA6
VT4
SCK 3 PA7 R7 T1
RESET VT7
RESET 4

GND 5
VCC C9
VD2
XTAL1 AVCC R11
C7
XTAL2 GND VD3
+5V
C10
VD4

C2 C3
X3 C8
VD5
Наименование
C11
VD6
К озонатору «-» 1

К озонатору «+» 2

Рис. 2. Принципиальная схема двухкаскадной схемы преобразователя


42 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Рис. 3. Диаграммы концентрации выхлопных газов автомобиля на холостом ходу (ХХ)

Рис. 4. Диаграммы концентрации выхлопных газов автомобиля на 2000 об/мин


“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 43

Рис. 5. Мощностные характеристики автомобиля с объемом двигателя 1,5 л

VD5 L1

+12 В
VT4 VT9
VD7 C3 C5 VD9 VT13
R7 R15
R23
VT4 VT4 VD3 R21
VD1 VT4
VT2 VT7
DD1 R4 R12
VT11
PB0 PA0
R17
PB1 PA1
R6 R14 T1
PB2 PA2
PB3 PA3 R19

PA4
PA5 R20 VT12
VT3 VT8 R18
VCC R3 R11 VT14
+5 В R5 R13
XTAL1 VT5 VD2 VT10
AVCC
VT1 VT6 R22
XTAL2 GND
R1 R9 VD4

VD6 L2 VD10 R24


R2 R8 R10 R16
C1 C2
VD8 C4 C6

C8

X1
X2
Наименование
Наименование T2
1
Кнопка включения 1
К озонатору «+» VD11 VD12 VD13
2
К озонатору «-» 2 C9
3 C7
Лямбда-зонд
4

5
Датчик оборотов
двигателя 6

7
Датчик влажности
8

Рис. 6. Принципиальная схема трехкаскадной схемы преобразователя


44 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Рис. 13. Обобщенная регулировочная характеристика бензинового двигателя


по составу смеси при горении топлива с кислородом

Рис. 14. Регулировочная характеристика бензинового двигателя по составу смеси при горении топлива с озоном

• более высокое качество преобразованной электро- увеличивает генерируемое напряжение в два раза. Таким
энергии; образом усиливаемый сигнал не искажается, а КПД им-
• меньшее потребление бортовой электроэнергии ав- пульсного преобразователя увеличивается.
томобиля;
• меньшие массо-габаритные размеры. Регулировочные характеристики устройства
Достижение этих возможностей стало благодаря при-
менению трех каскадного преобразования напряжения, В ЭСАУ двигателем используется программно-адап-
два первых каскада реализованы на трансформаторах, а тивное управление. Для реализации программного управ-
третий – на умножителе. Каждый трансформатор имеет ления в ПЗУ блока управления записывается зависимость
не высокий коэффициент трансформации, поэтому, па- длительности впрыска (количества подаваемого топлива)
разитная емкость, которая искажает усиливаемый сигнал от нагрузки и частоты вращения коленчатого вала двига-
становится на много меньше. В разработанном импульсном теля [6]. На рис. 13 представлена обобщенная регулиро-
источнике напряжения используется мостовой инвертор, вочная характеристика двигателя по составу смеси, го-
реализованный на транзисторах VT4,VT5,VT9,VT10, что рение топлива происходит с кислородом.
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 45

При горении топлива с озоном регулировочная харак- поступающего в камеру сгорания ДВС;
теристика имеет более равномерный вид (рис. 14), что 2. Представлена зависимость синтеза озона от ис-
улучшает переход из одной рабочей точки в другую и улуч- пользуемого окислителя в ТВС;
шает динамику работы системы топливоподачи. 3. Выявлено влияние озонированной ТВС на концен-
трацию отработанных газов;
Заключение 4. Установлено, что мощность и момент ДВС зависят
от используемого окислителя в ТВС.
1. Показана эффективность использования импуль- 5. Использование системы озонирования приводит к
сного источника питания для диссоциации кислорода, изменению регулировочной диаграммы ПЗУ ЭБУ.

Литература:

1. Притула А.Н., Полуянович Н.К. «Разработка и исследование системы топливоподачи на базе озонатора». Ре-
сурсоэффективные технологии для будущих поколений. Сборник трудов II Международной научно-практиче-
ской конференции молодых ученых. 23–25 ноября 2010 г. – Томск: Изд-во Томского политехнического уни-
верситета, 2010. – 452 с.
2. Притула А.Н., Полуянович Н.К. «Разработка системы озонирования воздуха для двигателя внутреннего сго-
рания» Геосистемы: факторы развития, рациональное природопользование, методы управления: сборник на-
учных статей по материалам II Международной научно-практической конференции, посвященной 15-летию со
дня основания филиала РГГМУ в городе Туапсе, 4–8 октября 2011года/Рос. фонд фундамент. Исслед., Ра-
бочая группа «Морские берега» Совета РАН по проблемам мирового океана, Фил. Рос. гос. гидрометеорол.
ун-та в городе Туапсе Краснодар. Края. – Краснодар: Издательский Дом – Юг, 2011. – 416 с.
3. Притула А.Н., Полуянович Н.К. «Устройства озонирования воздуха системы топливоподачи ДВС». Сборник
работ победителя отборочного тура Всероссийского конкурса научно-исследовательских работ студентов, ас-
пирантов и молодых ученых по нескольким междисциплинарным направлениям, г. Новочеркасск, октябрь-но-
ябрь 2011 г. / Мин-во образования и науки РФ, Юж. – Рос. Гос. Техн. ун-т. (НПИ). – Новочеркасск: Лик,
2011. – 575 с.
4. Притула А.Н., Полуянович Н.К. «Проектирование и реализация системы озонирования воздуха для ДВС».
Президиум центрального совета Российского Научно-Технического общества радиотехники, электроники и
связи им. А.С.Попова. 2011 г.
5. Цифровые интегральные микросхемы: Справ. / М.И. Богданович, И.Н. Грель, В.А. Прохоренко, В.В. Ша-
лимов. – Мн.: Беларусь, 1991. – 493 с.
6. Утин В. Варианты блока питания «Люстры Чижевского». – Радио, 1997, № 10, с. 42, 43

Эксплуатационные показатели современных твердосплавных СМП


производства ОАО «КЗТС»
Иванов Валерий Васильевич, доктор технических наук, профессор;
Пряжникова Анастасия Анатольевна, аспирант;
Сметанин Андрей Сергеевич, магистрант
Тульский государственный университет

Р ынок твердосплавных СМП российского производ-


ства является динамично развивающимся с темпом
роста 12,6 % в год, объемом, примерно, 110 млн. ру-
тельных предприятиях Российской Федерации. Так, по
данным ООО «Компания РИТС» (официальный дилер
ОАО «КЗТС») твердосплавные СМП нового поко-
блей [1]. При этом основные эксплуатационные пока- ления являются эффективной заменой своих аналогов из-
затели инструментов СМП, такие как износостойкость, вестных фирм Sandvik Coromant, SECO, Korloy, ISCAR
стружкодробящая способность, допускаемая скорость ре- и т.д. [3]. Обобщая результаты лабораторных и произ-
зания, вплотную приближаются к зарубежным аналогам. водственных испытаний, можно заключить, что износо-
Об этом свидетельствуют результаты лабораторных ис- стойкость отечественных СМП начинает соответствовать
пытаний, приведенных в [2]. Это также подтверждается лучшим мировым образцам.
и результатами промышленной эксплуатации СМП про- Обеспечение стабильного стружкодробления в про-
изводства ОАО «КЗТС» на различных машинострои- цессе резания основывается на геометрической конфигу-
46 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

рации передней поверхности СМП с учетом условий об- (с областью применения по ИСО Р35), производства
работки: чистовая, получистовая, черновая. Проведенный Sandvik-МКТС, несмотря на то, что его износостойкость
анализ показал, что на СМП нового поколения производ- должна быть ниже, чем у отечественного сплава с обла-
ства ОАО «КЗТС» она копируется с зарубежных ана- стью применения Р20. Обоснованность его применения
логов. Так, геометрия передней поверхности с индексом была вызвана тем фактом, что сплавы производства КЗТС
«М2» соответствует геометрии «TF» фирмы ISCAR. Ин- более раннего выпуска уступали своим зарубежным ана-
декс «Н1» соответствует геометрии «GH» фирмы Korloy логам даже при меньшем номере подгруппы его приме-
и т.д. нения по ИСО [4].
Целесообразность такого подхода при создании оте- Вторым аналогом являлась СМП формы CNMG
чественных СМП была проверена при комплексной 120408-M3 из сплава марки ТК2000 (Р15) фирмы SECO
оценке эксплуатационных свойств СМП формы CNMG (Швеция), а третьим аналогом – СМП формы CNMG
120408-М2 из твердого сплава марки ТС20РТ с обла- 120408-GM из сплава NC 3120 (Р15-Р30) южно-корей-
стью применения по ИСО Р20. Для сравнения были подо- ской фирмы Korloy.
браны СМП 3-х различных фирм, которые имеют схожую Результаты стойкостных испытаний сравниваемых
область применения. Учитывая это, эксперименты были СМП приведены в таблице.
проведены при обработке легированной стали 38Х2МЮА Из них видно превосходство сплава ТС20РТ (Р20) над
(материал группы Р по ИСО). Как было отмечено выше, маркой СТ35М (Р35), что свидетельствует о возросшем
геометрия М2 соответствует геометрии TF фирмы ISCAR, качестве отечественных сплавов нового поколения. Тем не
которая предназначена для получистовой обработки менее, он несколько уступает сплаву ТК2000, имеющего
(t=1–4мм, S=0,12–0,35 мм/об) конструкционных угле- очень близкую к нему область применения по ИСО Р15.
родистых, легированых, а также нержавеющих сталей. При оценке режущих свойств СМП из сплава NC3120
В связи с этим в опытах была принята глубина резания произошел скол на главной режущей кромке, в резуль-
t=1,0 мм и подача S=0,17 мм/об из ряда подач станка мо- тате чего износ задней поверхности на вершине СМП со-
дели 1К625, принятого в качестве оборудования. В каче- ставил 0,32 мм. При повторных испытаниях из-за малого
стве инструмента использовали резец PCLNR 2525-К12 диаметра заготовки (D=52 мм) в процессе резания воз-
(с углами j=95º, j1=5º). Проведение экспериментов никли вибрации, что не позволило окончательно выявить
было организовано следующим образом. Заготовку с ис- его потенциальные режущие свойства.
ходным диаметром 80 мм при вылете 600 мм закрепляли Оценка стружкодробящей способности передних по-
в 3-х кулачковом патроне с поджимом вращающимся верхностей сравниваемых сплавов показало следующее.
центром задней бабки. Обработку производили без при- На рисунке представлены фотографии процесса стружко-
менения СОТС по методу последовательных проходов. завивания на них, а также образцы стружки. Из них сле-
При этом, уменьшение скорости резания, обусловленное дует, что в условиях данных экспериментов наиболее ком-
уменьшением диаметра обработки, компенсировали пе- пактная стружка формируется на передней поверхности
реключением коробки скоростей на следующую бόльшую с индексом «43» (Sandvik-МКТС). Для геометрии «М2»
частоту вращения шпинделя. (КЗТС) характерна стружка с длиной спирали более 100
Для того, чтобы поставить сравниваемые СМП в более мм, что делает ее неприемлемой для работы на станках с
одинаковые условия, каждый последующий проход чере- ЧПУ. Следовательно, при решении вопроса выбора кон-
довался новой СМП. За критерий затупления контактных фигурации передней поверхности на отечественной СМП
поверхностей был принят линейный износ задней повер- для получистовой обработки, более предпочтительной яв-
хности, который измерялся на инструментальном микро- ляется геометрия «43». Кроме того, аналогичная геоме-
скопе БМИ-1 с последующим фиксированием характера трия с классическими стружкозавивающими канавками
изнашивания на цифровую фотокамеру. Кроме того, для ранее использовалась на СМП из твердых сплавов серии
более объективной оценки износостойкости сравнива- МС по ТУ 48–19–307–80, выпускаемых МКТС в 80-е
емых СМП учитывали не только время ее работы, но и годы прошлого столетия по лицензии фирмы Sandvik Cor-
пройденный путь резания, который также уменьшается с omant. В таком случае не возникает вопросов о правомоч-
уменьшением диаметра заготовки. Оценку формы и раз- ности использования зарубежных аналогов форм пере-
меров стружки проводили по собранным ее образцам. При дней поверхности на СМП отечественного производства.
этом, в соответствии с рекомендациями фирмы Sandvik Таким образом, на основании полученных результатов
Coromant, за приемлемую принимается стружка, длина можно сделать следующие выводы.
спиралей которой не превышает 100 мм. Процесс фор- 1. Режущие свойства твердых сплавов нового поко-
мирования стружки на передней поверхности СМП также ления производства КЗТС способны составить серьезную
фиксировался на цифровую фотокамеру, что позволяет конкуренцию зарубежным аналогам, что весьма акту-
визуально оценить влияние на него отличия в конфигу- ально для отечественной промышленности.
рации сравниваемых поверхностей. 2. При выборе формы передней поверхности на СМП
В качестве первого аналога для сравнения была при- для получистового точения отечественного производства
нята СМП формы CNMG 120408043 из сплава СТ35М предпочтение следует отдать геометрии с индексом «43».
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 47

Таблица 1. Результаты экспериментов

Диаметр заготовки D, мм;


Средняя скорость Путь ре‑ Время ра‑ Износ задней
СМП частота вращения шпин‑
резания, м/мин зания, м боты, мин поверхности, мм
деля, n об/мин
CNMG 120408-M2
TC20PT (P20)
КЗТС D=71–48
264 1962 7,39 0,17
n=1250, 1600

CNMG 120408–43
CT35M (P35)
Sandvik-МКТС D=67
263 700 2,66 0,26
n=1250

CNMG 120408-M3
TK2000 (P15)
SECO
D=60–50
266 2556 9,78 0,18
n=1250, 1600

CNMG 120408-GM
NС3120 (P15-P30) D=64–58
262 1170 4,72 0,32
Korloy n=1600

D=52
261 543 2,07 0,08
n=1600

КЗТС Sandvik-МКТС SECO Korloy

Рис. 1. Результаты экспериментов:


а – сход стружки по передней поверхности; б – форма стружки
48 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Литература:

1. ОАО «Кировградский завод твердых сплавов». Каталог. Пластины сменные многогранные твердосплавные. –
2010.– http://www.kzts.ru.
2. Иванов В.В., Пряжникова А.А. Перспективы применения режущих инструментов с СМП российского произ-
водства. // Технические науки: проблемы и перспективы: сб. статей Международной заочной научной конфе-
ренции. – С-Пб.: Молодой ученый, 2011. – С. 134–137.
3. http://www.ritsgroup.ru
4. Борискин О.И., Иванов В.В, Павлова Е.В. Повышение эффективности чистовой токарной обработки на основе
применения токарных резцов с СМП: монография, Тула: Изд-во ТулГУ, 2009. 151 с.

Состояние примесных атомов с глубокими уровнями в полупроводниках


в условиях сильной компенсации
Садуллаев Аловиддин Бобакулович, кандидат физико-математических наук, доцент
Каршинский инженерно-экономический институт (Узбекистан)

В условиях сильной компенсации, в полупроводниках,


концентрация равновесных носителей тока стано-
вится в сотни тысячи или миллионы раз меньше, чем кон-
ментов таблицы Менделеева, создающих глубокие энер-
гетические уровни в запрещенной зоне кремния был об-
наружен целый ряд энергетических уровней неизвестной
центрация ионизованных примесных атомов в решетке, природой с различной энергией ионизации (таблица-1).
что имеет место при Т=300 К, а с понижением темпера- Существование этих уровней нельзя объяснить элек-
туры эта разница еще более увеличивается. В этом случае тронной структурой примесных атомов в кристаллической
не только нарушаются локальные электронейтральности решетке. Большинство авторов утверждают, что приме-
в решетке и потенциал окружающего примесного атома, сные атомы образуют не фиксированные энергетические
но и существенно меняется дефектная структура самой уровни в запрещенной зоне, а создают энергетические по-
кристаллической решетки. С другой стороны в условиях лосы с определенной шириной (таблица-2).
сильной компенсации система находится в крайне нерав- Данные о концентрации электроактивной части при-
новесном состоянии. Воздействие малейших внешних месных атомов с глубокими уровнями полученные раз-
факторов (температуры, давления, освещенности, элек- личными авторами, существенно отличаются друг от друга
трического и магнитного поля) меняет не только элек- и очень противоречивы.
тронную структуру дефектов кристаллический решетки, Нами получены некоторые новые экспериментальные
но и существенно изменяет условия взаимодействия де- результаты, связанные с поведением примесных атомов
фектов и носителей тока. Поэтому примесные атомы с марганца в кремнии в условиях сильной компенсации.
глубокими уровнями в этих условиях не имеют фиксиро- Для исследования в качестве исходного материала был
ванных состояний в решетке, как это обычно имеет место использован монокристаллический кремний р-типа с
в некомпенсированном полупроводнике, а вынуждены удельным сопротивлением r=1; 4,5; 10; 100; 220 Ом·cм
постоянно перестраиваться с изменением внешних воз- и n-типа с удельным сопротивлением r= 2;10; 25; 70;
действий. Это означает, что каждому квазиравновесному 200 Ом·cм. Концентрация кислорода в данном мате-
состоянию решетки соответствуют только определенные риале практически была одинакова и составила No2=
состояния примесных атомов (положение их в решетке, (5÷7)·1017см-3. Из каждого исходного материала было
энергетические уровни). Поэтому в зависимости от сте- изготовлено по 10 образцов с одинаковыми геометриче-
пени компенсации материала и условий эксперимента, скими размерами. Диффузия марганца проводилась из га-
примесные атомы с глубокими энергетическими уров- зовой фазы, при этом в каждую ампулу было помешено
нями в кремнии могут внести в запрещенную зону мате- по два образца каждого исходного материала, для обеспе-
риала различные энергетические уровни с соответству- чения одинаковых условий легирования и скорости охла-
ющим состоянием в кристаллической решетке. ждения. Эксперимент повторялся 5 раз. При этом каждый
Анализ опубликованных экспериментальных данных раз при тех же условиях проводили отжиг исходных
авторов [1÷6] по исследованиям примесных атомов, со- образцов без марганца, чтобы оценить влияние термоот-
здающих глубокие энергетические уровни позволяет жига на свойства материала.
выяснит некоторые интересные факты в пользу выше Измерение электрофизических параметров образцов
изложенного предположения. Практически для всех эле- после диффузии марганца показало, что независимо от
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 49

Таблица 1

Элементы ЕV +Еi EC – Et Литература


0.35; 0.45 0.25
Sc 1
0.35; 0.45 0.27; 0.35; 0.5; 0.55.
0.53; 2
Mn
0.21; 0.24; 0.3; 0.39; 0.53 3
0.23; 0.2 0.35 3
Ni
0.18; 0.22;0.4. 0.41
Pd 0.34 0.18; 0.22; 0.32; 0.69 5
0.34; 0.41; 0.29; 0.62; 0.3; 0.34; 0.31; 0.36; 5
Pt
0.25; 0.37. 0.3; 0.2; 0.25; 0.28

Таблица 2

Элементы ЕV +Еi EC – Et Литература


Ni 0.2÷ 0.5 3
0.4÷0.53; 4
Mn
0.24÷0.3.
Zn 0.4÷0.55 6
Pd 0.2÷0.7 5
Ir 0.17÷0.5 5
Er 0.6÷0.48 5

одинаковых условий (температура, время диффузии, дав- ными. Показано, что концентрация электроактивных
ления паров диффузантов, скорости охлаждения) легиро- атомов марганца в n-кремнии не зависит от концентрации
вания, концентрация электроактивных атомов марганца фосфора и при исследуемых температурах диффузии со-
существенно зависит от концентрации исходного бора в ставляет NMn= (2÷2.5)·1014 см-3, а это почти на 2 по-
кремнии. Полная концентрация электроактивных атомов рядка меньше чем в р-кремнии (рис. 1, кривая-3). Таким
марганца определялась решением уравнения электро- образом, концентрация электроактивных атомов мар-
нейтральности на основе экспериментальных резуль- ганца (и элементов группы железа) в кремнии зависит от
татов с учетом степени заполнения обоих энергетических типа и концентрации исходных примесей. Поэтому суще-
уровней марганца (Е1=Ес-0.24 эВ, Е2=Ес-0.5 эВ) в запре- ствующие литературные данные об электроактивности
щенной зоне кремния [8]. элементов переходных групп в кремнии является лишь
На рис. 1 представлены зависимости концентрации частичным решением этого вопроса. Температурный ход
электроактивных атомов марганца от концентрации ис- концентрации электроактивных атомов не соответствует
ходного бора (кривая-2) и значения растворимости мар- температурному ходу растворимости данного элемента в
ганца при данной температуре диффузии (кривая-1). Как кремнии. Исследователи, не обращая внимания на сте-
видно из рисунка, концентрация электроактивных атомов пень компенсации исследуемого материала, условия эк-
марганца в образцах р-типа с удельным сопротивлением сперимента и параметры исходного материала, получили
r=1 Ом·cм почти на 2 порядка больше, чем в образцах разные значения энергетических уровней, концентрации
р-типа с удельным сопротивлением r=220 Ом·cм, не- центров и каждый раз утверждали, что они обнаружили
смотря на легирование этих образцов в одной ампуле и новые энергетические уровни разные значения кон-
при абсолютно одинаковых условиях. Если концен- центрации электроактивных атомов. В условиях сильной
трация электроактивных атомов марганца в образцах с компенсации (вообще в компенсированном материале)
r =1 Ом·cм достигает NMn=1.2·1016 см-3 и очень близко состояние примесных атомов и соответствующие им энер-
к значению растворимости марганца при данной темпера- гетические уровни не являются фиксированными и могут
туре (NMn=2·1016 cм-3) [9], а в образцах р-типа с r=220 иметь различные значения. В связи, с чем можно обсу-
Ом·cм она не превышает (3÷3.5)·1014 см-3. ждать возможность создания теории глубоких уровней в
Установлено, что концентрация электроактивных полупроводниках, которая до сих пор не существует в нор-
атомов марганца возрастает с увеличением концентрации мальном виде. Для этого необходимы более тщательные
бора, а при концентрации бора NВ ³ 2·1016 см-3, практи- экспериментальные и теоретические исследования вза-
чески все растворимые атомы становятся электроактив- имодействия примесных атомов с дефектами кристал-
50 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Рис. 1. Зависимость концентрации электроактивных атомов марганца от концентрации исходного бора и фосфора

лической решетки полупроводника в условиях сильной вообще физики сильно компенсированных полупровод-
компенсации и явлениями переноса в этих материалах и ников.

Литература:

1. Азимов Г.К. Диффузия, растворимость и состояние примесей скандия и ванадия в кристаллической решетке
кремния. Автореф. дисс. к.ф.-м.н. Ташкент 1992 г.
2. Омельяновский Э.М., Фистуль В.И. Примеси переходных металлов в полупроводниках. Металлургия. М
1983 г., с. 130.
3. Далиев Х.С., Лебедев А.А., Султанов Н.А. Параметры глубоких уровней в Si<V>. ФТП, 1985, в.2, с. 338–339.
4. Юнусов М.С. Физические явления в кремнии, легированном элементами платиновой группы. ФАН, 1983.
5. Hall R.N., Rasette J.H.. Appl phys. 1984, v.45,p.379–396.

Современные приборы бесконтактного кодирования рельсовых цепей


Бейбулатова Светлана Ивановна, студент;
Селиверов Денис Иванович, преподаватель
Саратовский техникум железнодорожного транспорта – филиал Самарского государственного университета путей сообщения

Р ешение стратегической задачи повышения эффек-


тивности работы ОАО «РЖД» невозможно осуще-
ствить без оснащения железных дорог современными и
опытной эксплуатации, внедрения или широкого приме-
нения. Однако даже не внедренные разработки играют
положительную роль. В процессе создания новых систем,
надежными техническими средствами. Работы по совер- их лабораторных и эксплуатационных испытаний нака-
шенствованию и созданию новых устройств ведутся пос- пливается опыт разработчиков, отдельные наиболее пер-
тоянно. При этом не все разработки доходят до стадии спективные идеи и технические решения используются
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 51

в последующих разработках, отклоняются ошибочные и бесконтактного кодово-путевого трансмиттера БКПТ


бесперспективные решения. вместо КПТШ; использование микроэлектронного дат-
В настоящее время на дорогах ОАО «РЖД» эксплу- чика ДИМ вместо маятниковых трансмиттеров МТ-1,
атируется значительное число систем железнодорожной МТ-2. [1]
автоматики и телемеханики с истекшим сроком аморти- Крупными шагами в направлении совершенствования
зации. были разработка и внедрение бесконтактного коммута-
Самыми распространёнными в России системами ин- тора тока. БКТ является более современным переключа-
тервального регулирования движением поездов являются ющим устройством для коммутации кодового тока в рель-
числовая кодовая автоблокировка и импульсно – про- совых цепях 25 и 50 Гц.
водная автоблокировка, электрические схемы которых Он состоит из двух тиристоров и управляющей цепи.
построены на электромеханических реле и существующие Принцип действия бесконтактного коммутатора тока ана-
уже более 50 лет. логичен принципу действия бесконтактного трансмиттер-
Основным недостатком этих систем автоблоки- ного реле.
ровки является низкая надежность электромеханиче- Первоначально бесконтактный коммутатор тока раз-
ских приборов (маятниковых трансмиттеров, трансмит- рабатывался как составная часть электронной кодовой
терных реле, кодовых путевых трансмиттеров), которые автоблокировки, предназначенной для модернизации су-
в процессе эксплуатации находятся в постоянной дина- ществующей системы с числовым кодом. Однако и в ре-
мике, что приводит к быстрой выработке их ресурса. Не- лейно-контактной аппаратуре кодовой автоблокировки
редко износ контактов приборов участвующих в формиро- бесконтактный коммутатор тока способен решить задачу
вании кодовых сигналов приводит к искажениям кодовых повышения надежности коммутационного узла и повы-
импульсов в рельсовой цепи и, как следствие, к сбоям сить качество кода, способствуя тем самым улучшению
в работе автоматической локомотивной сигнализации, работы автоблокировки и устройств безопасности дви-
переездной сигнализации или нарушениям в работе ав- жения поездов – автоматической локомотивной сигнали-
тоблокировки в целом. Следствием длительного отказа зации.
такой системы вызвавшей неоправданную остановку или Другим бесконтактным прибором кодирования, повы-
снижение скорости поезда являются прямые экономиче- шающим надежность кодообразующей аппаратуры си-
ские потери, связанные с задержками поездов и снижение стем числовой кодовой автоблокировки является бес-
уровня безопасности движения поездов. [1] контактный кодово-путевой трансмиттер. БКПТ служит
По анализу Управления автоматики и телемеханики для формирования числовых кодов КЖ, Ж и 3 соот-
ОАО «РЖД» в 2010 году на сети дорог допущено 183 ветствующих сигнальным показаниям путевых свето-
случая нарушения нормальной работы устройств сигнали- форов с помощью полупроводниковых приборов и ло-
зации, централизации и блокировки из-за неисправности гических элементов. Универсальность приборов типов
кодовых путевых трансмиттеров КПТШ и 123 случая БКПТ заключается в том, что они могут, устанавлива-
из-за неисправности трансмиттерных реле ТШ, МТ. На ется в релейных шкафах кодовой автоблокировки, на ре-
долю этих приборов приходится 20 % неисправностей от лейных стативах систем электрической централизации
общего числа отказов устройств автоматики и телемеха- станций. [3]
ники по аппаратуре в целом. [5] Начиная с 1975 года, коллективы разных организаций
Замена действующих систем автоблокировки на другую занимались разработкой кодового трансмиттера на ос-
систему требует больших капитальных затрат. Но, не- нове электронных элементов. Однако в те годы широкого
смотря на ежегодно возрастающие темпы модернизации применения такой электронный аналог КПТШ не нашёл
систем автоматики и телемеханики, замены их на более из-за высокой стоимости изделия, потому что в кон-
надёжные микропроцессорные аналоги вопрос повы- струкции прибора было задействовано большое количе-
шения устойчивой работы действующих систем остаётся ство электронных элементов. [6 с. 22]
не менее важным в современных условиях.
С целью повышения надежности и безопасности фун-
кционирования устройств проводится модернизация от-
дельных элементов путем улучшения их конструкции,
характеристик и совершенствование технологии изготов-
ления.
Эффективным решением проблемы электромехани-
ческих приборов в современных условиях на сети дорог
ОАО «РЖД» является замена их на бесконтактные
электронные приборы. Так в схемах включения тран-
смиттерного реле ТШ начато использование бесконтак-
тного коммутатора тока БКТ, улучшающего работу кон-
тактов самого трансмиттерного реле ТШ; применение
52 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Впоследствии каждая новая модификация БКПТ – быстродействием, имеют малые размеры и массу, менее
БКПТР, БКПТ-У, БКПТ-УМ с помощью новых техниче- подвержены воздействию вибрации от проходящего под-
ских решений, используемых при построении электрон- вижного состава, срок службы таких приборов не зависит
ного трансмиттера, получила более высокие показатели от числа их срабатывания, из-за отсутствия механических
безопасности движения поездов и надёжности работы ав- перемещений.
тоблокировки. [6 с. 23]
Принципиально новой разработкой бесконтактных
приборов кодирования стал электронный кодовый пу-
тевой трансмиттер ЭКПТ-УРС. Он выполнен на базе
современных отечественных распределительных контр-
оллеров со встроенными средствами вычислительной тех-
ники, обеспечивающих высокую точность и надёжность
работы. [4]
Не менее важной, по своему значению, разработкой
является микроэлектронный датчик импульсов ДИМ-1,
предназначенный для использования взамен механиче-
ских маятниковых трансмиттеров типа МТ-1 и МТ-2 при
эксплуатации на железнодорожных переездах и постах
электрической централизации в качестве датчика импуль- Одним из главных преимуществ бесконтактных при-
сного управления рельсовыми цепями, мигающими ог- боров кодирования в сравнении с электромеханическими
нями ламп переездных светофоров и автошлагбаумов, является увеличение срока межинтервальных профилак-
а также ламп путевых светофоров. Датчик импульсов тических проверок в ремонтном технологическом участке
ДИМ-1 может размещаться в металлических шкафах на- РТУ предприятия – дистанции сигнализации, централи-
ружной установки и стабильно работать при пониженной зации и блокировки. Так трансмиттеры разных типов ТШ,
температуре, которая являлась причиной остановки меха- КПТШ и маятниковые реле МТ с контактной системой
нических маятниковых трансмиттеров. [2] проверяются в условиях РТУ – один раз в год. В свою
Принимая во внимание, что электромеханические при- очередь, бесконтактный кодовый трансмиттер БКПТ про-
боры в цепях кодирования рельсовых цепей числовой ко- ходит проверки в РТУ один раз в пять лет, проверка при-
довой автоблокировки вносят временные искажения ко- бора БКТ, а так же комплексная проверка микроэлек-
довых сигналов, необходимо проводить корректировку тронного датчика импульсов ДИМ и вовсе выполняется
временных параметров этих сигналов, поступающих на один раз в 10 лет. Экономическая эффективность от вне-
входы дешифраторов автоблокировки и автоматической дрения этих современных приборов бесконтактного коди-
локомотивной сигнализации, как в условиях ремонтных рования рельсовых цепей очевидна.
технологических участках РТУ – при регулировке дат- Используя, таким образом, современные технологии,
чиков кодов КПТШ и трансмиттерных реле ТШ, так и в удается преобразовать устаревшие системы автоматики
процессе текущей эксплуатации. Это является одним из управляющих движением поездов, как на станции, так и на
существенных недостатков кодирования рельсовых цепей перегоне и сделать их по-настоящему перспективными, и
электромеханическими датчиками типа КПТШ и электро- более надёжными, а также снизить эксплуатационные рас-
магнитными реле типа ТШ. ходы на их обслуживание, причем даже при более высокой
Бесконтактные приборы так же обладают большим стоимости применяемых бесконтактных приборов. [1]

Литература:

1. Современные приборы бесконтактного кодирования. edu.dvgups.ru


2. Техническое описание инструкция по эксплуатации 36291000 ТО Датчики импульсов микроэлектронные
ДИМ-1 и ДИМ-2
3. Технические описание и инструкция по эксплуатации БКПТ-У 36861–00–00 ТО
4. Электронный кодовый путевой трансмиттер ЭКПТ-УРС. Прайс – лист ЭЗ «ГЭКСАР».
5. Анализ случаев нарушения нормальной работы устройств СЦБ за 2010 год. Управление автоматики и телеме-
ханики ОАО «РЖД»
6. Бесконтактный кодовый путевой трансмиттер с резервированием БКПТР. Журнал АСИ № 5 2008 год.
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 53

Тепловой режим в горной выработке при ведении проходческих работ


в условиях криолитозоны
Соловьев Дмитрий Егорович, кандидат технических наук
Институт горного дела Севера СО РАН (г. Якутск)

Д етальная разведка месторождений твердых полезных


ископаемых Севера, строительство шахт и рудников,
а так же производство добычных работ предполагает про-
начальный момент времени первичная длина выработки
равна шагу её проходки за один цикл. При этом рассчи-
тываются температуры воздуха в выработке и трубопро-
ходку большого количества тупиковых выработок различ- воде, а также температура окружающего массива пород
ного назначения. Как известно, в условиях криолитозоны с учетом теплообмена с забоем выработки и транспорти-
проведение их в дисперсных горных породах и эксплуа- руемой отбитой горной массой. Перед следующим циклом
тация в летний период сопряжена с целым рядом трудно- проходки температуры в массиве горных пород запомина-
стей, связанных с необходимостью предотвращения ра- ются, и при расчетах после подвигания забоя использу-
степления атмосферным теплом, без чего невозможно ются как начальные данные. Данная процедура повторя-
обеспечение устойчивости выработок. Это предъявляет ется вплоть до окончания проходки выработки.
особые требования к режиму вентиляции, который осу- решение позволяет определить температуру воздуха
ществляется путем нагнетания воздуха вентиляторами в трубопроводе и выработке, оценить динамику темпе-
местного проветривания по гибким прорезиненным вен- ратурного поля в окружающем массиве пород, а также
тиляционным трубопроводам (рис. 1). определить параметры ореолов их протаивания в летний
Для определения безопасных параметров вентиляци- период ведения проходческих работ.
онного режима, при которых бы обеспечивалась устойчи- На основе разработанной методики были проведены
вость горных выработок и соответственно безопасность численные эксперименты по расчету теплового режима
ведения горных работ в летний период, была разработана тупиковой выработки при различных скоростях подви-
математическая модель, отражающая специфические ус- гания забоя, температуры подаваемого в выработку воз-
ловия формирования теплового режима многолетнемёр- духа.
злого горного массива при ведении проходческих работ, расчеты проводились при следующих исходных пара-
которая подробно описана в работе [1]. Модель позво- метрах: забой за 1 смену (8 часов) продвигается на 1,5, 2
ляет рассчитать температурный режим вскрывающей ту- и 3 м. Конечная длина проходимой выработки 180 м. При
пиковой выработки при нагнетательном режиме прове- трехсменном (восьмичасовом) режиме работы и заданных
тривания с учетом теплообмена воздуха в выработке с скоростях проходки выработки, забой переместится на
вентиляционным трубопроводом, забоем и транспортиру- расстояние 180 м соответственно через 40, 30 и 20 суток.
емой отбитой горной массой, а также с учетом скорости Естественная температура пород -4°С; теплопроводность
её проходки. талых и мерзлых пород соответственно 1,6 и 2 Вт/ (м∙К);
расчет температурного режима тупиковой выработки теплоемкость сухой породы 900 Дж/ (кг∙К); плотность
с учетом движения забоя проводился по следующему ал- породы 1800 кг/м3; влажность породы 0,2 д.е.
горитму: поперечные размеры расчетной области выби- Температура воздушной струи на входе в вентиляци-
раются с учетом теплового влияния вокруг выработки, онный трубопровод составляет +5 и +10°С. расход воз-
длина расчетной области превышает конечную длину про- духа, необходимый для проветривания выработки, в рас-
ходимой выработки на величину теплового влияния. В четах при использовании самоходной техники с дизельным

Рис. 1. Схема проветривания тупиковой выработки в период проходки:


1 – вентилятор; 2 – трубопровод; 3 – забой тупиковой выработки; 4 – исходящая струя.
54 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Рис. 2. Глубина протаивания пород вокруг выработки через 20 суток после начала проходки при различных
скоростях подвигания забоя. Температура и расход воздуха соответственно +10°С и 144 м3/мин.

Рис. 3. Глубина протаивания пород вокруг выработки при достижении длины 180 м при различных скоростях
подвигания забоя. Температура и расход воздуха соответственно +10°С и 144 м3/мин.

приводом принимается равным 800 м3/мин (для одной по- хности выработки и соответственно интенсивному охла-
грузочно-транспортной машины ПД-5А), без ее исполь- ждению исходящей вентиляционной струи.
зования 144 м3/мин (принимаемый по фактору разжи- Результаты расчетов показывают, что глубины прота-
жения газов после взрывных работ). ивания пород вокруг выработки при достижении длины
На рисунке 2 показаны графики глубины протаи- 180 м для различных скоростей подвигания забоя соответ-
вания вмещающих выработки горных пород через 20 ственно составят 0,3, 0,23 и 0,13 м (рис. 3).
суток после начала проходки при различных скоростях Снижение температуры поступающего в выработку
подвигания забоя. В выработку поступает теплый воздух воздуха до +5°С при скорости подвигания забоя 2 м/смену
с температурой +10°С, расходом 144 м3/мин. Как видно и неизменности остальных параметров позволяет обес-
из графиков, чем выше скорость подвигания забоя, тем печить мерзлое состояние вмещающих горных пород, к
на большем расстоянии от груди забоя окружающие вы- окончанию проходки выработки (рис. 4).
работку породы остаются в мерзлом состоянии и тем Как известно, использование самоходной техники с ди-
меньше глубина их протаивания в устьевой части, что по- зельным приводом при проходке выработки приводит к её
ложительно влияет на её устойчивость. Причиной этого высокой загазованности и, как следствие этого, требуется
в данном случае является тот факт, что при увеличении значительное увеличение количества воздуха подаваемого
скорости проходки выработки обнажаются все больше в забой, в конечном счете, это приводит к интенсивному
поверхностей с естественной температурой пород, что протаиванию окружающих горных пород практически по
приводит к более интенсивному поглощению тепла, вно- всей длине выработки, что наглядно видно из графиков,
симого вентиляционным потоком, всей площадью повер- представленных на рисунке 5.
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 55

Температура, o С
1

-1

-2
0 30 60 90 120 150 180
Длина, м
+10 C +5 C

Рис. 4. Изменение температуры стенки горной выработки по длине при различной температуре воздуха
подаваемого в выработку. Расход воздуха и скорость подвигания забоя соответственно 144 м3/мин и 2 м/смену.

Рис. 5. Глубина протаивания пород к окончанию проходки выработки при расходе воздуха 800 м3/мин,
температуре подаваемого воздуха +5°С и различной скорости подвигания забоя за одну смену.

Таким образом, по результатам расчетов можно сделать снизить температуру воздуха путем охлаждения его, на-
вывод о том, что для заданных скоростей подвигания забоя пример, в ледяных или грунтовых охладителях [2]. Исполь-
1,5; 2 м, расходе воздуха 144 м3/мин, и температуры воз- зование же самоходной техники при проходке выработки
духа подаваемого в выработку воздуха +5°С может быть приводит к высокой загазованности горной выработки, в
обеспечено мерзлое состояние вмещающих горных пород результате чего требуется значительное увеличение ко-
в течении всего периода проходки выработки, а при более личества воздуха подаваемого в забой, что в конечном
высоких температурах поступающего воздуха для предо- счете приводит к интенсивному протаиванию окружающих
твращения растепления пород необходимо предварительно горных пород практически по всей длине выработки.

Литература:

1. Хохолов Ю.А. Температурный режим многолетнемёрзлого горного массива при ведении проходческих
работ [Текст] / Ю.А. Хохолов, Д.Е. Соловьев // Горный информационно-аналитический бюллетень. – 2009.
№ 4. – с. 177–182.
2. Чабан П.Д. Расчет охлаждения рудничного воздуха в необсаженных ледяных каналах [Текст] / П.Д. Чабан, В.П.
Афанасьев, В.В. Журкович // Колыма. – 1976. – № 12. – С. 39–42.
56 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Технология оценки качества полиграфического шрифта


Токарь Ольга Владимировна, кандидат технических наук, доцент
Белорусский государственный технологический университет

О дной из составляющих допечатной стадии техноло-


гического процесса в полиграфии является выбор
качественного шрифта. Наряду с художественной цен-
зволяет измерять различимость визуальных образов с ди-
станции, обычной для чтения. Изменяя фокусировку линз,
наблюдатель устанавливает точку, в которой образ ста-
ностью, технологичностью, экономичностью к произ- новится узнаваемым. Результат приблизительно соотно-
водственным требованиям к шрифтам относится также сится с пороговым расстоянием [1].
удобочитаемость. Известно, что основное предназна- В методе изучения процесса чтения для подсчета ко-
чение шрифта – передача информации. Для достижения личества ошибок испытуемый должен читать текст вслух,
этой цели он должен быть удобочитаемым, т.е. читатель при этом экспериментально установлено, что скорость та-
должен считывать его, затрачивая минимальные усилия. кого чтения будет примерно в три раза ниже, чем скорость
Оценка удобочитаемости кириллических шрифтов ак- чтения про себя. Поэтому в этом методе в качестве кри-
тивно велась в 50–70-х годах XX века и касалась того терия удобочитаемости следует выбрать не время чтения
объема гарнитур, которые использовались в те годы. В текста, а количество ошибок, зафиксированных в про-
80-е годы XX века в МГУП работы проводились под руко- цессе чтения. Однако в тоже время чтение вслух не ха-
водством профессоров А.И. Колосова и М.И. Воскресен- рактерно и не привычно для большинства квалифициро-
ского. Методики этих исследований были весьма разроз- ванных читателей. Ошибки при чтении могут возникать
ненны, что обусловлено различиями в задачах, которые из-за вынужденного произношения текста.
ставили перед собой авторы. Ценность метода регистрации движения глаз при
С учетом определений удобочитаемости сформиро- чтении заключается в том, что в результате его приме-
вались и объективные методы ее изучения. Их можно нения были установлены некоторые особенности про-
условно разделить на две группы: цесса чтения. В результате экспериментов, проведенных
1. Методы, направленные, прежде всего, на изучение Э. Тейлором, было установлено, что для скорости чтения
различимости слов, отдельных знаков и их сочетаний: а) характерен большой индивидуальный разброс даже среди
тахистоскопия; б) определение порогового расстояния; в) испытуемых с одинаковой читательской квалификацией.
определение порога освещенности; г) оптическое изме- Наиболее объективным и функциональным методом
рение видимости; изучения удобочитаемости принято считать метод изме-
2. Методы, которые относятся к изучению процесса рения скорости чтения. Он заключается в определении
чтения. Наиболее распространенные из них: а) измерение времени чтения связного или несвязного текста заданного
скорости чтения; б) регистрация движения глаз в про- объема. Другим вариантом метода является определение
цессе чтения; в) регистрация частоты морганий; г) под- количества знаков, прочитанных испытуемым за опреде-
счет количества ошибок при чтении текста вслух. ленное время. Оба варианта считаются адекватными. [2]
Тахистоскопия позволяет определить минимальное Самый простой вид этого метода – хронометрирование
время экспозиции, необходимое для распознавания знака, чтения. К его недостаткам можно отнести то, что нельзя
слова и группы слов. К недостаткам такого метода можно достаточно точно фиксировать начало и конец чтения и
отнести то, что иногда части образов распознаются раньше нельзя вычислить все промахи во время чтения в резуль-
окончания экспонирования, подсказывая тем самым пра- тате отвлечения по тем или иным причинам внимания ис-
вильный ответ. Этот метод больше подходит для оценки пытуемых. М. Корш предложил прочитывать первое и
различимости отдельных знаков, чем для измерения удо- последнее слово текста, однако нет гарантии, что текст
бочитаемости сплошного текста. все-таки будет прочитан, во-вторых, даже если текст и
Методика определения порогового расстояния (дистан- будет прочитан испытуемым, можно говорить лишь о бе-
ционный метод) заключается в том, что с целью опреде- глом просмотре материала.
ления порогового расстояния знак (слово, текст) поме- Существует точка зрения, что дать объективную оценку
щают на определенном расстоянии от наблюдателя, таким удобочитаемости того или иного шрифта практически не-
образом, чтобы он не мог их распознать, а затем знак по- возможно, поэтому исследование может сводиться к уста-
степенно придвигают ближе до такого расстояния, пока на- новлению удобочитаемости шрифтов относительно экспе-
блюдатель не распознает его правильно. Однако эта проце- риментально выбранного эталона, например, в 60−70-е
дура подходит для отбора шрифтов для плакатов, дорожных годы прошлого века таким эталоном была Литературная
знаков, объявлений, системы городской ориентации, где не- гарнитура. Помимо исследований с применением специ-
сколько слов должны считываться с большого расстояния. альных методик и приборов, в типографике практикуется
Методика оптического измерения видимости приме- визуальный метод определения удобочитаемости тексто-
няется при помощи оптического прибора, который по- вого шрифта.
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 57

На основе анализа публикаций по данной теме с учетом объективно, но и на субъективные оценки, характеризу-
сформировавшейся тенденции в выборе методик иссле- ющие определенные качества шрифтов. Субъективная
дования была разработана технология комплексного ис- удобочитаемость отражает индивидуальные предпочтения
следования удобочитаемости современных типографских читателей по приятности для глаза и удобству при чтении
шрифтов на допечатной стадии полиграфического про- текстовых шрифтов и во многом связана с распространен-
изводства, которая направлена на прогнозирование и ностью, известностью и узнаваемостью рисунка шрифта.
оценку качество вновь разрабатываемых шрифтов. Для этого используется методика парного сравнения.
Она заключается в том, что испытуемым попарно предъ-
являются сравниваемые шрифты, из которых в каждой
паре испытуемый должен был выбрать один, наиболее со-
ответствующий его представлениям о привлекательном
и удобочитаемом шрифте. При необходимости методика
может быть дополнена субъективным шкалированием.
Затем проводится статистическая обработка данных. Со-
гласованность результатов экспертов определяется с по-
мощью коэффициента конкордации. При значимости с
вероятностью 99  % желаемым является коэффициент
коркордации выше 70 %, допустимым – выше 50 %.
Оценка удобочитаемости должна проводиться для
ряда шрифтов, поскольку оценить полученные резуль-
таты можно только в сравнении, то есть речь идет о
сравнительной удобочитаемости. Однако данная схема
применима и при оценке удобочитаемости шрифта при из-
меняемых параметрах набора (кегля, интерлиньяжа, по-
лосы набора и т.д.).
Классификация шрифтов проводится с помощью ме-
тодов распознавания образов. Под термином «распоз-
навание образов» подразумевают целый класс раз-
нообразных алгоритмов, позволяющих проводить
классификацию и идентификацию объектов. Сюда отно-
сятся методы кластерного анализа, методы многомерной
Схема обработки данных
классификации, многомерные группировки, методы фак-
торного анализа (факторный анализ и метод главных ком-
Оценка удобочитаемости на допечатной стадии по- понент).
лиграфического производства основана на определении Для прогнозирования качества разрабатываемого
времени чтения испытуемым связного текста. Способ шрифта используются дискриминантный анализ и метод
контроля чтения, применяемый в данной методике, заклю- дерева решений [3]. В качестве дискриминантной фун-
чается в том, что в тестовый материал вводятся условные кции была выбрана линейная дискриминантная функция
метки, которые при чтении необходимо отметить. вида f = a1x1+a2x2+...+apxp+c, причем если значение
Таким образом определяется объективная удобочита- функции f >0, то классифицируемый объект относится к
емость (время, затраченное на прочтение текста в опре- классу W1, а если f≤0, то идентифицируемый объект от-
деленном шрифтовом оформлении), которая в большей носится к классу W2.
степени связана с различимостью силуэтов слов (или от- Для получения решающего правила использовался
дельных знаков), с быстротой их идентификации, с узна- подход под названием «распознавание с учителем». В его
ваемостью букв в том или ином рисунке. основе лежат заранее подготовленные классы объектов,
После оценки времени чтения для шрифтов прово- которые используются для обучения, и набор правил,
дится проверка закона распределения и однофакторный которые регулируют отнесение объекта к определен-
дисперсионный анализ. Если значения критерия Пирсона ному классу. После формулировки решающего правила,
для шрифтов показывают, что распределение экспери- можно использовать подход под названием «обучение без
ментальных данных можно признать нормальным, а од- учителя». Если решающее правило обеспечивает верное
нофакторный дисперсионный анализ (критерий Фишера) распознавание более 75 % объектов, то полученный ре-
показывает, что средние значения времени чтения неод- зультат, на наш взгляд, является вполне удовлетвори-
нородны, тогда к шрифтам может быть применено ранжи- тельным и позволяет предсказывать качество для вновь
рование. разрабатываемых или тестируемых шрифтов.
При анализе удобочитаемости шрифтов следует опи- Для прогнозирования качества объектов популярным
раться не только на критерии, которые можно измерить является метод дерева решений (или дерева решающих
58 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

правил). Базой данных, на основе которых осуществля- В зависимости от способа определения удобочитае-
ется прогнозирование, являются геометрические пара- мости (время чтения, парные сравнения) проводится вы-
метры шрифтов и удобочитаемость, выраженная в чи- деление значимых атрибутов (геометрических параме-
словых значениях. Геометрические характеристики тров) и конструирование решающих правил, которые
должны фиксировать основу графических признаков и ри- позволяют прогнозировать сравнительную удобочитае-
сунка символа, при этом должны быть выражены в виде мость вновь измеренных шрифтов.
соотношений: пропорциональность, контрастность, отно- По вышеописанной технологии была проведена
шение величины кегля к высоте буквы, отношение основ- оценка удобочитаемости ряда современных компью-
ного штриха к внутрибуквенному просвету, размер за- терных шрифтов, их классификация и сформулированы
сечек. В качестве базовых допустимо задействовать два решающие правила для прогнозирования качества новых
символа: «а» и «н» (прописное и строчное начертания). шрифтов.

Литература:

1. Karow P. Font Technology. – Heidelberg: Springer Verlag, 1994. – 484 р.


2. Ушакова М.Н. Обзор работ по удобочитаемости шрифтов для новых стандартов // Труды ВНИИ ОПИТа. Во-
просы разработки новых типографских шрифтов дл русских и латинских алфавитов. – М., 1974. – С. 23–56.
3. Райхман Э.П., Азгальдов Г.Г. Экспертные методы в оценке качества товаров. − М.: «Экономика», 1974. −
151 с.

Классификация современных полиграфических шрифтов


методами поиска латентных факторов
Токарь Ольга Владимировна, кандидат технических наук, доцент
Белорусский государственный технологический университет

Д ля ориентировки в многообразии типографских


шрифтов существует несколько видов их классифи-
каций, т.е. систематизации по группам.
тиква классицизма, рукописная антиква, египетские
шрифты, гротески, рукописные шрифты.
В классификации, принятой в СССР [3], в качестве
Одной из первых классификаций шрифтов по графи- важнейших графических признаков также использова-
ческим признакам была сформулирована в начале 20-х лись наиболее простые для наблюдения признаки: кон-
годов XX века французским историком шрифта Ф. Ти- трастность, наличие и форма засечек. В соответствие с
бодо [1]. В его классификации все шрифты по форме за- этим шрифты подразделялись на шесть основных групп:
сечек подразделялись на четыре группы: древние, еги- группа рубленых шрифтов, группа шрифтов с едва наме-
петские, типа эльзевир, типа дидо. Однако только форма тившимися засечками, группа медиевальных шрифтов,
засечек не может служить единственным признаком группа обыкновенных шрифтов, группа брусковых
классификации, поэтому такой подход не получил широ- шрифтов, группа новых малоконтрастных штрихов. К до-
кого распространения. В 1959 году [1] была опублико- полнительной группе относятся шрифты, которые по по-
вана так называемая десятичная классификация латин- строению и характеру рисунка сильно отличаются от
ских шрифтов, в которой делалась попытка установить шрифтов основных групп. Существуют также классифи-
тип рисунка шрифта в соответствие со стилем в изобра- кации MS WINDOWS, IBМ CLASSIFICATION, система
зительном искусстве (ренессанс, барокко, новый стиль и PANOSE и др.
т.д.). Однако такое деление также оказалось спорным и Целью работы является классификация ряда совре-
не всегда последовательным. менных шрифтов на основе их геометрических характе-
Немецкий ученый А. Капр [2] предложил иную класси- ристик. Они были измерены как для строчных букв «а» и
фикацию, суть которой заключалась в том, что автор уста- «н», так и для прописных.
новил графические признаки, на основе которых шрифты Отобранные для классификации пятнадцать гарнитур
делятся на группы. Главными из них, по его мнению, яв- без засечек и пятнадцать гарнитур с засечками приве-
лялись контраст между основными и соединительными дены в таблице. Там же помещены результаты оценки
штрихами, а также наличие и форма засечек. В соот- качества шрифтов, полученные по объективной и субъ-
ветствие с таким подходом были выделены следующие ективной методикам. Объективная оценка отражает ре-
группы: классическая антиква, переходная антиква, ан- зультаты эксперимента на скорость чтения. Субъек-
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 59

Характеристика ряда современных гарнитур шрифтов

№ п/п Гарнитура Засечки Позиция по объективной / субъективной оценке


1 Adonis + 21 / 7
2 AvantGardeGothic - 28 / 26
3 Bookman + 24 / 8
4 BellGothic - 26 / 29
5 Charter + 23 / 2
6 Eras - 20 / 24
7 FuturaFuturis - 17 / 23
8 GeoSlb712 + 19 / 13
9 Kabel - 25 / 21
10 Kis + 29 / 27
11 NewBaskerville + 2 / 14
12 Newton + 13 / 3
13 OCRF-Regular - 22 / 28
14 Octava + 27 / 5
15 Pragmatica - 15 / 9
16 Raleigh + 14 / 17
17 Times NEW Roman + 16 / 10
18 Orenburg - 5 / 15
19 Parangon - 30 / 25
20 Univers - 11 / 16
21 Cooper + 7/6
22 FranklinGothicBook - 10 / 11
23 Gothic725 - 12 / 19
24 Humanists 31 - 1 / 20
25 SwiftCTT + 3/4
26 TextBook - 8 / 18
27 ZapfEUiptical711 + 18 / 1
28 Sabon + 9 / 12
29 OfficinaSans - 6 / 22
30 OriginalGaramond + 4 / 30

тивная оценка получена методом экспертного опроса и Полученные при факторном анализе данные позво-
касается эстетико-художественных свойств изучаемых ляют выделить четыре условные группы геометрических
гарнитур. параметров с близкими значениями.
В тех случаях, когда изучаемый объект является 1-я группа: пропорциональность «а», «А», «н», «Н»,
сложным и характеризуется многочисленными косвен- отношение величины кегля к высоте «а», «А», «н», «Н»,
ными признаками, то необходим анализ с целью уста- отношение ширины основного штриха к внутрибуквенному
новления скрытых (латентных) факторов, позволяющих просвету для «а», «А», «н»; «Н», коэффициент асимме-
классифицировать объекты исследования. Одним из под- трии «а», процент белого пространства «а»; 2-я группа:
ходов в области классификации шрифтов может служить размер засечек «А», «н», «Н»; 3-я группа: контрастность
установление свойственных им латентных факторов, по- «а», «А», «н», «Н», отношение максимальной толщины
зволяющих добиться деления шрифтов на определенные штриха к минимальной толщине для «А», «н», «Н»; 4-я
группы. группа: отношение максимальной толщины штриха к ми-
Исследование исходных двадцати пяти геометриче- нимальной толщине для «а».
ских параметров методами факторного, компонентного и Результаты классификации двадцати пяти геометри-
кластерного анализа позволяет определить достаточное ческих параметров методами факторного и компонен-
количество признаков для дальнейшей классификации тного анализа полностью совпадают. Можно сделать
гарнитур. вывод, что для дальнейшей обработки достаточно поль-
60 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

зоваться одним признаком из каждой группы (пропор- заключаются в следующем: а) гарнитура Adonis рас-
циональность, размер засечек, контрастность «н», от- полагается отдельно, а не во второй группе; б) гарни-
ношение максимальной толщины штриха к минимальной туры Bookman и OriginalGaramond находятся в третьей
толщине «а»). Однако в результате кластерного анализа группе, а не во второй. Сходством является то, что гар-
шрифты могут быть разбиты не на четыре, а на шесть нитуры GeoSlb712, NewBaskerville и Kis также находятся
условных групп. отдельно от второй и третей групп.
1-я группа: пропорциональность «а», «А», «н», «Н», При сопоставлении с данными по эстетико-художе-
отношение величины кегля к высоте «А», «Н», коэф- ственной оценке гарнитур нами выявлены определенные
фициент асимметрии «а»; 2-я группа: контрастность зависимости. В первую группу входят двенадцать гар-
«а», «А», «н», «Н», отношение максимальной толщины нитур, расположенных в группе с низкой удобочитае-
штриха к минимальной толщине для «А», «н», «Н»; 3-я мостью, и три гарнитуры с высокой удобочитаемостью
группа: размер засечек «А», «н», «Н»; 4-я группа: от- (Pragmatica, Orenburg, FranklinGothicBook). Во вторую
ношение максимальной толщины штриха к минимальной и третью группы входят двенадцать гарнитур с высокой
толщине для «а»; 5-я группа: отношение величины кегля удобочитаемостью и три с низкой (OriginalGaramond, Ra-
к высоте для «а», «н»; 6-я группа: отношение ширины leigh, Kis).
основного штриха к внутрибуквенному просвету для «а», Кластерный анализ позволяет разбить объекты на
«А», «н», «Н», процент белого пространства «а». две группы (по тринадцать и семнадцать гарнитур). При
В каждой группе также можно выделить по одному ге- сравнении с эстетико-художественной оценкой шрифтов
ометрическому параметру, например, отношение макси- можно констатировать, что в первой группе нахо-
мальной толщины штриха к минимальной толщине для дится одиннадцать гарнитур с высокой удобочитаемо-
«а», пропорциональность «н», контрастность «н», размер стью (85 %) и две гарнитуры с низкой удобочитаемостью
засечек «н», отношение величины кегля к высоте для (15 %). Вторую группу составляют четыре гарнитуры с
«н», отношение ширины основного штриха к внутрибук- высокой удобочитаемостью (24 %) и тринадцать гарнитур
венному просвету для «н». По сравнению с факторным с низкой удобочитаемостью (76 %). Взаимосвязи с объек-
и компонентным анализом при этом методе добавляются тивной оценкой удобочитаемости не обнаружено.
еще две последние характеристики. Исследование выбранных тридцати гарнитур методами
Исследование шрифтов методами факторного, компо- факторного, компонентного и кластерного анализа при
нентного и кластерного анализа (при двадцати пяти гео- четырех геометрических параметрах показало, что для
метрических признаках) непосредственно представляет классификации гарнитур достаточно учитывать по одному
собой классификацию произвольно выбранных тридцати признаку из каждой группы. Как и при анализе двадцати
шрифтов. При наличии вышеперечисленных двадцати пяти геометрических характеристик, при факторном ана-
пяти характеристик шрифта методом факторного анализа лизе первую группу составляют пятнадцать гарнитур без
гарнитуры образуют три отдельные группы. засечек. Во вторую группу входят одиннадцать гарнитур
Первая группа включает в себя пятнадцать гарнитур с засечками, все кроме GeoSlb712, NewBaskerville, Kis и
без засечек: AvantGardeGothic, BellGothic, Eras, Fu- Swift.
turaFuturis, Kabel, OCRF-Regular, Pragmatica, Oren- Результаты компонентного анализа позволяют сделать
burg, Parangon, Univers, FranklinGothicBook, Gothic вывод, что первую группу также составляют пятнадцать
725, Hurnanist531, TextBook, OfficinaSans. Во вторую гарнитур без засечек. Во вторую группу входят восемь
и третью группу входят гарнитуры с засечками. Вторая гарнитур с засечками, все кроме GeoSlb712, NewBasker-
группа (восемь гарнитур): Bookman, GeoSlb712, Ra- ville, Kis и Swift. Отличием от факторного анализа явля-
leigh, Cooper, Adonis, Octava, Charter, OriginalGara- ется то, что во вторую группу не вошли гарнитуры Raleigh,
mond. Третья группа (семь гарнитур): ZapfElliptical711, OriginalGaramond и ZapfElliptical711.
Sabon, Newton, Times NEW Roman, Swift, NewBasker- При проведении кластерного анализа четко видны две
ville, Kis. самостоятельные группы: пятнадцать гарнитур с засеч-
Гарнитуры Bookman, GeoSlb712, NewBaskerville и Kis ками и пятнадцать гарнитур без засечек.
достаточно далеко расположены относительно совокуп- Таким образом, при классификации как при двадцати
ности других гарнитур, поэтому можно предположить, что пяти геометрических параметрах, так и при четырех гар-
они имеют самостоятельный характер. нитуры разбиваются на две группы: с засечками и без за-
При компонентном анализе (также как и при фак- сечек. Однако если значения гротесков имеют ярко выра-
торном) в первую группу объединено пятнадцать гар- женный близкий характер, то среди антикв наблюдаются
нитур без засечек. Во второй группе находятся: Raleigh, исключения, которые могут иметь самостоятельный ха-
Cooper, Octava, Charter. В третьей группе расположены: рактер. Выявлена зависимость между полученной класси-
Bookman, OriginalGaramond, ZapfElliptical711, Sabon, фикацией и эстетико-художественной оценкой гарнитур
Newton, Times NEW Roman, Swift. читателями. Зависимости между полученными данными и
По сравнению с факторным анализом результаты ком- результатами по объективной оценке удобочитаемости не
понентного анализа имеют отличия и сходство. Отличия обнаружено.
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 61

Литература:

1. Большаков М.В., Гречихо Г.В., Шицгал А.Г. Книжный шрифт. – М.: Книга, 1964. – 312 с.
2. Капр А. Эстетика искусства шрифта. Тезисы и маргиналии со 152 иллюстрациями. – М.: Книга, 1979. – 124 с.
3. Ярмола Ю.А. Компьютерные шрифты. – СПб.: BHV-Санкт-Петербург, 1994. – 208 с.

Проблемы и перспективы развития пассажирского транспорта


Шальнова Наталья Сергеевна, аспирант
Тихвинский филиал Санкт-Петербургского государственного университета сервиса и экономики

Г оворить о транспорте – это все равно, что говорить


о движении, от которого зависит эволюция челове-
чества. На протяжении нескольких тысяч лет человек в
негативных качеств. В процессе движения водители мар-
шрутных такси совершают перестроений из полосы в
полосу на 65  % больше, чем водители общественного
своем развитии прошел этап от момента изобретения ко- пассажирского транспорта. Водители «маршруток» до-
леса до освоения вселенной, и если сравнить древние по- биваются более высоких скоростей сообщения не за счет
требности человечества в транспорте, то они ничтожно уменьшения количества остановок, а за счёт скоростных
малы, по сравнению с современными. Ни одно государ- качеств автомобилей. Агрессивная манера вождения мар-
ство в мире в своем историческом развитии не обходилось шрутных такси, вызванная конкуренцией за пассажира на
и не обойдется без развитой транспортной инфраструк- дороге и стремление совершить как можно большее число
туры. В жизнь современного города важной составной ча- поездок приводит к возникновению частых аварийных си-
стью вошел пассажирский транспорт, основной задачей туаций [2].
которого является обеспечение потребности населения в Отсутствие оборудованных для маршрутных такси
перевозках при систематическом улучшении качества об- остановок и наличия остановок вне плана часто приводит
служивания пассажиров. Транспортная подвижность жи- к повышению аварийной обстановки на дороге вследствие
телей и средняя дальность их поездок растет по мере роста резкого торможения после разгона и нарушения рядности
численности и городской территории. В соответствии с движения. Установка незаконных дополнительных мест и
этим дальнейшее развитие, совершенствование и улуч- перевозка стоячих пассажиров является нарушением за-
шение качества обслуживания пассажирских перевозок конодательства и приводит к снижению комфортабель-
актуально для изучения и реализации. ности и безопасности поездки. Отсутствие кондуктора в
Одной из основных проблем городского обществен- салоне возлагает на водителя дополнительные обязан-
ного транспорта является сильная изношенность и недо- ности, выполнение которых отвлекает его. Водители ра-
статочные темпы обновления подвижного состава. Как ботают по 10–12 часов без какого-либо перерыва на
следствие износа подвижного состава – снижается уро- обед, тем самым нарушая все существующие нормы труда.
вень технической надежности и безопасности пассажир- Это ведёт к утомляемости и как следствие повышается ве-
ского транспорта, возрастает поток сходов с линии по тех- роятность возникновения ДТП [2].
ническим неисправностям. Кроме того, в значительной Вся вышеперечисленная проблематика, а также по-
степени растут затраты на эксплуатацию подвижного со- требность в улучшении экологической обстановки жилой
става и себестоимость перевозок пассажиров. Увели- зоны города, необходимость разгрузить пассажиропотоки
чение транспортной подвижности населения, в усло- в местах с интенсивным движением транспорта настоя-
виях сокращения провозных возможностей приводит к тельно требует изменения концепции дальнейшего раз-
росту наполняемости салонов. В часы «пик» она почти вития городского транспорта.
втрое превышает значения, рекомендованные Междуна- Данный вопрос требует комплексного подхода, который
родным союзом общественного транспорта, и достигает включает в себя одновременное решение нескольких
физического предела. Не обеспечивается не только мини- задач. Такими задачами могут быть совершенствование
мальный уровень комфортности поездок пассажиров, но тарифной политики, создание информационно-аналити-
и необходимые условия соблюдения безопасности при их ческой системы управления общественным транспортом,
перевозках [1]. мониторинг функционирования общественного тран-
Что касается пассажирских перевозок маршрутными спорта, формирование единой маршрутной сети и ее оп-
такси, то, несмотря на положительные стороны данного тимизация, создание системы диспетчерского управ-
вида пассажирского транспорта, такие как высокая ско- ления общественным транспортом, снижение вредного
рость доставки, широкий охват транспортной сети города, воздействия общественного транспорта на окружающую
относительный уровень комфорта, они обладают рядом среду [5].
62 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Говоря о совершенствовании тарифной политики, – заключение контрактов с перевозчиками на дли-


стоит отметить то, что проблема предприятий обществен- тельный период времени (от 3 до 5 лет) может послужить
ного транспорта заключается в том, что они не могут стать стимулом для инвестирования в сферу пассажирских пе-
в современных условиях прибыльными за счет более эф- ревозок финансовых средств и привлечет новых перевоз-
фективной работы, а не за счет повышения тарифов. И чиков;
сегодня в целом они остаются убыточными. Особенность – предоставление субсидий на транспортное обслу-
функционирования общественного транспорта заключа- живание населения в целях компенсации перевозчику
ется в необходимости согласования экономических ин- убытков, возникших вследствие регулирования тарифов и
тересов транспортных предприятий и общественных ин- перевозки льготных категорий граждан, должно предпо-
тересов с учетом потребностей всех слоев населения и лагать использование механизмов мобилизации внутри-
предполагает строго взвешенный подход к формированию хозяйственных резервов транспортных предприятий, оп-
тарифов за пользование услугами общественного тран- тимизации их производства и т.п. [5].
спорта. Сегодня для удовлетворения требований насе- В современных условиях совершенствование та-
ления к транспортным услугам по количественным, каче- рифной политики заключается в создании эффективного
ственным и экономическим параметрам и одновременном механизма, основанного на использовании различных со-
обеспечении рентабельности предприятий общественного четаний элементов рыночного и государственного регу-
транспорта необходимо сдерживать рост тарифов на об- лирования рынка транспортных услуг с учетом их соци-
щественном транспорте [1]. альной значимости.
Основными способами снижения роста тарифов яв- Основными задачами совершенствования тарифной
ляются государственное регулирование и создание ры- политики являются:
ночной экономики, при осуществлении которых следует – мониторинг тарифов в целях ограничения их инфля-
учитывать следующие основные моменты: ционного влияния;
– государственное регулирование зачастую оказыва- – ограничение тарифов для обеспечения доступности
ется слишком жестким, что приводит к ослаблению ры- транспортных услуг и недопущения их оказания ниже се-
ночных стимулов и оттоку капиталов из отрасли; бестоимости (демпинга) или долгосрочного применения
– отмена регулирования тарифов сопряжена с риском заниженных цен, не позволяющих обеспечить безопа-
резкого повышения платы за проезд, а сохранение регу- сность транспортного процесса;
лирования к ухудшению транспортного обслуживания на- – обеспечение ценовой прозрачности рынка за счет
селения. При регулировании тарифов наблюдаются еди- расширения практики применения принципа «объявлен-
нообразный пакет транспортных услуг и у перевозчиков ного тарифа»;
отсутствуют стимулы к введению новшеств в транспор- – обеспечение в интересах пользователей транспор-
тном обслуживании; тных услуг стабильности и унификации тарифов [5].
– механизм рыночной конкуренции также имеет свои В сфере автомобильного и электрического обществен-
недостатки, так как конкуренция часто оказывается не- ного транспорта тарифное регулирование предполагает
достаточной, недобросовестной и в итоге приводит к сни- повышение ценовой доступности услуг общественного
жению качества транспортного обслуживания населения; транспорта для менее обеспеченных слоев населения. Та-
– при наличии конкуренции привлечение частных пе- рифное регулирование осуществляться путем постепен-
ревозчиков может уменьшить бюджетную нагрузку и по- ного выравнивания уровня транспортной обеспеченности
высить качество предоставляемых транспортных услуг, а городских и пригородных маршрутов и создания условий
при ее отсутствии – ухудшить качество транспортного об- для улучшения качества услуг. Ценообразование на пере-
служивания населения, а также вызвать рост стоимости возки в коммерческом режиме должно основываться на
проезда; учете конъюнктуры рынка и повышенного качества тран-
– заключение контрактов на транспортное обслужи- спортных услуг.
вание на конкурсной основе является достаточно эффек- Создание информационно-аналитической системы
тивным средством создания конкуренции. Система кон- управления общественным транспортом обусловлено не-
курсов позволяет достичь более эффективных и высоких обходимостью повышения эффективности управления
показателей уровня транспортных услуг. Для этого не- общественного транспорта и мониторинга его функцио-
обходимо создать продуманную и взвешенную систему нирования.
конкурсов, основанных на объективных оценках уровня Основными задачами данной системы являются:
претендентов и вынесения частных решений с макси- – осуществление мониторинга функционирования об-
мальным исключением субъективных подходов. При щественного транспорта;
этом одним из вариантов обеспечения общего уровня – формирование и оптимизация единой маршрутной
рентабельности пассажирских перевозок может быть сети общественного транспорта;
формирование лотов, объединяющих низкорента- – осуществление диспетчерского управления общест-
бельные и убыточные социально значимые маршруты с венным транспортом;
рентабельными; – автоматизация продажи проездных документов на
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 63

автомобильный, железнодорожный, воздушный и вну- Осуществление диспетчерского управления общест-


тренний водный общественный транспорт. венным транспортом обеспечивает оперативное управ-
Осуществление мониторинга функционирования об- ление общественным транспортом и формирует объек-
щественного транспорта в рамках вышеуказанной си- тивную информацию о его функционировании. Для этого
стемы позволит исполнительным органам государст- необходимо в рамках информационно-аналитической си-
венной власти и органам местного самоуправления стемы управления общественным транспортом информа-
муниципальных образований: ционно объединить центральные диспетчерские службы
– вести централизованный учет и хранить информацию муниципальных образований, диспетчерские пункты на
об объектах общественного транспорта, его инфра- транспортных предприятиях, вокзалах и станциях.
структуре (в том числе подвижной состав, остановочные Диспетчерское управление общественным тран-
пункты, станции и вокзалы) и хозяйствующих субъектах, спортом обеспечит:
предоставляющих транспортные услуги; – повышение качества транспортного обслуживания
– исключить дублирование в работе по сбору и хра- населения за счет непрерывного автоматизированного
нению информации; контроля движения в режиме реального времени,
– обрабатывать и анализировать актуальные данные по – координацию и синхронизацию работы всех видов об-
общественному транспорту; щественного транспорта за счет увязки интервалов дви-
– исключить риск использования устаревших данных жения по периодам дня на соприкасающихся маршрутах;
при проведении анализа и принятии управленческих ре- – повышение эффективности использования подвиж-
шений в сфере общественного транспорта; ного состава за счет сокращения непроизводительных
– повысить эффективность межведомственного вза- потерь времени на маршруте и рационального исполь-
имодействия за счет общедоступного использования со- зования подвижного состава и резерва на наиболее загру-
бранных сведений; женных направлениях;
– исключить многократное предоставление хозяйст- – повышение безопасности пассажирских перевозок за
вующими субъектами идентичную (однотипную) инфор- счет оперативного оповещения водителей транспортных
мацию в органы власти, контролирующие общественный средств об авариях и чрезвычайных ситуациях на мар-
транспорт [5]. шрутной сети и информационного обеспечения меропри-
Формирование единой маршрутной сети обществен- ятий по ликвидации последствий дорожно-транспортных
ного транспорта предполагает ведение реестра маршрутов происшествий и чрезвычайных ситуаций посредством ор-
общественного транспорта на региональном и муници- ганизации связи водителей транспортных средств, участ-
пальном уровнях. Реестр должен представлять собой ин- ников дорожно-транспортных происшествий с предста-
формационную систему учета в электронном и бумажном вителями оперативных служб (скорая помощь, милиция
носителях сведений о маршрутах общественного тран- и др.);
спорта (включая его номер, путь следования, с указанием – предоставление информации населению о расписа-
места остановочных пунктов и их наименования, места ко- ниях движения общественного транспорта через инфор-
нечных остановочных пунктов). Данные реестра должны мационно-телекоммуникационную сеть Интернет, ин-
быть открытыми и общедоступными, подлежат опублико- формационные киоски, в Call-центрах по городской и
ванию в средствах массовой информации и размещаться сотовой телефонной связи и через другие средства инфор-
в информационно-телекоммуникационной сети Интернет. мирования населения;
Для улучшения и упорядочения движения обществен- – оперативное информирование пассажиров на оста-
ного транспорта, обеспечения комфортных условий пере- новках (вокзалах) общественного транспорта с помощью
садки пассажиров с одного транспорта на другой и эффек- остановочных табло об ожидаемом времени прибытия
тивности использования подвижного состава необходимо (отправления) общественного транспорта, номере мар-
осуществить оптимизацию маршрутной сети с примене- шрута и фактическом времени прибытия очередного тран-
нием логистических принципов развития транспорта. спортного средства.
Оптимизация маршрутной сети обусловлена необходи- – полный переход на автоматизированный учет и
мостью: контроль организации работы транспортного комплекса
– исключения дублирования маршрутов движения об- путем интеграции вокзалов, автостанций, транспортных
щественного транспорта; предприятий и транспортных средств в единое информа-
– сокращения транзитных маршрутов общественного ционное пространство [5].
транспорта, проходящих через центры городов; Все более актуальной становится проблема обеспе-
– распределения подвижного состава по маршрутам с чения охраны окружающей среды от вредного воздействия
учетом пропускной способности дорог, допустимой ско- транспортных средств, в том числе общественного тран-
рости движения и в соответствии с его потребностями на спорта. Снижение вредного воздействия всех видов об-
маршруте; щественного транспорта на здоровье человека и окружа-
– открытия новых маршрутов общественного тран- ющую среду достигается за счет перехода на применение
спорта для удовлетворения потребностей населения [5]. транспортных средств, работающих на экологически
64 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

видах топлива и альтернативных источниках энергии, а – сокращение транспортных издержек транспортных


так же снижение энергоемкости транспортных средств. предприятий;
Для чего необходимо: – снижение негативного влияния общественного тран-
– разработать и ввести механизм стимулирования тран- спорта на окружающую среду [6].
спортных организаций, использующих такие транспор- Транспорт, как грузовой, так и пассажирский в нашей
тные средства и источники топливно-энергетических ре- стране способствует решению таких важных политиче-
сурсов; ских задач, как ликвидация экономического отставания
– усилить контроль технического состояния эксплуати- окраинных районов, противоположности между городом
руемых транспортных средств по экологическим показа- и деревней, расширение связей народов нашей страны,
телям, ограничения выбросов и утилизации отходов тран- укрепление их дружбы, обмен достижениями во всех от-
спортных предприятий; раслях народного хозяйства и областях культуры.
– использование технических средств по сбору, ком- Транспорт имеет огромное значение для экономического
плексной переработке и утилизации различных видов от- и культурного сотрудничества России с другими странами,
ходов, образующихся при эксплуатации или попадающих укрепления и развития экономической системы хозяйст-
в водную среду в результате аварий объектов водного вования, в решении социально-экономических проблем.
транспорта. Обеспеченность территории хорошо развитой транспор-
Реализация данных мероприятий обеспечит: тной системой является одним из факторов привлечения
– рост конкурентоспособности предприятий общест- населения и производства, служит важным преимуще-
венного транспорта; ством для размещения производительных сил и дает интег-
– повышение эффективности управления общест- рационный эффект. Так же транспорт создает условия для
венным транспортом; формирования местного и общегосударственного рынков.
– увеличение количества перевезенных пассажиров; Всё это создает предпосылки для дальнейшего раз-
– повышение качества и безопасности транспортного вития и совершенствования транспортной системы в
обслуживания населения; целом и пассажирской транспортной системы в частности.

Литература:

1. Алексеева, И.М. Статистика автомобильного транспорта : учебник / И.М. Алексеева, О.И. Ганченко, Е.В.
Петрова. – М.: Экзамен, 2005. – 352 с.
2. Бычков, В.П. Предпринимательская деятельность на автомобильном транспорте: перевозки и автосервис:
учебное пособие / В.П. Бычков. – М.: Академический проект, 2009. – 573 с.
3. Гудков, В.А. Пассажирские автомобильные перевозки : учебник / В.А. Гудков, Л.Б. Миротин, А.В. Вельможин,
С.А. Ширяев. – М.: Горячая линия – Телеком, 2006. – 447 с.
4. Менеджмент на транспорте: учебное пособие для студ. Высш. учебных заведений / Н.Н. Громов, В.А. Персианов,
Н.С. Усков и др.; под общей ред. Н.Н. Громова, В.А. Персианова. – М.: Изд. Центр Академия, 2003. – 528 с.
5. Спирин, И.В. Организация и управление пассажирскими автомобильными перевозками : учебник / И.В.
Спирин. – М.: Академия, 2011. – 398 с.
6. Туревский, И.С. Автомобильные перевозки: учебное пособие / И.С. Туревский. – М.: Издательский Дом
«Форум», 2011. – 222 с.

Анализ современной концепции эксплуатации объектов недвижимости


Эбзеев Мурат Борисович, аспирант
Северо-Кавказская государственная гуманитарно-технологическая академия (г. Черкесск)

В статье проведен анализ современных подходов к исследованию стадии эксплуатации объектов недви-
жимости с точки зрения энергопотребления и дано обоснование необходимости управления энергосбереже-
нием в существующих зданиях. Предложена оптимизация принимаемых решений по сохранности и воспроиз-
водству объектов недвижимости с учетом энергосберегающих мероприятий.

П ереход к рыночным отношениям в экономике и, как


следствие этого, разгосударствление собственности
с одной стороны привело к появлению многообразия соб-
лало неэффективными нормативные методы организации
ее эксплуатации (содержания и ремонта), которые были
разработаны в нашей стране в советский период. В их ос-
ственников на объекты недвижимости, а с другой – сде- нове лежала система планово-предупредительных ре-
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 65

Рис. 1. Жизненный цикл здания

монтов, посредством которой восстанавливались проек- высокого уровня комфорта за счет применения совре-
тные параметры объектов недвижимости, снижающиеся в менных мультимедийных средств, контроля безопасности,
процессе эксплуатации с течением времени под воздейст- оптимизации количества потребляемой энергии посред-
вием внешних и внутренних факторов, воздействующих на ством телеметрии и многое другое.
конструктивные элементы и инженерные системы здания Широко известно, что каждое здание имеет свой жиз-
или сооружения. ненный цикл (рис. 1), который включает следующие
Под воздействием этих факторов конструкции изнаши- стадии:
ваются, стареют, разрушаются, вследствие чего эксплуа- – возникновение (строительство);
тационные качества зданий и сооружений ухудшаются и с – функционирование (эксплуатация), которое связано
течением времени они перестают отвечать своему назна- с уменьшением отдачи полезных свойств по причине на-
чению. копления износа;
В строительной науке для определения уровня воздей- – прекращение существования (утилизация).
ствия этих факторов на элементы объекта недвижимости Все входящие в состав здания элементы и подсистемы,
и установления их предельных (допустимых) значений в в свою очередь, также имеют свои сроки службы, то есть
период эксплуатации зданий и сооружений, введены пара- свои жизненные циклы, которые в определенной мере
метры эксплуатационных качеств (ПЭК), которые соот- взаимосвязаны между собой. Существование совокуп-
ветствующим образом нормируются и используются при ности жизненных циклов в одном объекте обусловливает
проектировании различных по назначению объектов не- появление синергетического эффекта, который может
движимости. приводить как к уменьшению длительности жизненного
В настоящее время, в городах Москва, Ростов-на- цикла объекта в целом, так и при соответствующих усло-
Дону, Липецке уже используются рыночные методы орга- виях технической эксплуатации, поддержании технико-
низации эксплуатации (содержания и ремонта) объектов экономических характеристик объекта – к увеличению
недвижимости, которые базируются на системе монито- продолжительности жизненного цикла объекта в целом.
ринга, дающего возможность своевременно выявить де- Жизненный цикл обычно составляет не один десяток
фекты, возникающие в их элементах под воздействием лет, причем в отличие от традиционной продукции (тех-
факторов внешней и внутренней среды. Его роль в орга- нических средств, обработанных материалов, услуг, про-
низации управления объектами недвижимости обуслов- граммного обеспечения) довольно большую часть этого
лена возможностью сравнения их функционального со- времени занимает период эксплуатации. Особую актуаль-
стояния с принятыми стандартами и критериями [3]. ность имеет проблема поддержания объекта на постпро-
К современному зданию (сооружению) и его техниче- изводственной стадии – на стадии эксплуатации.
скому оснащению предъявляются высокие требования. Особенности эксплуатационных процессов стро-
На передний план выдвигаются: использование новых се- ительных объектов состоят в том, что воздействие на
тевых технологий, применение средств коммуникации и здания и сооружения происходит на наиболее длительном
интернет – информации, потребность в комфорте и обес- промежутке времени и оказывает решающее влияние на
печение безопасности. Однако, и вопросы экологической качественные характеристики, которые в значительной
безопасности, оптимизации использования ресурсов не степени определяются инженерно-техническими и кон-
остаются без внимания специалистов, также актуальной структивными решениями, принятыми на стадиях проек-
является проблема внедрения энергосберегающих техно- тирования и строительства.
логий, алгоритмов управления, которые в первую очередь Продолжительность эксплуатационного периода жи-
обеспечиваются системами автоматизации зданий. В на- лого здания зависит от множества факторов и условий, в
учно-исследовательских лабораториях и университетах числе которых можно отметить:
инновационные разработки ждут своего выхода на рынок 1) конструктивно-технические характеристики самого
с целью снижения эксплуатационных расходов и создания объекта;
66 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

2) обеспеченность материальными, трудовыми, фи- Обслуживание – работы, выполняемые для обеспе-


нансовыми ресурсами для поддержания объекта на этапе чения нормативного срока эксплуатации объектов недви-
эксплуатации; жимости; они не ведут к увеличению его стоимости, но
3) качество и своевременность проведения работ по предотвращают обветшание и выход из строя отдельных
техническому обслуживанию и текущему и ремонту объ- элементов.
екта; Ремонт – работы по устранению повреждений или из-
4) своевременность и качество проведения капи- ношенности объекта недвижимости с целью его восста-
тального ремонта объекта. новления до нормального эксплуатационного состояния.
Особенности эксплуатационных процессов стро- Для обеспечения бесперебойной эксплуатации ос-
ительных объектов состоят в том, что воздействие на новных фондов строительного комплекса необходимо их
здания и сооружения происходит на наиболее длительном непрерывное возобновление, то есть воспроизводство.
промежутке времени и оказывает решающее влияние на Воспроизводство является одной из важнейших задач жи-
качественные характеристики, которые в значительной лищной политики, имеющей долгосрочные социальные
степени определяются инженерно-техническими и кон- и экономические последствия. Оно входит составной ча-
структивными решениями, принятыми на стадиях проек- стью в общественное воспроизводство. Процесс воспро-
тирования и строительства. изводства может быть реализован посредством нового
Считается, что здание в стадии возникновения соот- строительства, проведения капитального ремонта, модер-
ветствует требованиям энергетической эффективности, низации и реконструкции существующих объектов.
предъявляемым к нему, а на стадии прекращения сущест- Использование различных форм воспроизводства, вза-
вования уже такие требования не предъявляются. Стадия имно дополняющих друг друга в едином воспроизводст-
функционирования, находясь между процессами стро- венном процессе, призвано не только обеспечить сохран-
ительства и утилизации, неразрывно связана с потерей ность объектов недвижимости, но и повысить их качество,
первоначальных эксплуатационных характеристик здания. а также расширить жилищный фонд современного города.
Сюда входят такие общие этапы как функционирование и Сегодня, в связи с кризисными явлениями в мире, все
развитие. большее внимание уделяется экономии энергии в зданиях
Первый этап – функционирование объекта недвижи- и сооружениях.
мости включает обслуживание и ремонт объектов. Фун- Энергосбережение в системе строительного ком-
кционирование объектов недвижимости представлено плекса не рассматривается в контексте обособленного
следующими направлениями: эксплуатация оборудования процесса, а имеет целью структурное преобразование си-
помещений; материальный учет; противопожарная ох- стемы технической эксплуатации. Система технической
рана и техника безопасности; управление коммуника- эксплуатации, таким образом, вбирает элемент «энергос-
циями, утилизацией и переработкой отходов, переме- бережение» как один из системообразующих факторов.
щениями и переездами, изменениями и перестройкой; Энергосбережение становится генеральным вектором
устранение аварийных ситуаций; обеспечение эксплуа- развития объектов недвижимости, смещая ориентиры в
тации и ремонта; установка мебели и охрана объекта. строительном комплексе от долговечности и надежности в
В процессе функционирования объекта недвижимости сторону экономии энергии и материальных ресурсов.
часто приходится выполнять работы по изменению всего Общая площадь эксплуатируемых зданий в России со-
объекта или его частей. Существует ряд правил, которые ставляет около 5 млрд. кв. м, в том числе более 2,8 млрд
позволяют осуществлять эффективное управление изме- кв. м это жилые дома, и на их отопление расходуется 400
нениями в пользу организации: пространство, материалы, млн. тонн условного топлива, или 25 % годовых энер-
принципы проектирования, планирование, инженерное горесурсов страны. Если общее потребление тепловой
обеспечение. энергии сократить только на одну треть от той разницы,
Аварийные ситуации могут возникнуть в любое время, которая существует между потреблением тепла в России
так как никто не застрахован от пожара, затопления, на- и странах Западной Европы, как, например, Дании, можно
воднения, землетрясения и так далее. Единой формы сэкономить 72 миллиарда кубометров природного газа в
плана мероприятий по ликвидации аварий не существует, год. Если учесть все это, то становится ясно, какое пер-
в каждом конкретном случае назначается ответственный востепенное значение для экономики страны имеет повы-
за тот или иной объект и разрабатывается инструкция, по шение эксплуатационных характеристик зданий и сокра-
которой он должен действовать. щение потребления энергии в домах.
Второй этап данной стадии жизненного цикла объ- Именно здесь заложены перспективы реального сни-
екта недвижимости – обслуживание и ремонт. Как пока- жения энергопотребления при обеспечении необходимого
зывает практика, подавляющее большинство собствен- уровня комфортности проживания [4].
ников объектов недвижимости не выделяют достаточных Анализ современного состояния концептуальных основ
средств на содержание и ремонт зданий и сооружений. Но эксплуатации объектов недвижимости, а также тенденций
затраты на ликвидацию последствий почти всегда превы- в строительном комплексе в целом, доказывает необхо-
шают стоимость работ по обслуживанию и ремонту. димость и неминуемость трансформации критериев и по-
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 67

казателей эффективности принимаемых решений. Оп- технологическое обеспечение реализации задач эффек-
тимизировать принимаемые решения по сохранности и тивной эксплуатации должно строиться на совершенство-
воспроизводству объектов недвижимости с учетом энер- вании методик планирования и производства ремонтных
госберегающих мероприятий возможно при постановке работ, что повысит энергетическую эффективность фун-
задач многофакторной зависимости. Организационно- кционирования объектов недвижимости.

Литература:

1. Основы организации и управления жилищно-коммунальным комплексом, под общей ред. П.Г. Грабового, изд.
«АСВ», 2004.
2. Сборщиков С.Б., Дмитриев А.Н., Монастырев П.В. Энергосбережение в реконструируемых зданиях. Научное
издание – М.: Издательство АСВ, 2008.
3. Чернышов Л.Н., Бородина Е.А. Методические основы организации эксплуатации объектов недвижимости на
основе мониторинга. // Недвижимость: экономика, управление. 2010, № 3–4.
4. Энергосбережение в жилищном фонде: проблемы, практика и перспективы. М.: dena, Фонд «Институт эконо-
мики города», 2004.

Диагностика и оценка состояния автомобильных дорог


Юшков Владимир Сергеевич, аспирант
ФГБОУ ВПО «Пермский национальный исследовательский политехнический университет»

А втомобильные дороги представляют собой комплекс


сооружений, предназначенных для круглосуточного
беспрепятственного пропуска транспортных средств с
и материальных ресурсов, направляемых на рекон-
струкцию, ремонт и содержание дорожной сети;
3) общая оценка качества и состояния автомобильных
расчетными скоростями и нагрузками в любой период дорог производится по показателям потребительских
года при любых погодно-климатических условиях [1]. свойств, обеспечиваемых фактическим уровнем эксплу-
Система диагностики является необходимым эле- атационного содержания, геометрическими параметрами,
ментом управления надежностью дорожной сети по сиг- техническими характеристиками, инженерным оборудо-
налам о состоянии ее элементов. Если система управления ванием и обустройством.
в ответ на сигнал об отказе по транспортно-эксплуатаци- По результатам диагностики и оценки состояния
онным параметрам исключает участок дороги из процесса дорог в процессе эксплуатации выявляют участки дорог,
функционирования, то происходит изменение внутренней не отвечающие нормативным требованиям к их тран-
структуры, реконфигурация режимов эксплуатации авто- спортно-эксплуатационному состоянию и, руководст-
мобильной дороги. Но для решения такой задачи необ- вуясь «Классификацией работ по ремонту и содержанию
ходимы управляющие сигналы, указывающие на отказы автомобильных дорог общего пользования», определяют
(физические эффекты, с определенной вероятностью сви- виды и состав основных работ и мероприятий по содер-
детельствующие о возможности отказа), что значительно жанию, ремонту и реконструкции с целью повышения их
сокращает время выработки сигнала, управляющего над- транспортно-эксплуатационного состояния до требуемого
ежностью, обеспечивая высокую степень безотказности и уровня.
отказоустойчивости [2]. Результаты диагностики и оценки дорог являются
Виды диагностики и оценки состояния дорог и состав предпроектными материалами и информационной базой
исходной информации [3]: для разработки в установленном порядке проектов рекон-
1) цель диагностики и оценки состояния автомо- струкции, капитального ремонта, ремонта и содержания
бильных дорог состоит в получении полной, объек- эксплуатируемых дорог. В отдельных случаях, предус-
тивной и достоверной информации о транспортно-эк- мотренных «Классификацией работ по ремонту и со-
сплуатационном состоянии дорог, условиях их работы держанию автомобильных дорог общего пользования»,
и степени соответствия фактических потребительских допускается взамен проекта разработка сметной докумен-
свойств, параметров и характеристик требованиям дви- тации на ремонт и содержание дорог на основании резуль-
жения; татов диагностики и оценки их состояния.
2) систематический мониторинг является основой Полученная на основе диагностики и оценки состояния
управления состоянием автомобильных дорог и ис- дорог информация служит для формирования и система-
ходной базой для эффективного использования средств тического обновления автоматизированного банка до-
68 Технические науки «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

рожных данных (АБДД) как на федеральном, так и на тер- участках дорог значительной протяженности, где при стро-
риториальном уровнях. ительстве, реконструкции или ремонте устроены краевые
Диагностика состояния автомобильных дорог вклю- укрепительные полосы, имеющие однотипное покрытие с
чает четыре основных этапа, которые выполняются, как проезжей частью, таким параметром служит ширина ос-
правило, последовательно: новной укрепленной поверхности, включающая в себя
1) подготовительные работы; ширину проезжей части и краевых укрепительных полос.
2) полевые обследования; К дорогам категории I-A относят дороги, имеющие не-
3) камеральная обработка полученной информации; сколько раздельных проезжих частей (каждая по две и
4) формирование (обновление) АБДД. более полосы движения), с разделительными полосами,
По объему выполнения работ диагностику и оценку со- в т.ч. разметкой или разделительными барьерами между
стояния дорог подразделяют: ними, и пересечения в разных уровнях с другими автомо-
а) первичную; бильными или железными дорогами.
б) повторную. К дорогам категории I-Б относят дороги, имеющие две
При первичной диагностике, как правило, измеряют и раздельные проезжие части (каждая по две и более полосы
оценивают весь комплекс установленных параметров и ха- движения), с разделительной полосой, в т.ч. разметкой
рактеристик состояния дороги, а также транспортного по- или разделительным барьером безопасности между ними.
тока, а при повторной диагностике – только переменные, Фактические категории других дорог по ширине про-
к которым относятся прочность дорожной одежды, про- езжей части или по ширине основной укрепленной повер-
дольная и поперечная ровность (глубина колеи), шеро- хности принимают в зависимости от их фактических раз-
ховатость и сцепные качества покрытия, характеристики меров (табл. 2).
транспортного потока и др. Кроме того, при повторной ди- В пересеченной местности фактическую категорию су-
агностике измеряют и оценивают те постоянные параметры ществующей дороги определяют по двум главным пара-
и характеристики, которые были изменены в процессе ре- метрам: ширине проезжей части и продольному уклону
монта или реконструкции. В необходимых случаях могут (табл. 3).
быть измерены и оценены отдельные группы или сочетания В горной местности фактическую категорию дороги
постоянных и переменных параметров и характеристик. определяют по соответствию нормативным требованиям
Конкретные виды и объемы работ по диагностике и ширины проезжей части, продольных уклонов и радиусов
оценке состояния дорог устанавливают, руководствуясь кривых в плане (табл. 4).
«Временными нормативами объемов работ и периодич- Визуальная оценка состояния дорожного покрытия по-
ности диагностики и обследования, автомобильных дорог зволяет получить данные о его состоянии, выявить места,
и мостов». подлежащие оценке прочности дорожной одежды, опреде-
При оценке состояния и назначении работ по ремонту лить объем повреждений, необходимый для планирования
или реконструкции эксплуатируемых дорог во многих слу- работ по ремонту и содержанию. Визуальную оценку реко-
чаях возникает необходимость установить фактическую мендуется проводить в весенний период после того, как до-
категорию дороги, требуемую категорию по интенсив- рога освободилась от снега. Для визуальной оценки фик-
ности движения на момент обследования и расчетную, на- сируются все дефекты поверхности проезжей части.
значаемую при проектировании реконструкции. До начала визуальной оценки необходимо подготовить
Фактическую категорию существующей дороги на мо- журнал с ведомостями дефектов, убедиться в исправности
мент обследования и оценки состояния определяют путем автомобиля и оборудования, установить на автомобиле
сопоставления основных геометрических параметров с дорожные знаки «Дорожные работы» и «Объезд препят-
нормативными. К указанным параметрам относят ширину ствия слева», провести инструктаж всех членов группы,
проезжей части (ширину основной укрепленной повер- обратив особое внимание на важность соблюдения всех
хности), продольные уклоны и радиусы кривых в плане. требований безопасности работ. До проведения обследо-
В зависимости от рельефа местности эти параметры вания осуществляют обучение пользованием данной ме-
рассматривают как главные или дополнительные критерии тодикой с целью приобретения необходимых навыков.
при определении категории дороги (табл.1). Рельеф мест- В случаях, если дефекты на покрытии отсутствуют,
ности устанавливают по проектной документации на дорогу. встречаются редко (через 100 м и более), либо на большом
На одной дороге могут быть выделены участки раз- протяжении дороги (более 100 м) встречаются одина-
личных категорий, отличающиеся по основным параме- ковые дефекты, глазомерную оценку допускается произ-
трам, протяженностью не менее 3 км на перегонах и 1 водить в процессе проезда автомобиля со скоростью не
км на подходах к городам. При меньшей протяженности более 30 км/ч. В остальных случаях глазомерную оценку
таких участков их категорию принимают такой же, как на осуществляют в процессе прохождения вдоль дороги с со-
основном протяжении дороги. блюдением правил техники безопасности. При наличии
Главным геометрическим параметром для установ- оборудования для видеосъемки ее производят в процессе
ления фактической категории дороги во всех случаях явля- движения автомобиля со скоростью, которая обеспечи-
ется фактическая ширина проезжей части. На дорогах или вает последующую обработку результатов.
“Young Scientist” . #12 (35) . Vol. I . December 2011 Technical Sciences 69

Таблица 1

Рельеф местности Критерии определения фактической категории дороги


Ширина проезжей части Продольный уклон Радиус кривых в плане
или ширина основной
укрепленной поверхности
Равнинный главный дополнительный дополнительный
Пересеченный главный главный дополнительный
Горный главный главный главный

Таблица 2

Фактическая ширина проезжей части, м до 4,8 5,8–6,8 6,9–7,4 более 7,4


Фактическая ширина основной укрепленной до 5,6 7,0–8,0 8,1–9,0 более 9,0
поверхности, м
Фактическая категория дороги V IV III II

Таблица 3

Максимальный продольный уклон, ‰ 40 50 60 70 90


Фактическая категория дороги I–А I – Б, II III IV V

Таблица 4

Максимальный продольный уклон, ‰ 40 50 60 70 90


Минимальный радиус кривых в плане, м 250 125 100 60 30
Фактическая категория дороги I–А I – Б, II III IV V

Для проведения измерений (глубины колеи, раскрытия Работы по диагностике и оценке состояния дорог
трещин, расстояний между трещинами, длины сторон должны выполнять специализированные организации,
ячеек сетки трещин) автомобиль проезжает вперед от оснащенные соответствующими передвижными лабора-
места дефекта на 5–10 м, инженер и техник выходят ториями, приборами и оборудованием [4]. Применение
из автомобиля и двигаются по обочине в направлении, новой технологии и реализация прикладных задач форми-
обратном движению. В случае выхода на проезжую часть рования банка данных о вибрационных полях дорожных
работу следует производить под защитой автомобиля, конструкций на всех этапах жизненного цикла сущест-
располагающегося так, чтобы знаки «Дорожные работы» венно модернизирует регламенты системы диагностики,
и «Объезд препятствия слева» были обращены навстречу как по производительности, так и по качеству оценки со-
движения. стояния автомобильных дорог.

Литература:

1. Диагностика автомобильных дорог и назначение ремонтных мероприятий: Учеб.пособие /А. Н. Канищев, О.В.
Рябова, А.А. Быкова; Воронеж, гос. арх. – строит, ун-т. – Воронеж, 2004.
2. Юшков В.С., Кычкин В.И. Алгоритм ранней диагностики дорожной конструкции нежесткого типа и модель его
реализации // Журнал «В мире научных открытий» № 5 часть 1. г. Красноярск 2010 г.С. 104–109.
3. Кычкин В.И., Юшков В.С. Вибродиагностика дорожных конструкций с применением статистических методов
оценки качества // международная научно-практическая конференция. «Современные проблемы безопасности
жизнедеятельности: опыт, проблемы, поиски решения», г. Казань, 25–26 февраля 2010 г., С. 360–364.
4. Кычкин В.И., Юшков В.С. Технология вибродиагностики дорожных конструкций нежесткого типа // сборник
научных трудов по итогам 11-ой международной научно-технической Интернет-конференции «Новые мате-
риалы и технологии в машиностроении». Брянск 2010 г. выпуск 11. С. 150–153.
70 Информатика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

И н фо р м а ти к а

Подход к оцениванию сложности проведения сертификационных испытаний


программного обеспечения
Беляков Игорь Александрович, ассистент
Петербургский государственный университет путей сообщения

К лючевым вопросом при планировании сроков вы-


пуска программного обеспечения на рынок явля-
ется точная оценка временных затрат. При этом одним из
ванных систем, оно решает сложнейшие задачи управ-
ления и проектирования, обработки информации и другие
не менее важные задачи. Разработкой ПО занимается
самых сложно прогнозируемых этапов является этап под- множество организаций, большинство из которых не уде-
тверждения безопасности программы – сертификация. ляет должного внимания контролю безопасности создава-
Именно большими и сложно прогнозируемыми времен- емых программных продуктов. Следствием является су-
ными затратами, а также дороговизной сертификата об- щественный рост количества уязвимостей, выявляемых в
условлено нежелание большинства разработчиков серти- программном обеспечении.
фицировать свою продукцию на соответствие стандартам Сертификация программного обеспечения является,
безопасности. В настоящее время большинство програм- пожалуй, основным средством, позволяющим убедится
много обеспечения сертифицируется только в условиях, в безопасности ПО. Проведение анализа исходных тек-
когда заказчик требует наличия сертификата. стов ПО является базовым (вне зависимости от уровня
Создание общего подхода к оцениванию затрат на сер- контроля) требованием при проведении сертификаци-
тификацию сделает ее более доступной для широкого круга онных испытаний ПО на соответствие требованиям без-
разработчиков и окажет положительное влияние на про- опасности. В целях обеспечения информационной без-
блему безопасности программного обеспечения в целом. опасности ПО существует множество методик, основной
Наименее прогнозируемым этапом при сертификации задачей которых является выявление уязвимостей в ПО.
ПО является этап проведения сертификационных испы- Для оценки качества работы этих методик можно исполь-
таний. Зная требования к предоставляемой информации и зовать множество характеристик, но необходимо отме-
общепринятые методики проведения сертификационных тить, что все они характеризуют качество работы. В на-
испытаний можно достаточно точно спрогнозировать при- стоящее время нет методики, позволяющей оценить
мерные временные и финансовые затраты. В настоящее временные затраты на проведение сертификационных ис-
время испытательные лаборатории при оценке затрат на пытаний.
проведение сертификационных испытаний в первую оче-
редь руководствуются объемом анализируемых данных Система сертификационных испытаний
(количество строк ИТ и их объем в Мб), а так же состоя-
нием производства и документации. Однако следует заме- Организационную структуру системы сертификации
тить, что данные характеристики не описывают, в полной программного обеспечения образуют: ФСТЭК России,
мере, весь объем работ, который необходимо будет про- Орган по сертификации, испытательная лаборатория и
вести, при проведении сертификационных испытаний ПО. заявитель (Рисунок 1).
Это может привести к несоответствию объема работ по В компетенции ФСТЭК России создана Система сер-
проведению сертификационных испытаний затраченным тификации средств защиты информации по требованиям
средствам (затраченные заказчиком средства либо не по- безопасности информации и установлены правила прове-
кроют стоимость работ по сертификации либо сущест- дения сертификации средств защиты информации. Также
венно их превысят). Следовательно, для более точной ФСТЭК имеет возможность утверждать нормативные до-
оценки затрат по сертификации ПО, необходимо оцени- кументы, на соответствие требованиям которых прово-
вать не только объем исходных текстов, но и их сложность. дится сертификация средств защиты информации и про-
граммного обеспечения, и методические документы по
Введение проведению сертификационных испытаний. Все вы-
данные сертификаты учтены в государственном реестре.
Программное обеспечение стало неотъемлемой ча- Органы по сертификации средств защиты информации и
стью современной жизни. Входя в состав автоматизиро- испытательные лаборатории проходят аккредитацию на
“Young Scientist” . #12 (35) . Vol. I . December 2011 Computer Science 71

Рис. 1. Система сертификации программного обеспечения

право проведения работ по сертификации, в ходе которой по сертификации осуществляется при проведении испы-
ФСТЭК России определяет возможности выполнения таний программного обеспечения в Испытательной лабо-
этими органами и лабораториями работ по сертификации ратории.
средств защиты информации. Органам по сертификации Исследования, проведенные на базе Испытательной
средств защиты информации ФСТЭК делегирует часть лаборатории Средств защиты информации ПГУПС, по-
своих полномочий. Они сертифицируют средства защиты казывают, что наиболее трудоемкими этапами процесса
информации, выдают сертификаты и лицензии на при- испытаний ПО является обработка результатов анализа,
менение знака соответствия с представлением копий в а также принятие решения о соответствии программного
ФСТЭК России и осуществляют инспекционный контроль обеспечения требованиям безопасности. Практика про-
за сертифицированными средствами защиты информации ведения сертификационных испытаний показывает, что
и учет. Испытательные лаборатории проводят сертифи- до 50% времени, необходимого на всю процедуру серти-
кационные испытания средств защиты информации и по фикации, затрачивается на сертификационные испытания
их результатам оформляют заключения и протоколы, ко- (рисунок 2).
торые направляют в соответствующий орган по сертифи- Сертификация программного обеспечения по требова-
кации средств защиты информации и изготовителям. ниям безопасности предполагает проведение определен-
В настоящее время существует ряд метрик для опре- ного множества испытаний и тестов, набор которых за-
деления объема и относительной сложности программ. висит от уровня контроля. Основными инструментами,
Прежде всего следует отметить размерно-ориентиро- при проведении испытаний являются статический анализ
ванную метрику LOC (Lines Of Code), которая, для оп- исходных текстов и динамический анализ исполняемых
ределения сложности ПО использует количество строк файлов ПО. Вне зависимости от используемого подхода,
кода. Также следует отметить метрику Холстеда, опреде- все методы анализа имеют примерно одинаковый алго-
ляющую объем (1) и сложность (2) программы в зависи- ритм выполнения (рисунок 3).
мости от количества функциональных и информационных Исходя из методики проведения испытаний можно вы-
объектов. делить следующие характеристики исходных данных, ока-
зывающие влияние на время проведения испытаний (Та-

HVol = ( Nfo + Nio) ⋅ Log 2 (Uio + Ufo) (1) блица 1).


Зная характеристики, влияющие на время проведения
Ufo ⋅ Nio испытаний, определим их влияние в зависимости от суще-
HDiff = (2) ствующих классов требований к безопасности ПО (Та-
2 ⋅ Uio блица 2).
где Nfo и Nio – количество функциональных и инфор- Теперь, зная требования к классу безопасности
мационных объектов, а Ufo и Uio – количество вызовов (уровню контроля отсутствия недекларированных воз-
функциональных объектов (ФО) и использования инфор- можностей) можем определить временные затраты на
мационных объектов (ИО). Однако существующие ме- выполнение сертификационных испытаний для каждого
трики не учитывают специфики проведения сертифика- класса.
ционных испытаний. Например, не учитываются различия Самые мягкие требования предъявляются к програм-
в требованиях для разных классов безопасности, а также мному обеспечению в рамках четвертого класса безопа-
специфические особенности существующих алгоритмов сности. Основным инструментом является статический
анализа программного обеспечения. При оценке слож- анализ, который включает контроль полноты и отсутствия
ности необходимо учитывать, что основной объем работ избыточности исходных текстов ПО на уровне файлов и
72 Информатика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Рис. 2. Система проведения сертификационных испытаний ПО

Рис. 3. Принципиальная модель анализа ПО

контроль соответствия исходных текстов ПО его объ- – контроль выполнения ФО;


ектному коду. Для оценки временных затрат вполне по- – сопоставление фактических маршрутов выполнения
дойдет оценка, основанная на количестве строк кода. ФО и маршрутов, построенных в процессе проведения
Третий класс безопасности расширяет требования чет- статического анализа.
вертого класса в области статического анализа исходных Следовательно, необходимо добавить зависимость от
текстов программ. В частности, необходимо выполнить количества и частоты использования ФО и ИО. Для этого
контроль полноты и отсутствия избыточности исходных добавим зависимость от сложности программы, предло-
текстов на уровне ФО, контроль связей ФО по управ- женную Холстедом, в расчет, основанный на подсчете ко-
лению и информации, контроль ИО, а также сформиро- личества строк кода (3).
вать перечень маршрутов выполнения ФО. Предъявля-
Loc ⋅ Ufo ⋅ Nio
ются новые требования по проведению динамического O3 = (3)
анализа исходных текстов программ: 2 ⋅ Uio
“Young Scientist” . #12 (35) . Vol. I . December 2011 Computer Science 73

Таблица 1. Характеристики, влияющие на временные затраты

Исходные данные, к которым относится


№ Характеристика Обозначение характеристика
ИТ ИФ ФП
1 Количество файлов Nfl + + –
2 Количество строк Loc + + +
3 Объем Size + + +
4 Количество логических операций Nlog + – +
5 Количество ФО Nfo + + –
6 Количество ИО Nio + – –
7 Количество вызовов ФО Ufo + + –
8 Количество обращений к ИО Uio + – –

Таблица 2. Зависимость временных затрат на класс безопасности от характеристик

Классы безопасности ПО (уровень контроля)


Характеристика
4 3 2 1
Fcnt + + + +
Loc – + + +
Size + + + +
Flog – – + +
Focnt – + + +
Iocnt – – + +
Foex – + + +
Ioex – – + +

Для второго класса, помимо аналогичных требований, Наиболее полный набор требований безопасности
предъявляемых к третьему классу, необходимо выполнить предъявляется к первому классу, в котором добавля-
следующие проверки: ются такие требования как контроль соответствия ис-
– контроль полноты и отсутствия избыточности ис- ходных текстов ПО его объектному (загрузочному) коду
ходных текстов контролируемого программного обеспе- с использованием сертифицированных компиляторов, а
чения на уровне ФО; также семантический контроль наличия заданных кон-
– синтаксический контроль наличия заданных кон- струкций в исходных текстах ПО из списка (базы) потен-
струкций в исходных текстах ПО из списка (базы) потен- циально опасных конструкций. Основное отличие данных
циально опасных программных конструкций; требований заключается в том, что существенно больше
– формирование перечня маршрутов выполнения ФО; времени тратится на семантический анализ исходных тек-
– анализ критических маршрутов выполнения ФО для стов (5).
заданных экспертом списков ИО; Loc ⋅ ( Ufo ⋅ Nfo) + (Uio ⋅ Nio)
– сравнительный анализ алгоритма работы функцио- O1 = (5)
нальных объектов (процедур, функций) и алгоритма ра-
Uio ⋅ Ufo
боты, приведенного в «Пояснительной записке». Так же необходимо учесть, что большой объем работ
Для динамического анализа предъявляются следу- по анализу программного обеспечения выполняет эк-
ющие требования: сперт. Значит необходимо добавить в расчеты корректи-
– контроль выполнения ФО; рующий коэффициент, который отражает объем времени
– сопоставление фактических маршрутов выполнения требуемый эксперту на выполнение одной технологиче-
ФО и маршрутов, построенных в процессе проведения ской операции. Экспериментально установлено, что это
статического анализа. время в среднем равняется 25 с. В ходе выполнения ре-
Исходя из требований третьего класса, можно рассчи- альных сертификационных испытаний были рассчитаны
тать временные затраты (4). временные затраты для двух программ (Таблица 3).
При этом временные затраты в полной мере отра-
Loc ⋅ ( Ufo ⋅ Nfo) + (Uio ⋅ Nio)
O2 = (4) жают реальные затраты в условиях когда сертифика-

2 ⋅ Uio ⋅ Ufo ционные испытания прошли в установленном режиме и
74 Информатика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Таблица 3. Характеристики сертифицируемого ПО

Характеристики
Loc Nfo Nio Ufo Uio
Приложение 1 600 3 9 7 15
Приложение 2 900 5 13 9 24

Таблица 4. Распределение временных затрат в зависимости от класса безопасности

Временные затраты
O4 O3 O2 O1
Приложение 1 0:27:38 0:41:02 2:28:46 4:57:32
Приложение 2 0:39:32 1:08:08 5:39:28 11:18:57

не потребовалась корректировка исходных данных (Та- Заключение


блица 4).
Расхождение реальных затрат с рассчитанными соста- Внедрение единой методики оценивания сложности
вило не более 14%. Следует отметить, что предложенный проведения сертификационных испытаний даст инстру-
подход находится в сильной зависимости от индивиду- мент, позволяющий более точно оценить временные за-
альных свойств эксперта, но аналогичная зависимость су- траты. Это сделает получение сертификата безопасности
ществует и в реальных условия проведения сертификаци- более доступным для широкого круга разработчиков, а
онных испытаний. стоимость более обоснованной, что в свою очередь окажет
Еще одним преимуществом предложенного подхода положительное влияние как на качество конечного про-
является что, что он позволяется оценить и проконтроли- дукта, так и на его безопасность.
ровать эффективность работы эксперта.

Литература:

1. Безопасность программного обеспечения компьютерных систем / Казарин О.В. – Москва, МГУЛ, 2003. –
213 с. – ISBN 5–283–01667
2. Выявление уязвимостей программного обеспечения в процессе сертификации / Марков А.С., Миронов С.В,
Цирлов В.Л. и др., Научно-практический журнал «Информационное противодействие угрозам терроризма»
№7 – М.: ФГУП НТЦ, 2006. – с. 177–186
3. Codermetrics: Analytics for Improving Software Teams / Jonathan Alexander – O’Reilly Media, 2011–262 с. –
ISBN: 978–1-449–30515–4
4. ГОСТ Р ИСО/МЭК ТО 16326–2002. Программная инженерия. Руководство по применению ГОСТ Р ИСО/
МЭК 12207 при управлении проектом.
5. Метрическая оценка качества программ / Изосимов А.В., Рыжко А.Л. – М.: МАИ, 1989.
6. Начала науки о программах / Холстед М. – М.: Финансы и статистика, 1981.
7. Анализ методов проверки корректности программ / Еремеев М.А., Глухарев М.Л., Корниенко А.А., Сборник
докладов 10 международной научно-практической конференции «Информационные технологии на железнодо-
рожном транспорте «Инфотранс – 2005» – С-Пб.: ПГУПС, 2005. – с. 276–280
“Young Scientist” . #12 (35) . Vol. I . December 2011 Computer Science 75

Обзор методов интеграции информационных ресурсов высших учебных заведений


Ершеева Рита Мухатовна, магистрант
Западно-Казахстанский аграрно-технический университет им.Жангир хана (г. Уральск, Казахстан)

В настоящее время в Западно-Казахстанском аграрно-техническом университете разрабатывается


единая автоматизированная информационная система управления образовательным процессом, и стоят ос-
новные задачи интеграции данных и интеграции приложений. В статье рассмотрены основные методы ин-
теграции данных и приложений.
Ключевые слова: высшее учебное заведение, информационные системы (ИС), интеграция приложений, ин-
теграция данных.

Integration methods review for information resources


of the higher educational institutions
Currently in the West Kazakhstan Agrarian Technical University has been developing a unified automated informa-
tion system of the educational process’ management, and the main objectives are data integration and application in-
tegration. The paper considers the main methods of data and application integration.
Keywords: higher educational institution, information systems (IS), application integration, data integration.

П ри информатизации управления образованием в вузе


могут быть использованы информационные системы
четырех уровней:
ленческих решений на всех уровнях, не позволяет
осуществлять мониторинг деятельности вузов и системы
высшего образования в целом.
1. информационные системы по отдельным аспектам Информационные системы поддержки принятия ре-
применения; шений для управленческих структур вузов и органов
2. корпоративные информационные системы на основе управления системой высшего профессионального обра-
единой информационной среды вуза (нескольких вузов), зования используются крайне редко ввиду их отсутствия
Департамента высшего профессионального образования и/или неподготовленности управленческого состава всех
или Министерства образования; уровней органов управления образованием.
3. автоматизация управления на основе информаци- Информационные системы управления на основе ма-
онных систем поддержки принятия решения (СППР); тематических моделей оптимизации фактически не ис-
4. совершенствование управления на основе матема- пользуются. [6]
тических моделей оптимизации. Одна из главных тенденций применения информаци-
Информационные системы первого и второго уровней онных технологий в учреждениях высшего образования
на практике решают задачи: сбора необходимой «управ- последних лет связана с формированием в вузе единой
ленческой» информации (например, об учебном процессе, корпоративной информационной среды. [7]
качестве обучения, участниках процесса обучения – пре- Требования, предъявляемые к ИС, формируются на
подавателях, кафедрах, студентах, студенческих группах основании целей и задач, стоящих перед ИС. [4]
и др.); отслеживания функционирования различных си- 1. Для того чтобы быть необходимым инструментом де-
стем – образовательных, воспитательных, управлен- ятельности сотрудников вуза, приложения ИС должны
ческих и др.; частичного или полного их мониторинга. поддерживать основные направления деятельности вуза
Информационные системы третьего уровня способны су- и комплексно реализовывать необходимые функции от
щественно облегчить принятие управленческих решений, сбора и хранения до анализа, планирования и поддержки
а информационные системы четвертого уровня создают принятия решений.
основу для оптимизации структуры и функционирования 2. Пользователями ИС должны быть все сотрудники,
административных подразделений вуза. преподаватели, студенты вуза, независимо от их местона-
В казахстанских вузах имеется опыт использования хождения, при этом доступ к информационным сервисам
информационных систем по отдельным аспектам приме- ИС должен предоставляться авторизованным пользова-
нения. Вместе с тем используемые системы функциони- телям в соответствии с их ролью в вузе, выполняемыми
руют автономно и не замкнуты в единую информационную должностными обязанностями.
сеть вузов, что осложняет возможности их оперативного 3. Требование, предъявляемое к информации в части
применения во внутривузовском управлении. актуальности, валидности и непротиворечивости, приводит
Еще не создана корпоративная информационная си- к необходимости поддержания высокого уровня интеграции
стема казахстанских вузов, что снижает возможности по- данных, формализованного через ведение обобщенного ре-
лучения оперативной информации для принятия управ- позитория данных, и развитой системы актуализации.
76 Информатика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

4. Для того чтобы ИС обеспечивала не только учетные основные задачи интеграции данных и интеграции прило-
функции, но поддерживала обработку, анализ, модели- жений.
рование, принятие решений, необходимо использование Наиболее удачным решением для задачи интеграции
надежных и масштабируемых аппаратно-программных информационных ресурсов различных информационных
платформ и технологий различного назначения – систем систем считается построение централизованной системы
управления базами данных (СУБД), систем управления интеграции данных, которая возьмет на себя функции
электронным документооборотом (СУЭД), геоинформаци- связи данных из нескольких ИС. Интегрирующая инфор-
онных систем (ГИС), технологий Интернет, виртуальных мационная система (ИИС) должна поддерживать следу-
сетей, распределенных вычислений, OLAP-технологии. ющие функции:
5. Использование множества технологий в одной ИС – консолидация данных различных информационных
формирует требования к архитектуре, которая должна систем с описанием структуры данных в центральном узле;
основываться на компонентной модели и позволять ре- – функция импорта/экспорта данных;
шать задачи интеграции приложений, разработанных на – работа в автономном и оперативном режимах: данные
базе различных технологий. могут быть добавлены в ИИС и считаны из ИИС как в ре-
6. ИС должна предоставлять доступ к необходимой в альном времени, так и обработкой отложенных запросов;
данный момент пользователям информации и быть про- – возможность подключения новых ИС к ИИС с по-
екций деятельности вуза на область информационных тех- мощью настраиваемых расширений;
нологий, а в силу инновационного характера деятельности – функция системного историзма для предотвращения
вуза это требует поддержки информационной средой ин- изменения данных без возможности восстановления;
теграции бизнес-процессов. – функция автоматического контроля качества данных,
7. Для управления информационной средой необ- добавляемых в ИИС;
ходимо использовать различные индикаторы (характе- – функция выверки дубликатов записей и объектов;
ристики, параметры, процедуры и т.п.), позволяющие – расширенная система прав, ограничивающих работу
оценивать востребованность приложений, степень их с данными на самом низком уровне к хранилищу данных;
использования, быстродействие среды в целом и ее от- – универсальный инструмент визуального представ-
дельных частей, использовать механизмы распределения ления данных для просмотра информации, хранимой в
нагрузки для достижения высокой производительности. ИИС (интерфейс пользователя);
8. Для поддержания надежного функционирования – функция сложного поиска по данным в ИИС (язык
среды необходимо использовать документированные про- запросов данных). [9]
цедуры резервного копирования, архивирования и вос- К числу основных средств, используемых для обеспе-
становления данных, защиты резервных копий от несан- чения интеграции информационных ресурсов, относятся
кционированного доступа. конверторы данных, интегрирующие модели данных, ме-
С точки зрения разработчика информационная среда ханизмы отображения моделей данных, объектные адап-
вуза представляет собой объединение сетевой инфра- теры (Wrappers), посредники (Mediators), онтологические
структуры, корпоративных данных, программ и пользова- спецификации, средства интеграции схем и интеграции
телей среды. онтологических спецификаций, а также архитектура,
Большинство задач, стоящих перед разработчиками обеспечивающая взаимодействие средств, используемых
информационной среды, связаны со словом интеграция: в конкретной системе интеграции ресурсов. [3]
интеграция информационно-технических подразделений, Не существует стандартного уровня интеграции или
интеграция сетевой инфраструктуры вуза, интеграция централизации – каждый руководитель должен самосто-
данных, интеграция приложений, интеграция бизнес-про- ятельно (или с помощью консалтинговой фирмы) решать
цессов, пространственная интеграция (интеграция фили- эту непростую проблему. Все зависит от организационно-
алов). [10] функциональной структуры конкретного предприятия,
Проблема интеграции информационных систем изуча- структуры его бизнеса, реальных инвестиционных воз-
ется с момента, когда получили распространение первые можностей и политики развития. [1]
базы данных – с 70-х гг. XX века. До настоящего времени Для создания информационной среды могут использо-
задача интеграции остается недостаточно проработанной, ваться несколько организационно-технологических под-
поскольку наряду с комплексностью и высокой сложно- ходов. Среди них можно выделить три основных подхода к
стью данной задачи, в связи со стремительным развитием созданию интеграционной основы корпоративной инфор-
информационных технологий меняются и требования к мационной среды вуза:
самим информационным системам, а как следствие – и к 1.  использование монолитной системы класса ERP;
их интеграции. [9] 2. использование корпоративных веб-служб, в том
В настоящее время в Западно-Казахстанском аг- числе порталов;
рарно-техническом университете (ЗКАТУ) разрабаты- 3.  принципы и технология открытых систем.
вается единая автоматизированная информационная си- ERP-система обеспечивает поддержку управления
стема управления образовательным процессом, и стоят финансовыми, материальными, кадровыми ресурсами на
“Young Scientist” . #12 (35) . Vol. I . December 2011 Computer Science 77

всех уровнях управления, актуальной информацией, не- Основной принцип технологии открытых систем со-
обходимой для принятия оперативных и стратегических стоит в создании среды, включающей программные и ап-
решений. Ключевой особенностью современных ERP-си- паратные средства, службы связи, интерфейсы, форматы
стем является использование методик и интегрированных данных и протоколы. Эта среда в основе имеет развиваю-
аналитических средств стратегического управления, щиеся, доступные и общепризнанные стандарты и обес-
обеспечивающих управление результативностью как вуза печивает значительную степень переносимости, взаимо-
в целом, так и на уровне его структурных подразделений, действия и масштабирования приложений и данных.
а также распространение процессов управления за рамки Важнейшим понятием в технологии открытых систем
вуза – интеграция с министерством, партнерами, по- служит понятие профиля как согласованного набора ба-
ставщиками, местными и федеральными органами власти зовых стандартов, необходимых для решения конкретной
и т.д. [7] задачи или класса задач. [5]
При этом необходимо учесть затраты на покупку, вне- Важнейшей задачей при развитии информационной
дрение, поддержку ERP-системы, а также существующие среды является задача интеграции данных. Она возникает
информационные системы в вузе. в связи с тем, что, во-первых, объем данных быстро уве-
Второй подход состоит в консолидации уже сущест- личивается, особенно за счет развития новых информа-
вующих информационных сервисов с использованием ционных систем, во-вторых, информационные системы в
единой концепции сетевого взаимодействия и управ- вузе создаются различными группами разработчиков, ко-
ления доступом к ресурсам, что обеспечивает интег- торые часто используют разные СУБД. Использование
рацию данных и унификацию доступа к сервисам и при- единственной базы данных в развитой информационной
ложениям. По мнению сторонников данного подхода, его среде невозможно. Наличие несколько баз данных, воз-
применение обеспечит перенос в более современную ин- можно различной архитектуры, ставят вопрос о первич-
формационную среду функций унаследованных прило- ности информации, которая обеспечивает непротиворе-
жений и дальнейшее использование имеющихся данных, чивость данных. [10]
а с другой стороны позволит в дальнейшем внедрять Интеграция данных в информационных системах по-
новые информационные сервисы на базе единой техно- нимается как обеспечение единого унифицированного ин-
логической политики (технологий web-служб), что упро- терфейса для доступа к некоторой совокупности, неодно-
стит сопровождение и развитие корпоративной информа- родных независимых источников данных. Таким образом,
ционной среды. [7] для пользователя информационные ресурсы всей сово-
При данном подходе необходимо решить: какое ин- купности интегрируемых источников представляются как
струментальное программное средство лучше выбрать, новый единый источник. Система, обеспечивающая поль-
как в дальнейшем будут разрабатываться новые модули зователю такие возможности, называется системой ин-
системы, какого стандарта придерживаться в проектиро- теграции данных.
вании и разработке и, как долго будет строиться интегри- Интегрируемыми источниками данных могут быть тра-
рованная система. диционные системы баз данных, поддерживающие раз-
Основным перспективным направлением создания личные модели данных (реляционные, объектные, объ-
информационных технологий, определяющим эффек- ектно-реляционные, графовые и т.п.), разнообразные
тивность информационно-вычислительных систем всех унаследованные системы, репозитории, веб-сайты,
уровней и назначений, признан третий подход – техно- файлы структурированных данных. Обеспечение доступа
логия открытых систем, сущность которой состоит в обес- к данным многих источников через единый интерфейс оз-
печении: начает фактически, что речь идет о поддержке представ-
– унифицированного обмена данными между различ- ления совокупности данных из множества независимых
ными компьютерами; источников в терминах единой модели данных.
– переносимость прикладных программ между различ- Сложность и характер интеграции данных зависят
ными платформами; от уровня интеграции, который необходимо обеспечить,
– мобильности пользователей, т.е. возможности поль- свойств отдельных источников данных и всего множества
зователей переходить с одного компьютера на другой, источников в целом, требуемых способов интеграции.
независимо от его архитектуры и объема памяти, ис- Системы интеграции данных могут обеспечивать ин-
пользуемых программ без необходимости переобучения теграцию данных на физическом, логическом и семанти-
специалистов. ческом уровне. Интеграция данных на физическом уровне
Основой, обеспечивающей реализацию открытых си- с теоретической точки зрения является наиболее про-
стем, служит совокупность стандартов, с помощью ко- стой задачей и сводится к конверсии данных из различных
торых унифицируется взаимодействие аппаратуры и всех источников в требуемый единый формат их физического
компонентов программной среды: языков программиро- представления. Интеграция данных на логическом уровне
вания, средств ввода-вывода, графических интерфейсов, предусматривает возможность доступа к данным, содер-
систем управления базами данных, протоколов передачи жащимся в различных источниках, в терминах единой
данных в сетях и т.п. глобальной схемы, которая описывает их совместное
78 Информатика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

представление с учетом структурных и, возможно, по- странство, данные в котором могут храниться в различных
веденческих (при использовании объектных моделей) источниках, однако информация о расположении данных
свойств данных. Семантические свойства данных при недоступна запрашивающей стороне.
этом не учитываются. Поддержку единого представления Метод распространения данных осуществляет перенос
данных с учетом их семантических свойств в контексте данных из одной системы в другую.
единой онтологии предметной области обеспечивает ин- В ЗКАТУ имеются следующие приложения, использу-
теграция данных на семантическом уровне. емые в учебном процессе, которые являются в основном
Источники данных могут обладать различными свой- собственной разработкой и нуждаются в интеграции: учет
ствами, существенными для выбора методов интеграции кадров, планирование академических занятий, учет сту-
данных – они могут поддерживать представление данных денческого контингента, составление графика занятий,
в терминах той или иной модели данных, могут быть ста- оценивание знаний обучающихся (на стадии разработки)
тическими или динамическими и т.п. Множество источ- [2], составление графика экзаменов, составление и про-
ников интегрируемых данных может быть однородным верка тестовых заданий, программа итогового контроля,
или неоднородным относительно характеристик, соответ- анкетирование обучающихся и персонала, программа ди-
ствующих используемому уровню интеграции. [3] станционного образования. Для создания интеграционной
Существуют три основных метода интеграции данных: информационной среды вуза был выбран третий метод –
консолидация, федерализация и распространение. [8] технология открытых систем, и основан на объектно-ори-
При использовании метода консолидации данные со- ентированном подходе. Среди имеющихся приложений
бираются из нескольких первичных систем и интегриру- существуют разработанные ранее и имеют различные
ются в одно постоянное хранилище. СУБД. Для интеграции данных используются методы кон-
При использовании метода федерализации данных солидации и распространения данных в зависимости от
образуется единое виртуальное информационное про- приложений.

Литература:

1. Граничин О.Н., Кияев В.И. Информационные технологии в управлении БИНОМ. Лаборатория знаний, Ин-
тернет-университет информационных технологий – ИНТУИТ.ру, 2008
2. Ершеева Р.М. Анализ требований к Автоматизированной Информационной Системе оценивания знаний обуча-
ющихся [Текст] / Р.М. Ершеева // Молодой ученый. – 2011. – №11. Т.1. – С. 70–74.
3. Когаловский М.Р. Интеграция данных в информационных системах. Сб. трудов Третьей Всероссийской конфе-
ренции «Стандарты в проектах современных информационных систем», Москва, 23–24 апреля 2003 г.
4. Крюков В.В., Шахгельдян К.И. Проблемы создания интегрированной информационной среды вуза //Телеком-
муникации и образование. 2005. – №6.
5. Мкртчан Ф.А., Ничипор А.Е. Технология открытых систем интеграционная основа создания баз данных для ге-
оинформационного мониторинга. Проблемы окружающей среды и природных ресурсов. Обзорная информация.
2003. – № 2. С. 52–61 с.
6. Нефедова Л.В. Информационные технологии управления в казахстанских вузах // Материалы международной
научно-практической конференции «Информационные технологии в гуманитарном образовании». Россия, Пя-
тигорск, ПГЛУ, 24–25 апреля 2008 г.
7. Олейников А.Я, Меркулова A.B. К вопросу о построении интегрированной корпоративной информационной
среды вуза. //Журнал радиоэлектроники электронный ресурс. 2005, – № 12. Москва: РАН, 2005
8. Торшин, Д.В. Конвертация и перенос данных в задачах интеграции информационных ресурсов / Д.В. Торшин,
Н.И. Юсупова // Актуальные проблемы в науке и технике : сб. ст. 2-ой регион. зимн. шк.-сем. аспирантов и мо-
лодых ученых. Т. 2. Уфа : Технология, 2007. С. 50–55
9. Торшин Д.В., Юсупова Н.И. Программное обеспечение для задачи интеграции разрозненных компьютерных
систем // «Вестник УГАТУ», Серия «Управление, вычислительная техника и информатика», 2009 № 1 (30).
10. Шахгельдян К.И. Опыт интеграции при разработке информационной среды вуза //Приложение к журналу
«Открытое образование». Материалы Всероссийской научно-методической конференции «Открытое образо-
вание и информационные технологии». Пенза. – 2005. с. 368–371.
“Young Scientist” . #12 (35) . Vol. I . December 2011 Computer Science 79

Прогноз финансового состояния методом сравнения тенденций показателей


Левандовский Владислав Иванович, докторант, преподаватель, программист
Экономическая академия (г. Кишинёв, Молдова)
Комратский государственный университет

Одна из проблем, с которой могут или уже столкнулись в условиях кризиса торговые, производственные
предприятия и компании, оказывающие услуги, – отсутствие инструмента осуществляющего заблаговре-
менное предупреждение развитие кризисной ситуации. В статье автор подробно рассматривает методику
создания компонента информационной системы, осуществляющего прогноз развития кризисных и других яв-
лений на предприятии.

The Forecast Financial Status by Comparing Trends of Indicators


Vlad Lewandovski

One of the problems which may or may have already faced the crisis of trade, production companies and compa-
nies providing services – the lack of tool of early warning of development of a crisis. The author examines in detail the
methodology for creating a component information system, which can predict the development of crisis and other phe-
nomena on the enterprise.

А нализируя финансовую жизнедеятельность раз-


личных предприятий за определённый временной про-
межуток, не трудно обнаружить, что финансовая состав-
воды о будущем развитии кризисных явлений.
Основываясь на данный метод анализа и прогноза раз-
вития кризисных ситуаций, можно разработать анало-
ляющая предприятия не является величиной постоянной, гичный способ прогноза, но в основе которого, будет не
и имеет свойство волнообразно изменяться, временами анализ самих значений финансовых коэффициентов, а их
опускаясь, затем поднимаясь до определённого значения изменений (тенденций) за несколько отчетных периодов.
и т.д. Таким образом, финансовая составляющая деятель- Такой метод оценки финансового состояния предпри-
ность предприятия представляет собой совокупность эко- ятия базируется на сравнении динамики изменения зна-
номических спадов и подъёмов. чений финансовых показателей за ряд предшеству-
Практически любому спаду или подъему предшествуют ющих периодов.
некие события, создаются определённые предпосылки, Система должна определить тенденции изменения
причины вызывающие эти скачки. Задача управляющего отдельных показателей и темпы прироста за несколько
выявить эти предпосылки, знать о них. Что в дальнейшем предшествующих периодов. Затем выполняется поиск
позволит ему предсказать возможное развитие кризисной в архивной БД такого ряда отчетных периодов, у ко-
ситуации. торого тенденции изменений значений показателей и
Охарактеризовать финансовое состояние предприятие приростов значений коэффициентов, были бы схожи
можно посредством исследования значений абсолютных с тенденциями и приростами значений ряда периодов
и относительных финансовых показателей. Каждому со- предшествующих текущему отчетному периоду. Если с
стоянию соответствует определённый набор (шаблон) разницей в 10–15% в архивной БД будет обнаружен пе-
значений финансовых показателей, поэтому наблюдая за риод со схожей динамикой коэффициентов, то пользова-
значениями коэффициентов за различные отчетные пе- телю, по архивной БД, наблюдая от найденного периода,
риоды, можно определить характерное поведение зна- можно проследить возможное развитие событий в бли-
чений показателей в период стагнации, в предкризисный жайшем будущем.
период, в период кризиса или экономического роста. На Таким образом, в случаях развития кризисных ситу-
основании полученных данных о значениях коэффици- аций, управляющий сможет заблаговременно скорректи-
ентах, данных об изменении этих значений, можно будет ровать свои действия для предотвращения кризиса или
судить о текущем состоянии предприятия, и сделать вы- снижения потерь при выходе из кризисной ситуации.

Таблица 1. Кодирование изменений значений показателей

Изменение значения коэффициента Код


Падение 0
Без изменения 1
Рост 2
80 Информатика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Рис. 1. Алгоритм функции записи данных об изменении значений показателей между отчетными периодами
i – номер цикла прохода по базе исходных данных; DB – значение коэффициента в текущей строке БД;
DB (исх) – кол-во строк в таблице БД с исходными данными; k1,k2 – значения показателей из данных исходной БД;
scen – строка хранящая значение изменения (хода) показателя

Рассмотрим детально последовательность действий Для отслеживания поведения значений коэффици-


необходимых для создания программной процедуры про- ентов в динамике за несколько периодов, удобно будет со-
гноза. здать дополнительную таблицу, в одной ячейке которой,
В первую очередь, по истечению отчетного периода, будет храниться информация об изменении коэффици-
система выполняет очередной расчет показателей. Далее ентов за несколько отчетных периодов (нижняя часть рис.
сравнивая их значения со значениями за предыдущий пе- 2). На рисунке 2 в верхней таблице видно, что коэффи-
риод, определяется направление хода значения (падение циент маневренности (КМ) с 15.11.1984 по 15.12.1984
или рост) и величина изменения конкретного показателя. снижался (код – ‘0’), а с 15.12.1984 по 15.01.1985 повы-
Аналогичная операция проделывается со всеми показате- шался (код – ‘2’). Уже в нижней части эти данные нахо-
лями. Все данные по изменениям значений показателей дятся не в разных ячейках и на разных строках, а в одной
за текущий отчетный период по сравнению с предыдущим ячейке в виде кода – ‘02’ и в одной строке (первая строка).
отчетным периодом, в закодированном виде системой за- Алгоритм процедуры записи данных в одну ячейку (рис.
писываются в БД. Алгоритм процедуры представлен на 3), предполагает считывание данных из первой строки в
рис. 1. Такую совокупность изменений значений показа- поле КМ (коэффициент маневренности) (верхняя часть
телей за отдельный отчетный период назовем – сценарий рис. 2), затем переход на следующую строку и считывание
ходов значений коэффициентов. данных со второй строки этого же поля.
Кодирование изменений значений показателей от од- Считанные значения в виде строки сохраняются в стро-
ного отчетного периода к другому условимся выполнять ковую переменную и сохраняются в нижнюю таблицу
согласно приведенной таблице 1 кодирования. (рис. 2). Далее процедура возвращается на первую строку
“Young Scientist” . #12 (35) . Vol. I . December 2011 Computer Science 81

Рис. 2. Таблица БД с закодированными значениями изменений финансовых показателей


KM – коэффициент маневренности, KOSS – коэф. обеспечен. собств. средствами, KOZSI – коэфф. обеспеченности запасов
собственными источниками, KA – коэф. автономии, KSSZS – коэф. соотношения собственных и заёмных средств

Рис. 3. Алгоритм функции записи данных об изменении значений показателей между отчетными периодами
из нескольких строк в ячейку одной строки
j – номер цикла прохода по базе исходных данных cо сценариями; DBscenRC – кол-во строк в таблице БД со сценариями;
scen – строка хранящая значение изменения (хода) показателя; m – кол-во отчетных периодов; s – значение хода за один
отчетный период; DBscripts – БД с архивными комбинациями сценариев; DBscen – данные о сценарии из БД
82 Информатика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Рис. 4. Алгоритм процедуры сравнения текущего сценария ходов значений коэффициентов со сценариями
хранящимися в архивной БД
x – номер цикла прохода по базе исходных данных c архивными сценариями; DBarhRC – кол-во строк в таблице БД
с архивными сценариями; sum – кол-во совпадений текущих ходов значений коэффициентов с архивными в одном
сценарии; s1 – строка в которой кодируется сценарий ходов значений всех коэффициентов; DBk – значение сценария
в архивной БД

исходной таблицы и повторяет эти же действия, но у же Естественно, что следующие за найденными строками в
в следующем поле, коэффициента KOSS (коэффициент архивной БД, будут представлять собой возможный ва-
обеспеченности собственными средствами), пока не зако- риант развития событий в ближайшем будущем.
дирует все поля. В процессе деятельности предприятия, при ухудшении
Таким образом, система формирует строку изменений финансового состояния, менеджеры предприятия выну-
значений всех коэффициентов за несколько отчетных пе- ждены предпринимать меры по выходу из кризиса. Когда
риодов, причем крайним значением в строке, является удастся выйти из кризиса, пользователю системы пред-
значение за текущий период. Полученную строку си- ставиться возможность тщательно проанализировать
стема начинает сравнивать с аналогичными строками, на- комплекс предпринятых антикризисных мер. Выявить
ходящимися в архивной базе данных согласно алгоритму, причины сложившейся ситуации, и определить: какие
представленному на рисунке 4. предпринятые действия привели к положительным ре-
В процессе сравнения, текущего сценария изменений зультатам? Именно те антикризисные меры, благодаря
значений коэффициентов за несколько отчетных периодов которым удалось вывести предприятие из кризиса, ме-
с архивными сценариями, система выполняет подсчет ко- неджер должен зафиксировать в базе знаний предприятия.
личества совпадений изменений каждого коэффициента Причем база знаний в нашем случае будет представлять
в сценарии. Разумеется, что строки с совпадениями 80% таблицу-ассистент, подключенной к таблице с данными
и более будут отмечены подсветкой. Найденные и отме- значений коэффициентов за предыдущие периоды. Это
ченные строки в архивной БД, определяют периоды со означает, что при выделении строки в архивной БД (одна
схожими финансовыми состояниями с текущим периодом. строка содержит данные за один отчетный период), поль-
“Young Scientist” . #12 (35) . Vol. I . December 2011 Computer Science 83

зователь получает доступ к пакету антикризисных мер из поскольку при ручном поиске информации в базе знаний
таблицы-ассистента, относящихся непосредственно к пе- возможны различные погрешности.
риоду выделенной строки. Подобный подход позволит Сегодня особенно актуальна разработка и вне-
в дальнейшем не только определять заранее развива- дрение в учетные системы, инструмента прогно-
ющийся кризис, но и уже иметь в арсенале ряд дейст- зирования развития кризисных явлений на предпри-
венных антикризисных мер специфичных для фактиче- ятии, а также накопления опыта и приобретённых
ской ситуации. Также это позволяет сэкономить время компанией знаний в области ликвидации кризисных
при принятии управленческого решения в кризисной ситуаций. Эта задача, которая может принести
ситуации, повышает эргономичность программного про- значительную отдачу для бизнеса уже в ближайшей
дукта и снижает риск ошибки человеческого фактора, перспективе.

Литература:

1. Астахов В.П. Анализ финансовой устойчивости фирмы и процедуры, связанные с банкротством – М. Ось-89
1995
2. Ван Хорн Дж.К. Основы управления финансами – М. Финансы и статистика 1996
3. Гончаров М.И., Лемзяков Г.А. «Консалтинг в антикризисном управлении» «Экономика» 2006
4. Земитан Г. «Методы прогнозирования финансового состояния организации»
5. Кудинов А. (http://www.bkg.ru) «Что такое прогнозирование и зачем оно нужно»,
6. Чепурина М.Н. «Курс экономической теории». Учебное пособие. Под ред. проф. Киров: АСА, 1994
7. Шеремет А.Д., Негашев Е.В. «Методика финансового анализа», М.: Инфра-М, 1999

Способ оценки зависимости качества связи в системах IP-телефонии


от критических параметров IP-сети
Макарова Ольга Сергеевна, аспирант
Уральский федеральный университет имени первого Президента России Б.Н. Ельцина (г. Екатеринбург)

Введение безопасности, наряду с конфиденциальностью, которой


обычно уделяют самое большое внимание. Решение про-
На сегодняшний день системы IP-телефонии активно блемы качества связи зависит в первую очередь от пони-
развиваются в России. По результатам исследования мания того как оценивать качество и какие параметры
рынка корпоративной IP-телефонии в России [1] выяв- сети передачи данных оказывают наибольшее влияние на
лено, что доля корпоративной IP-телефонии на 2010 г качество связи.
составляла 39%, ее прогнозируемый прирост на 2010 г.
составлял 13%. Анализ результатов исследования [2] по- Способы оценки качества связи
казывает, что в первом квартале 2011 г. доля прироста
частного сегмента IP-телефонии составила 11%. Оценка качества связи может осуществляться различ-
Полученные результаты, объясняются экономической ными методами:
эффективностью использования систем IP-телефонии, – метод, использующий усредненный показатель
увеличением количества предлагаемых моделей и рас- мнений о качестве MOS (MeanOpinionScore) и представ-
ширением спектра сервисов, поддерживаемых системами ленный в [3] и [4];
IP-телефонии, надеждами на повышение качества IP-те- – метод, использующий рейтинг R (QualityRating),
лефонии. Расширение спектра предоставляемых сервисов определяемый с применением Е-модели [5].
и модельного ряда характеризует маркетинговую поли- Официально рекомендуемым способом оценки ка-
тику производителей оборудования. В то время как повы- чества IP- и других типов речевой связи является MOS.
шение качества связи при использовании IP-сетей – это Оценка MOS в соответствии с [2] осуществляется по пя-
решение самой главной проблемы организации инфор- тибалльной шкале. При использовании данной шкалы са-
мационной безопасности IP-телефонии. Так как обеспе- мому плохому качеству связиприсваивается оценка 1, а
чение качества связи позволяет обеспечить доступность и самому хорошему качеству связи присваивается оценка
целостность голоса, передаваемого в IP-телефонии. До- 5. Оценку качества связи осуществляет группа людей по
ступность и целостность столь же важные постулаты звучанию тестовых речевых шаблонов, передаваемых по
84 Информатика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

каналам, поддерживающим разное качество связи. Таким Решение задачи по связи значения QoE
образом, данная оценка является субъективной и может с критическими параметрами IP-сети
варьироваться от группы к группе. Тем не менее, при до-
статочно большой выборке может быть получена доста- В работе [7] был проведен анализ соответствия оценки
точно точная оценка. Данный алгоритм оценки позволяет QoE и значений критических параметров IP-сети. Было
понять удовлетворенности пользователей воспринима- выявлено, что значения оценок не совпадают. Анализ
емым качеством обслуживания. Результаты исследований проводился для 4 приложений Skype, Gizmo5, Damaka,
[6] показывают следующее: andVoo 100 студентами в возрасте от 19 до 28 лет, дли-
– очень высокая оценка составляет 4,00 и выше; тельность разговора по каждому из приложений состав-
– высокая оценка составляет 3,50–4,00; ляла 120 секунд, причем при разговоре с обеих сторон
– приемлемая оценка составляет 3,00–3,50; находились участники-оценщики. При оценке качества
– синтезированный звук получает оценку 2,50–3,00. обслуживания использовалось ПО Wireshark и специ-
При использованииосуществлении оценки, с исполь- альный скрипт, отслеживались параметры: полоса пропу-
зованием рейтинга R используется сто бальная шкала. скания, задержка, джиттер, потеря пакетов.
Единицы MOS связаны с R сложной нелинейной зависи- Необъективность данной оценки заключается в том,
мостью [5]. Данные методы оценки: что при каждом эксперименте качество исходного (про-
– характеризуют QoE – воспринимаемое качество об- слушиваемого) голоса было различным, так как на обеих
служивания; сторонах были участники – оценщики, голос различных
– являются субъективными; людей может восприниматься по-разному. Кроме того
– не позволяют автоматизировать процесс оценки. в ходе данного эксперимента не менялась полоса про-
Поэтому для оценки качества передачи голоса в ре- пускания, не менялись нагрузки в сети, поэтому отсле-
альных системах и приложениях используется другой по- дить критические значения параметров, при которых ка-
казатель качество обслуживания, учитывающий влияние чество связи являлось неприемлемым невозможно. В
различных параметров работы IP-сети на общую вели- ходе описанного эксперимента не проводилась и оценка
чину качества передачи голоса. Определены критические существующих систем обеспечения качества обслужи-
параметры IP-сети, влияющие на качества связи при пе- вания. Снятие ограничений данного исследования – за-
редаче голоса: дача данной работы.
– задержки при передаче пакетов;
– джиттер (вариация задержки при передаче пакетов); Описание модели оценки зависимости качества
– потеря пакетов. связив системах IP-телефонии от критических
На данный момент еще не решена задача по связи зна- параметров IP-сети
чения QoE с критическими параметрами IP-сети.
Задачи данной работы:
Характеристика влияния критических параметров – определение степени влияния параметров IP-
IP-сети на воспринимаемое качество обслуживания сети (проводных и беспроводных), таких как задержка,
джиттер и потеря пакетов, на качество связи. Данное со-
В системах IP-телефониивремя ожидания, означает поставление позволит разработать метод автоматизиро-
период времени, за который голос проделывает путь от ванной оценки качества передаваемой связи;
источника до получателя. Данный параметр характери- – степень повышения качества связи при использо-
зует запаздывание. Существует три типа задержки: вании существующих моделей повышения качества об-
– задержка на распространение зависит от длины пути, служивания QoS.
который должен пройти свет по оптоволоконному кабелю Данная задача будет решаться путем оценки звучания
или электрический импульс по медным проводам; тестовых речевых шаблонов (120 секунд) участников-
– задержка на сериализацию зависит от времени, в те- оценщиков по методике MOSи с использованием рей-
чение которого бит или байт помещается в интерфейс тинга R с одной стороны. Установки и оценки критических
(данная задержка пренебрежимо мала); параметров IP-сети, с помощью программно-аппаратных
– задержка на обработку зависит от фактического па- средств с другой стороны. После того, как будет сформи-
кетирования, сжатия и коммутации пакетов. рована взаимосвязь между критическими параметрами
Джиттер – это неравномерность периодов времени на IP-сети и MOS (R), будет проведена оценка существу-
доставку пакетов. Данный параметр характерен только ющих моделей повышения качества обслуживания QoS,
для пакетных сетей передачи данных. Данный параметр реализуемых средствами оборудования Cisco. Оценка
добавляет в передаваемую речь дребезг. будет производиться как для проводных, так и для беспро-
Потеря пакетов в сетях передачи данных – явление, водных сетей связи, построенных на оборудовании Cisco.
зависящее от используемого транспортного протокола. В Оценку будут производить студенты в возрасте от 16 до
сетях передачи данных возникновение критического тра- 23 лет.
фика требует контроля суммарных потерь пакетов. Решение данной задачи будет решаться на стенде.
“Young Scientist” . #12 (35) . Vol. I . December 2011 Computer Science 85

Стенд состоит из: при котором эксперт оценит качество связи как неудов-
– источника голосового сообщения; летворительное.
– устройство управления; В качестве приемника голосового сообщения должен
– канала передачи данных, с регулируемым количе- выступать участник – оценщик, который выставляет
ством передаваемых пакетов; оценку качества связи (R-Factor, MOS) на каждом шаге
– приемника голосового сообщения; эксперимента в соответствии со своими субъективными
– анализатора, позволяющего отслеживать критиче- ощущениями. Причем количество экспертов должно по-
ские параметры IP-сети. зволять сформировать усредненное статистическое зна-
Источник голосового сообщения должен позволять чение R-Factor и MOS при разном значении критических
формировать исходное сообщение со следующими свой- параметров.
ствами: Анализатор должен позволять отслеживать критиче-
– постоянное по качеству; ские параметры IP-сети (задержку, джиттер, потерю па-
– продолжительное по времени. кетов). Необходимо, чтобы анализ перехваченных пакетов
В нашем случае это можно сделать, записав исходное можно было провести как в режиме реального времени,
сообщение на диктофон. Длительность сообщения должна так и после проведенного эксперимента, путем просмотра
позволять провести эксперимент с различным количе- статистики. Для каждого голосового потока RTP необхо-
ством пакетов в канале. димо отследить следующие параметры:
Устройство управления – с помощью этого устройства – межпакетные интервалы – временное распреде-
возможно менять кодеки, используемые при передачи го- ление пакетов RTP в потоке (задержку);
лоса, реализовывать различные существующие и реали- – джиттер потока;
зованные модели QoS. – кол-во пакетов – количество пакетов RTP в секунду
Модель негарантированной доставки – включая повторные, потерянные и искаженные пакеты;
BestEffortService. Обеспечивает простое увеличение про- – полосу пропускания потока – скорость потока в
пускной способности без какого-либо выделения от- Кбит/c;
дельных классов трафика и регулирования. – размеры пакета – средние размеры пакетов RTP в
Модель Интегрированного сервиса – IntegratedService виде четырех диаграмм (весь пакет, RTP-нагрузка, RTP-
(IntServ). Описана в [8].Модель интегрированного обслу- заголовок, сетевой заголовок).
живания обеспечивает сквозное (End-to-End) качество Программа Commview удовлетворяет всем выше пере-
обслуживания, гарантируя необходимую пропускную спо- численным условиям.
собность. IntServ использует для своих целей протокол Реализация и анализ данной модели позволит понять
резервирования сетевых ресурсов RSVP (протокол), ко- влияние различных критических параметров работы IP-
торый обеспечивает выполнение требований ко всем про- сети на общую величину качества передачи голоса.
межуточным узлам.
Модель дифференцированного обслуживания – Результат
DifferentiatedService (DiffServ). Описана в [9], [10].
Обеспечивает QoS на основе распределения ресурсов В данной работе была выявлена основная проблема,
в ядре сети и определенных классификаторов и огра- связанная с отсутствия стандартизованного метода авто-
ничений на границе сети, комбинируемых с целью пре- матизированной оценки качества связи. Проведен анализ
доставления требуемых услуг. В этой модели вводится существующих методов оценки, решений данной про-
разделение трафика по классам, для каждого из которых блемы. Было выявлено, что при сопоставлении критиче-
определяется свой уровень QoS. DiffServ состоит из ских параметров IP-сетей, таких как задержка, джиттер
управления формированием трафика (классификация и потеря пакетов, и воспринимаемого качества обслужи-
пакетов, маркировка, управление интенсивностью) и вание важно:
управления политикой (распределение ресурсов, поли- – использовать одинаковые тестовые речевые ша-
тика отбрасывания пакетов). DiffServ является наиболее блонов (120 секунд);
подходящим примером «умного» управления приори- – использовать одну IP-сеть;
тетом трафика. – при передаче голосовых пакетов осуществлять изме-
Канал передачи данных должен обладать постоянной нение полосы пропускания, изменять нагрузкуна сеть.
пропускной способностью. Должна быть возможность В дальнейшем при использовании полученных резуль-
загрузки канала пакетами данных, передаваемых с по- татов, планируется разработать автоматизированную ме-
мощью протоколовс установлением соединения и без тодику оценки качества связи.
установления соединения на транспортном уровне (UDP Результаты, полученные при оценке существующих
и TCP пакеты). Это позволяет сделать программа jperf. моделей QoS, позволят сформировать оптимальную сеть
Загрузка канала пакетами производится с некоего на- передачи данных, позволяющую поддерживать необхо-
чального значения с определенным шагом до значения, димое качество связи.
86 Информатика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Литература:

1. DiscoveryResearchGroup. Исследование российского рынка IP-телефонии, 2010 г.


2. Discovery Research Group Исследование российского рынка IP-телефонии, 2011 г.
3. ITU-T Recommendation P.800 (08/1996). Methods for subjective determination of transmission quality.
4. ITU-T Recommendation P.830 (02/1996). Subjective performance assessment of telephone-band and wideband
digital codecs.
5. TU-T Recommendation G.107 (07/2002). The E-Model, a computational model for use in transmission planning.
6. URL: http://sirko-nn.ru/node/13 (дата обращения: 14.02 2011).
7. Maria-Dolores Cano, Fernando Cerdan, Subjective QoE analysis of VoIP applications in a wireless campus
environment. Springer Science, 2010 г.
8. RFC 1633. Integrated Services in the Internet Architecture: an Overview, 1994 г.
9. RFC 2474.Definition of the Differentiated Services Field (DS Field)in the IPv4 and IPv6 Headers, 1998 г.
10. RFC 2475.An Architecture for Differentiated Services, 1998 г.

Методология объектно-ориентированного программирования


на примере модели сетевых протоколов OSI
Миненков Андрей Михайлович, программист АСУТП
ООО «РУСАЛ Русская Инжиниринговая Компания» (г. Братск)

Усатюк Василий Станиславович, программист


Братский государственный университет

В современной IT отрасли стандартом разработки по- следующим радикальным изменением хода выполнения
давляющего большинства промышленных проектов программы.
прикладного уровня стало использование модели объ- Неадекватность понимания базиса ООП выразилась
ектно-ориентированного проектирования (ООП). Однако в развитии ООЯП. Существующие языки и лежащие в
на практике по целому ряду причин, которые мы рассмо- их основе модели разработки развивались неотрывно от
трим в дальнейшем, в сознании большинства програм- представлений, что такое программа. Ниже представлен
мистов (в том числе студентов IT специальностей) ООП краткий обзор эволюции методологии программирования:
исчерпывается применением синтаксиса объектно-ори- 1. Двоичные коды (машинные коды) – программа есть
ентированных языков программирования (ООЯП) с ис- упорядоченный набор состояний конечного автомата-
пользованием концепций структурного уровня програм- процессора (используется исключительно комбинатор
мирования (в лучшем случае). С другой стороны имеется следования);
большая группа специалистов осознано использующих 2. Языки ассемблера – программа есть упорядо-
методологию ООП, но не способных достаточно полно ченный набор мнемоник ЦПУ (используются комбина-
ответить на ряд фундаментальных вопросов, касающихся торы следования и альтернатива);
отношений между компонентами системы и тех сущест- 3. Языки высокого уровня (алгоритмические языки)
венных ограничений, которые накладываются на систему – программа есть упорядоченный набор операторов языка
в результате установления подобных отношений. (предоставляют в дополнение предыдущим двум реали-
Неадекватность применения объектно-ориентирован- зацию комбинатора цикла);
ного синтаксиса рассмотрим на примере простого выра- 4. Языки структурного уровня – программа есть
жения языка С++: A=B, оставив за рамками внимания упорядоченный набор методов – функциональных аб-
вопрос приведения типов. В концепции структурного стракций (реализации комбинаторов те же, однако эле-
уровня это выражение обозначает копирование всех мент комбинирования, не оператор языка, а функцио-
битов переменной В в переменную А. В концепции ООП нальная абстракция);
данное выражение означает – объекту А присвоить зна- 5. ООЯП – программа есть взаимодействующая
чения объекта В. В результате чего произойдет неявное совокупность компонентов, определяющая множество
выделениям памяти объектом А согласно реализации его реакций в ответ на возникновение соответствующих со-
оператора присваивания. Данная операция может при- бытий во внешней операционной среде, такой как, мно-
вести к сбою, в случае, отказа функции распределения па- жество клиентов корпоративной сети, ОС, BIOS, EFI
мяти и соответственно генерированию исключения с по- (Комбинаторы инкапсуляция, наследование, полимор-
“Young Scientist” . #12 (35) . Vol. I . December 2011 Computer Science 87

физм). путем безусловного последовательного выполнения всех


Исторически сложилось так, что ООЯП создавались в шагов алгоритма, вся сеть простаивает достаточно долго.
качестве надмножества языков структурного уровня, что А если отказ канала будет перемежающимся, то за счет
можно наблюдать на примере развития языка С++ из инертности алгоритма велик риск возникновения ситу-
С или языка Delphi из Pascal. Позднее (в середине 90-х ации, когда сеть вообще не выйдет в рабочий режим, а
годов) были предприняты попытки разработать объектно- будет заниматься исключительно изучением собственной
ориентированный язык, не привязанный к наследию топологии.
структурного уровня. Это достигалось путем превращения Идея объектно-ориентированного подхода заключа-
интерфейсов классов в категорический императив про- ется в том, чтобы при изменении конфигурации топо-
граммирования. Последнее характерно для ООЯП JAVA, логии, максимально локализовать изменения в конфигу-
C#. Однако в связи с отсутствием строгого и общеприз- рации сетевого оборудования, приостанавливая работу
нанного определения ООП и его ключевых структур су- только части сети, непосредственно контактирующей с
ществующие языки все еще имеют ограниченную под- эпицентром события. Иными словами каждый комму-
держку концепций данной методологии проектирования. татор в системе должен знать не всю топологию сети, а
Даже в языке С++, наиболее мощном средстве разра- лишь ее часть, непосредственно прилегающую к нему.
ботки на сегодняшний день, приходится конструировать Эти идеи в итоге приведут нас к современной реализации
механизмы, реализующие отношения между понятиями алгоритмов балансировки нагрузки, но уже на 3-м, а не на
той или иной предметной области. Т.е. невозможно на- 2-м уровне OSI.
писать универсальную библиотеку, которая позволит ре- Другим недостатком структурной методологии в си-
шать задачи любой предметной области с наибольшей эф- стеме из нескольких программ является необходимость
фективностью. Однако, какую бы мы предметную область модифицировать и компилировать координирующую про-
не взяли, методология ее анализа всегда остается одной и грамму заново для ее актуализации после добавления в
той же. Задача же программиста сводится к интеграции координируемые компоненты хотя бы одного нового со-
существующей библиотеки и описания предметной об- бытия. Например, представим рассмотренный ранее про-
ласти, разрабатываемого самим программистом. Как по- цесс анализа структуры сети в виде конвейера этапов. В
казывает практика, решить такую задачу без фундамен- результате работы такого конвейера принимается ре-
тальных знаний в области построения ООП систем и не шение, какие порты моста необходимо заблокировать для
вызвать потом на себя праведный гнев системных адми- исключения петель в топологии сети.
нистраторов не представляется возможным. GetPortList | SetFailedPorts | SetRootPort | SetDesigna­
Поскольку результатом вышеупомянутой интеграции tedPorts | SetBlockedPorts
является система обработки событий, ключевой особен- Проблема заключается в том, что каждая программа в
ностью работы ООП-приложений является способность конвейере полагается на присутствие необходимой для ее
асинхронно реагировать на события. Это качественно от- работы информации в потоке ввода. Это означает, что су-
личает объектно-ориентированные приложения от при- ществует некоторый протокол, определяющий в каком
ложений написанных в структурной методологии, для ко- смещении потока, находится тот или иной параметр, ис-
торой один из ключевых комбинаторов – следование, по пользуемый данной программой. Представим поток вы-
определению не допускает подобного поведения. Иными вода для каждой из утилит-этапов конвейера в случае
словами, система, реализованная с помощью структурной моста с 4 портами ethernet (таблица 1).
методологии программирования, является синхронной, Допустим, что теперь программа GetPortList будет
т.е инертной к изменению ключевых констант непосред- возвращать информацию также и о протоколе, сконфи-
ственно во время выполнения программы. гурированном для данного порта. При конвейерной об-
Для примера рассмотрим процесс анализа структуры работке велика вероятность совпадения значений полей,
сети по алгоритму Spanning Tree. Как известно, алгоритм разделяемых запятыми, в одной строке (то есть не гаран-
состоит из трех основных шагов: тируется уникальность идентификатора), однако интер-
1. Выбор корневого моста. претация этих значений может значительно отличаться.
2. Выбор корневого порта. В результате, если программы конвейера полагались на
3. Выбор назначенного порта. уникальность идентификатора, то их результат работы
В результате работы алгоритма каждый мост опреде- будет ошибочен. Если же они полагались на порядок сле-
ляет, какие сегменты, подключенные к его портам, за- дования полей, то и в этом случае их результат работы
мыкаются сами на себя (образуют петли) и переводит со- будет ошибочен, вследствие добавления новых значений.
ответствующие порты в режим только прослушивания. Рассмотрение этих проблем в рамках методологии ООП
Однако после изменения топологии сети (отказе канала привела к появлению формата XML, который сейчас ис-
или добавления нового моста) весь алгоритм приходится пользуется практически повсеместно, начиная от задач
выполнять заново, чтобы перестроить граф активных ка- оперативного обмена сообщениями между пользовате-
налов в соответствии с новыми исходными данными. В лями (протокол XMPP), заканчивая маршалингом ин-
связи с тем, что топология каждый раз строится «с нуля», формации, необходимой для удаленного вызова процедур
88 Информатика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Таблица 1

1. GetPortList: 2. SetFailedPorts:
eth0, 10mbit, FD, Up eth0, 10mbit, FD, Up, Active
eth1, 100mbit, HD, Up eth1, 100mbit, HD, Up, Active
eth2, 100mbit, FD, Up eth2, 100mbit, FD, Up, Failed
eth3, 10mbit, FD, Down eth3, 10mbit, FD, Down, Failed
3. SetRootPort: 4. SetDesignatedPorts:
eth0, 10mbit, FD, Up, Active, Root eth0, 10mbit, FD, Up, Active, Root, ND
eth1, 100mbit, HD, Up, Active, NR eth1, 100mbit, HD, Up, Active, NR, D
eth2, 100mbit, FD, Up, Failed, NR eth2, 100mbit, FD, Up, Failed, NR, ND
eth3, 10mbit, FD, Down, Failed, NR eth3, 10mbit, FD, Down, Failed, NR, ND
5. SetBlockedPorts:
eth0, 10mbit, FD, Up, Active, Root, ND, NB
eth1, 100mbit, HD, Up, Active, NR, D, NB
eth2, 100mbit, FD, Up, Failed, NR, ND, B
eth3, 10mbit, FD, Down, Failed, NR, ND, B

в .NET и организацией обмена между клиентским прило- Применение данного подхода позволяет нам строить
жением и СУБД. гетерогенные сети произвольной топологии, то есть сети,
За короткую историю компьютерных технологий спе- работающие на различных протоколах передачи данных.
циалистам не раз приходилось сталкиваться с проблемой Причем для данной системы не будет иметь значения,
построения масштабируемых систем. Как нам известно, какой протокол задействован, так как, несмотря на раз-
решением данной проблемы в сфере построения сетей пе- личия, протоколы решают одну и ту же задачу в кон-
редачи данных стало рассмотрение любой сети с позиций тексте одного и того же уровня модели. В этом и заклю-
модели взаимодействия открытых систем (OSI). чается основной эффект применения ООП – методологии.
Проведя аналогию между ООП системой, состоящей Ответ же на вопрос, как строится подобная система,
из некоторой совокупности взаимодействующих эле- почему в стержне архитектуры лежат именно понятия
ментов (объектов), и абстрактной сетью описываемой «Канал», «Сегмент», «Сеть» и т.д. следует искать в по-
моделью OSI (Рис. 1), мы можем прийти к пониманию нятии элементарного объекта, т.е. такого понятия пред-
сущности и роли трех основных комбинаторов ООП: ин- метной области, которое мы не можем расчленить на суб-
капсуляции, наследования и полиморфизма. понятия в контексте заданной предметной области.
Рассматривая модель OSI в приложении к прото- Итак, представленная архитектура на всех уровнях
колу TCP/IP, мы можем наблюдать, что каждый новый своей реализации решает концептуально одну и ту же за-
уровень модели образуется совокупностью однородных дачу – передачу сообщения между парой или большим
взаимодействующих элементов нижестоящего уровня. числом узлов системы. Если рассматривать функцию пе-
Иными словами каждый вышестоящий уровень вклю- редачи сообщения как функцию, изменяющую состояние
чает в себя элементы нижестоящего уровня. Таким атомарного (элементарного) объекта архитектуры, на-
образом определяется понятие включения в модели OSI, пример, канала связи, представленного кабелем, то ло-
которое является частным случаем понятия инкапсу- гично будет рассмотреть данный объект в виде конеч-
ляция. Понятие инкапсуляции является более общим и ного автомата, имеющего соответствующие состояния
подразумевает не только включение элементов, но также (Рис. 2).
и сокрытие типов данных, используемых внутри подси- Модель конечного автомата двух состояний достаточно
стемы, при рассмотрении этой же подсистемы с более просто преобразуется к классу ООЯП, описывающему
высокого уровня. элемент выбранного уровня рассмотрения системы. Для
Отношения между абстрактными и специализирован- автомата двух состояний имеем 4 существенных события
ными сущностями называется наследование и существует и 2 метода-триггера этих событий. На рис. 3 изображена
в контексте выбранного уровня рассмотрения системы. импульсная интерпретация рассматриваемой модели, где
Механизм представления какой-либо специализиро- t1 соответствует поведению клиентской стороны (генера-
ванной сущности в виде ее абстракции называется по- тора событий), t2 – поведению моделируемого объекта
лиморфизмом. Это отношение можно наблюдать на (обработчика событий), t3 – поведению взаимосвязан-
примере третьего уровня OSI для сети и подсети и сово- ного объекта, причем при вариации продолжительностей
купности реальных протоколов (в данном случае IP, IP6, и амплитуд импульсов всех трех объектов, характер взаи-
IPX). моотношений между ними будет оставаться неизменным.
“Young Scientist” . #12 (35) . Vol. I . December 2011 Computer Science 89

Рис. 1. Объектно-ориентированная модель OSI

Рис. 2. Модель конечного автомата двух состояний «Канал»

В контексте языка C++ та же самая модель будет void SetAdviceSink (CLink::IAdviceSink * pAdviceSink);
иметь следующий вид: bool OpenSignalFront ();
bool CloseSignalFront ();
class CLink{ ...
public: };
class IAdviceSink{
public: Наибольший интерес в классе представляет абстрак-
virtual void BeforeOpenSignalFront (CLink * pSource) = 0; тный класс (интерфейс) IAdviceSink, который позволяет
virtual void AfterOpenSignalFront (CLink * pSource) = 0; вызывать методы клиентского объекта со стороны реали-
virtual void BeforeCloseSignalFront (CLink * pSource) = 0; зуемого класса в ответ на всякое изменение существен-
virtual void AfterCloseSignalFront (CLink * pSource) = 0; ного состояния моделируемого объекта.
}; Здесь мы сделаем небольшое практическое отсту-
CLink (CLink::IAdviceSink * pAdviceSink = NULL); пление, касающееся реализации модели событий в C++.
virtual ~CLink (); Что же такое событие с точки зрения языка программи-
90 Информатика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Рис. 3. Импульсная интерпретация модели объекта «Канал»

рования? В языке С (без плюсов) существует понятие // Далее идет определение класса.
указателя на функцию, в общем виде имеющее прибли- };
зительно следующее представление: typedef void (*) ()
PCALLBACK; Внутренний класс INotificationSink позволяет нам до-
Суть применения указателя на функцию – возмож- биться такого поведения, чтобы другой объект получал
ность во время выполнения программы связать так не- уведомления от объектов класса CSomeObject. Для этого
которые участки программы, чтобы функция по указан- нам лишь надо выполнить следующее:
ному адресу вызывалась в ответ на некоторое событие в
нашем компьютерном мире. Так например реализовыва- class CAnotherObject : public CSomeObject::INotificationSink {
лись когда-то векторы прерываний в DOS. public: virtual void OnSomeEvent (const SomeClass & cSender) {
В языке С++ понятие функции обратного вызова /* реализация обработчика здесь */
имеет свою специфику, потому как и представление о }
программе в нем отличается от того же представления в C. // прочие составляющие класса.
Итак, допустим, перед нами стоит задача вызова функции- };
обработчика по указателю в ответ на некоторое событие,
зафиксированное (обнаруженное) нашим объектом. Теперь используем принцип полиморфизма. Суть по-
Сложность здесь в том, что каждому методу некоторого лиморфизма заключается в трактовке объекта через его
класса в С++ неявно передается указатель (this) на эк- интерфейс, но при этом, поскольку метод является вирту-
земпляр этого класса. То есть, если мы определим тип альным, то при вызове интерфейсного метода вызываться
указателя на функцию PCALLBACK: typedef void (*) () будет метод фактического класса, экземпляром которого
PCALLBACK; то этот тип не будет соответствовать сиг- и является трактуемый объект. Таким образом, доопре-
натуре вызова: «pSomeObject->SomeMethod ();» . деляя первый класс, получим:
В C++ существует понятие указатели на методы объ-
екта, но большинство программистов предпочитают с class CSomeObject {
ними не связываться (уж очень они неуклюжи). Поэтому public:
поступают так: class INotificationSink {
public:
class CSomeObject { virtual void OnSomeEvent (const SomeClass & cSender) = 0;
public: };
class INotificationSink { private:
public: INotificationSink * m_pAdvicedObj;
virtual void OnSomeEvent (CSomeClass & cSender) = 0; public:
}; explicit CSomeObject (INotificationSink * pAdvicedObj = NULL) {
// ... m_pAdvicedObj = pAdvicedObj;
“Young Scientist” . #12 (35) . Vol. I . December 2011 Computer Science 91

} class CSegment{
void SomeMethod () { public:
/* Допустим, тут мы обнаруживаем некоторое class IAdviceSink{
* событие и хотим уведомить наш приёмник событий. */ public:
if (m_pAdvicedObj != NULL) m_pAdvicedObj- virtual void BeforeOpenMedia (CSegment * pSource) = 0;
>OnSomeEvent (*this); virtual void AfterOpenMedia (CSegment * pSource) = 0;
} virtual void BeforeCloseMedia (CSegment * pSource) = 0;
}; virtual void AfterCloseMedia (CSegment * pSource) = 0;
};
Конечно, возможны и другие способы реализации со- CSegment (CSegment::IAdviceSink * pAdviceSink =
бытийно-ориентированного взаимодействия в С++, к NULL);
тому же у нас может быть более одного приёмника со- virtual ~CSegment ();
бытий (уведомляемого объекта), но нам ничто не мешает void SetAdviceSink (CSegment::IAdviceSink * pAdviceSink);
реализовать одну из вариаций объекта мультиплексора- bool OpenMedia ();
броадкастера, который будет принимать сначала уве- bool CloseMedia ();
домление от исходного объекта, а затем поочередно пе- . . .
редавать каждому зарегистрированному в броадкастере private:
приемнику. Этот аспект вопроса лучше всего освящен в typedef std::list< CLink > TList;
фундаментальной работе GoF во главе с Эрихом Гаммой – TList Items;
«Шаблоны объектно-ориентированного проектирования» };
(Gamma et all, 1995), паттерн цепочка ответственности
(Responsibility Chain). Обратите внимание на выделенную жирным курсивом
Впрочем, можно трактовать m_pAdvicedObj как vector часть объявления. Буквально она означает, что понятие
или даже deque, но, как истинный идеалист, я предпо- Сегмент включает в себя множество разнородных (по-
читаю не сваливать на один класс все возможные роли. лиморфных) понятий Канал, однако трактуемых единоо-
Именно из-за подобной перегрузки ролями такие библи- бразно. Описав же в реализации класса Сегмент процесс
отеки как VCL или .NET страдают от переизбытка числа взаимодействия между экземплярами класса Канал, мы
методов на один класс, и часто представление програм- получим на нижестоящем уровне систему каналов, изме-
миста о том или ином классе остается лишь частичным. В нение состояния одного из членов которой ведет к согла-
этом нет большой беды, если вы лишь используете библи- сованной реакции соседних членов и так далее, пока общее
отеку, но если перед вами будет поставлена задача, ре- состояние системы не станет устойчивым. Эта модель хо-
шение которой приведет не просто к расширению, а даже рошо отражает физические процессы передачи энергии
к частичной реорганизации класса, то вы рискуете поте- и/или информации в реальном мире, поэтому является
ряться в деталях. чрезвычайно гибкой. В то же самое время, выделение но-
Но вернемся к стеку протоколов и нашему первому вого уровня абстракции, достигаемого с помощью анализа
наброску класса. Именно наброску, так как представ- часть-целое, позволяет согласованно управлять множе-
ленная часть образует лишь прототип функционала, до- ством аспектов работы элементов из общего центра, об-
ступный для эксплуатации клиентской стороной. Однако легчая с ростом уровня реализацию задачи передачи сооб-
это уже большой шаг в сторону формализации. Вопрос ре- щения (в данном случае) до тех пор, пока для ее решения
ализации методов в C++ достоин написания отдельной не окажется достаточным вызвать единственный метод.
статьи. Здесь же мы рассмотрим лишь еще один аспект И как только мы начинаем рассматривать программиро-
– как формируется объект класса вышестоящего уровня вание с клиентской точки зрения, мы покидаем мир объ-
с помощью включения множества однородных объектов ектно-ориентированного проектирования и вновь возвра-
класса нижестоящего уровня. Мы опустим модель конеч- щаемся к процессам, или, иными словами, к структурному
ного автомата двух состояний для понятия сегмента, так программированию. И каким бы объектным не являлось
как рамки статьи, увы, ограничены, но для вас не должно ваше приложение, все равно для него должна присутство-
составить большого труда восстановить эту модель для вать та часть, которая будет изменять его состояния. Поэ-
рассматриваемого класса самостоятельно по аналогии с тому даже на C++ программа все так же традиционно на-
предыдущим уровнем. Ниже приведен листинг интерфей- чинается с функции main.
сной части класса.

Литература:

1. Себеста Р.В., Основные концепции языков программирования. – М.: «Вильямс», 2001. – с. 672.
2. Cisco Systems Руководство Cisco по междоменной многоадресатной маршрутизации = Interdomain Multicast
Solutions Guide. – М.: «Вильямс», 2004. – с. 320.
92 Информатика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Triangulation method of projection scanning as a basis of the combined system


for input of three-dimensional images
Мордвинов Алексей Андреевич, магистр
Новосибирский государственный технический университет

Introduction Triangulation method and mobile setup for object


contouring
There are many different ways to obtain 3D measure-
ments and the many types of scanners that are based on In these researches, active triangulation has been used
any one single way. Among the huge number of different by the lighting methods to perform the contouring via image
methods to obtain three-dimensional model of the object processing. In active triangulation, the distance between the
can be identified several key: triangulation method, based on image sensor and the laser projector provides the depth res-
determining the time of the signal, the phase shift method olution. But in a static setup, holes in the surface occur due
and so on. to the limitation of view field of the image sensor and to depth
Currently, the development of information technology en- variation. Therefore, occlusions appear, and there are prob-
ables the measurement of geometrical parameters of three- lems in detecting small details. In this case, the object recon-
dimensional objects. However, to date there are no samples struction is not completed [4, p. 70].
of three-dimensional scanners are available in daily use, can To overcome these limitations, the object is profiled from dif-
get a three-dimensional model of the object only by means ferent views to obtain the complete object. This is done by using
of an ordinary webcam and a projector. Non-contact method multiple cameras or a mobile setup. Also, fringe projection, line
of measuring the geometrical parameters allows for nonde- projection, and spot projection have been applied to acquire dif-
structive testing parameters of products. ferent views of the object. In fringe projection, the object surface
The most promising optical techniques that will improve is retrieved by applying a phase detection algorithm. Then, the
the measurement accuracy, improve productivity and in- phase is converted to actual dimensions based on the setup ge-
crease the measurement range. ometry. In line projection and spot projection, the object depth
Three-dimensional contouring is an important research is computed by triangulation using the position of the light pat-
topic in industrial inspection, computer vision, navigation, tern and the setup geometry. These kinds of optical sensors
rapid prototyping, reverse engineering, and object mod- have been successfully applied to detect complete objects.
eling. Nowadays, the contouring is achieved by noncon- A mobile setup avoids occlusions and improves the reso-
tact systems based on lighting methods [1, p. 270]. These lution. However, a new equation must be deduced to com-
kinds of sensors use methods such as fringe projection, line pute the object depth in each modification of the geometry.
projection, spot projection, time of flight, and interferom- This step includes a new measurement of the modified ge-
etry. Many researches have been concentrated on these ometry and the determination of the parameters of the vision
sensors, and new techniques are still being developed [3, p. system. According to these considerations, modeling of the
286]. Today, commercial solutions are available and used mobile setup is required to retrieve the object depth automat-
by the scientific community. And there is no, unfortunately, ically at any camera position. Also, modeling of the mobile
a scanning device capable of a three-dimensional model setup is necessary to improve its performance.
of the object immediately, without providing the neces- Modeling of a mobile setup is performed to achieve con-
sary conditions, so any such system is narrowly applicable, touring of a complete object. The proposed model provides
and perfect. However, these sensors are still very expensive, an equation that computes the object depth at any camera
and a long time is required to obtain the object reconstruc- position. The mobile setup is implemented by an electrome-
tion. Also, manual operations are required for the data col- chanical device, which moves the camera and the object on
lection in these sensors [2, p. 1660]. Therefore, there is a an axis. To perform the contouring, the object is moved and
task to develop a new universal system that includes sev- scanned by a laser line. (To simulate the laser beam is used
eral methods for determining the topography and the con- ordinary projector that displays the required image on the ob-
struction of three-dimensional model of the object and does ject). Based on the deformation of the laser line, the algo-
not depend on the conditions of scanning and the research rithm of triangulation method generates a model to compute
is now focused on low cost, good accuracy, and fast pro- the object dimension by means of the camera position. To de-
cessing. tect the small details, the setup begins with a long distance
In our work for the design of the combined system of the between the laser line and the camera. When an occlusion of
input three-dimensional images, I use two methods: trian- the laser line appears, the camera is moved toward the laser
gulation method and method of phase shift. In this article we line to detect the occluded region.
will briefly consider only the first, since it is a fundamental For this mobile setup, the object dimension is proportional
and basing. to the deformation of the laser line. Also, the deformation de-
“Young Scientist” . #12 (35) . Vol. I . December 2011 Computer Science 93

Fig. 1. Experimental mobile setup

pends on the camera position. Thus, the algorithm computes laser line is deformed at the image plane according to the ob-
the object dimension by means of the laser line deformation ject surface. The relationship between the laser line deforma-
and the camera position. Also, this algorithm provides the in- tion and the object dimension is evaluated. Thus, the con-
trinsic and extrinsic parameters of the vision system. In this touring of the object shape is performed.
manner, parameters such as the focal length, camera orien- The relationship between the position of the laser line and
tation, and distances in the setup geometry are deduced by the object depth is described by the geometry shown in Fig. 2.
computer algorithms. Thus, the mobile setup performs the For this geometry, the reference plane is the platform of the
contouring automatically. electromechanical device. In this reference plane, the three-
In the reconstruction system, the produced information dimensional Cartesian coordinates are defined. The coordi-
is stored in an array memory to obtain the complete ob- nates (x, y) are on the reference plane, and the coordinate z
ject shape. This computational process improves the perfor- is perpendicular to the coordinates (x, y).The plane (x, y) is
mance, the resolution, and the accuracy of the reconstruc- the reference from which the object depth is measured. The
tion system. This procedure represents a new contribution reference z=0 is obtained based on the projection of the laser
to laser-line projection methods. The experimental results line on reference plane. In this case, the coordinate of the
are evaluated based on the root mean square error. The eval- laser line on the x axis is the same as on the y axis. In the ge-
uation of these results includes measurement error, resolu- ometry of Fig. 2, the x axis and y axis are located on the refer-
tion, processing time, range of measurement, and limita- ence plane, and the object depth is indicated by h (x, y). The
tions of the CCD array. In this evaluation, good repeatability points A and B correspond to the projections of the laser line
is achieved. on the reference plane and on the object surface, respectively.
Shape detection by means of multiple views is an impor- The laser line is deformed in the image plane due to the sur-
tant task in optical metrology and computer vision. In the face variation and the camera position. Thus, the coordinate
mentioned methods, the vision parameters are computed of the laser line is changed from xA to xB in a step of the scan-
to achieve the measurement of the object shape. Typically, ning. This displacement of the laser line is described by
these parameters are obtained by a procedure external to the s (x,y) = xA − xB (1)
reconstruction system. In the proposed mobile setup, the ob- The object dimension is proportional to the displacement
ject contouring is performed by an automatic vision system. s (x, y).
This means that the extrinsic and intrinsic parameters of the To detect the displacement, the maximum of the laser line
vision system are deduced by computational algorithms. is measured in the image. To do so, the pixels of each row are
The mobile setup is shown in Fig. 1. This setup includes approximated by a continuous function.
an electromechanical device, a CCD camera, a laser line pro- To simulate the laser beam is used ordinary projector
jector, and a computer. In the electromechanical device, the that displays the required image on the object. To increase
object is moved along the x axis by means of a platform and the increase the accuracy in the process of obtaining three-
control software. On the object, a laser line is projected to dimensional model of the object is scanned in two direc-
perform the scanning. In each step of the movement, the tions: horizontally and vertically. Fig. 3 (a) and Fig. 3 (b)
CCD camera captures the laser line. The camera is aligned shows the images with horizontal and vertical position of
at an angle to the object surface. This camera can be moved, the laser, but Fig. 3 (c) also shows the total lattice posi-
independently of the laser projector, along the x axis. Every tions of the scan line, which contains information about the
94 Информатика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Fig. 2. Geometry of the experimental setup

(a) (b) (c)

Fig. 3. (a) Horizontal laser line projected on the object. (b) Vertical laser line projected on the object.
(c) The total lattice positions of the scanning line

relief of the object. Typically, occlusions of laser line appear Experimental Results
in the initial configuration due to the surface variation. This
lack of data is observed in the line occlusion and its broken The model of the mobile setup is available to perform the
contour. To avoid this occlusion, the CCD camera is moved contouring from different views of the object. Thus, occlu-
toward the laser projector or object is rotated about itself. In sions are avoided, and small details are detected. Also, the
this manner, the occlusion is avoided and the object con- vision parameters are obtained, and physical measurements
tour is completed. However, the scale factor of these con- on the setup are avoided. Thus, the contouring is performed
tours is not the same. This is because the contours are automatically by the model of the mobile setup.
computed in different camera positions. In the model of the In the arrangement Fig. 1, the object is moved along the
mobile setup, the scale factor is corrected according to the x axis in steps of 1.27 mm. This device can be moved 0.0127
camera position. mm as a minimum step along the x axis, y axis, and z axis. A
“Young Scientist” . #12 (35) . Vol. I . December 2011 Computer Science 95

laser line is projected on the target by a 15-mW laser diode object shape. The results of reconstruction of the object is
to perform the scanning. The laser line is captured by a CCD shown in Fig. 4.
camera and digitized by a frame grabber of 256 gray levels.
The displacement of the laser line is computed based on the
maximum intensity. The resolution in the x direction is de-
duced by detecting the laser line in two different positions.
To do so, the laser line is moved 127.00 mm away from the
initial position by means of the electromechanical device.
Then the number of pixels between these two positions is
328.324. Thus, the resolution on the x axis is computed by
the relationship resolution = (pixel number)/distance. The
resolution in the y direction is obtained by detecting the ob-
ject on the laser line at two different positions on the y axis.
To do so, the object is moved 95.00 mm away from the initial
position on the y axis. Then the maximum displacement of
Fig. 4. Three-dimensional shape of the object
the laser line is detected in each movement. The resolution
in the z direction is provided by the displacement of the laser Conclusion
line along the x axis. The position of the laser line is mea-
sured with a resolution of a fraction of a pixel. Also, the dis- A technique of contouring performed by a model of a mo-
placement in Eq. (1) is achieved with a resolution of a frac- bile setup has been presented. The technique described here
tion of a pixel. provides a valuable tool for industrial inspection and reverse
The experiment was performed with one object. The ob- engineering. The automatic process avoids physical mea-
ject to be profiled was the Pushkin’s bust shown in Fig. 3 surements on the setup, which are common in methods of
(a). An occlusion appears due to the surface variation. This laser line projection. This procedure improves the accuracy
occlusion was detected and recovered by the mobile setup. of the measurement, because measurement errors are not
Thus, the contouring was performed completely. To do so, passed to the contouring system. This step is achieved with
data produced was scanned along the x axis in steps of 1.27 few operations. By using this computational-optical setup,
mm. Data produced by the algorithm generate the complete good repeatability has been achieved in each experiment.

References:

1. F. Remondino and S. El-Hakim, Image-based 3D modelling: A review, Photogramm. Rec. 21 (115), 269–291, 2006.
2. H. Y. Lin and M. Subbarao, Vision system for fast 3-D model reconstruction, Opt. Eng. 43 (7), 1651–1664, 2004.
3. L. M. Song and D.N. Wang, A novel grating matching method for 3D reconstruction, NDT & E Int., 39, 282–288,
2006.
4. L. Zagorchev and A. Goshtasby, A paintbrush laser range scanner, Comput. Vis. Image Underst. 10, 65–86, 2006.

Автоматизированная информационная система контроля знаний


удаленного доступа
1 Прончев Геннадий Борисович, кандидат физико-математических наук, доцент;

2 Прончева Надежда Геннадьевна, кандидат физико-математических наук, доцент;


1 Гришков Александр Владимирович, студент V курса;
1 Московский государственный гуманитарный университет им. М.А. Шолохова
2 Институт прикладной математики им. М.В. Келдыша РАН

В статье представлена новая автоматизированная информационная система контроля знаний удален-


ного доступа. Информационная система может быть использована в дистанционной форме обучения. Те-
стовые задания вводятся в систему в виде текстовых файлов. Как результат – тестовые задания легко
масштабированы и инвариантны относительно содержания.

О дним из приоритетных направлений развития нашей


страны является внедрение информационных тех-
нологий во все сферы жизни. В.В. Путин отмечал [1]:
«Страны, сделавшие ставку на развитие IТ-технологий,
сегодня занимают наиболее выгодные позиции в мировом
разделении труда. Они добились существенного роста
96 Информатика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

производительности труда, повысили качество государ- Автоматизированная информационная система


ственного управления. А доступность для граждан всего контроля знаний
спектра информационных услуг кардинально повлияла
на развитие в этих странах человеческого капитала, на Автоматизированные информационные системы
рост их конкурентоспособности. И, наконец, свободный контроля знаний (АИСКЗ) используются во многих об-
обмен идеями и информацией – это важный фактор укре- ластях, например:
пления в государствах демократических институтов и про- • при проведении пробных ЕГЭ;
цедур». В утвержденной президентом России «Стратегии • при принятии теоретического экзамена в ГАИ;
развития информационного общества в Российской Фе- • в различных тестах в Интернете (учебные, социоло-
дерации» [2], одной из основных задач было названо гические опросы и т.д.).
«повышение качества образования, медицинского обслу- АИСКЗ имеют ряд преимуществ по сравнению с тра-
живания, социальной защиты населения на основе раз- диционными методами контроля:
вития и использования информационных и телекоммуни- 1. Процесс проверки заданий автоматизирован.
кационных технологий». 2. Выставление оценок происходит на основании ко-
Использование современных технических средств личества правильно выполненных заданий теста.
придает учебному процессу творческий, поисковый ха- 3. Контроль знаний можно проводить на каждом за-
рактер, что способствует развитию творческих спо- нятии, так как такой контроль при малом количестве во-
собностей учащихся, повышению интереса к учебному просов, выполняется очень быстро.
процессу [3]. Обзор современных информационных тех- 4. Оценка за знания ставится объективно и не зависит
нологий, применяемых в общеобразовательной школе в от преподавателя.
настоящее время можно найти в нашей работе [4]. Од- 5. Все результаты проведенных тестов сохраняются, и
нако, только наличие технических средств не решает про- всегда можно повторно вернуться к результатам.
блем информатизации образования. Необходимо совер- 6. У преподавателя всегда есть статистика по успе-
шенствовать старые и разрабатывать новые методики ваемости учащихся.
преподавания. 7. Высокий уровень масштабируемости тестовых
В настоящее время миллионы людей получают образо- систем.
вание по дистанционной форме обучения с помощью гло- 8. Хорошая защита от фальсификации результатов
бальной вычислительной сети Интернет. Использование тестирования.
Интернет-технологий позволяет [5]: 9. Возможность дистанционной проверки знаний
• обучаться «без отрыва от производства»; учащегося находящегося, вне учебного заведения (на-
• выбрать для обучения удобное время и место; пример, по причине болезни)
• получать оперативные, в том числе в режиме реаль- Чтобы обеспечить совместимость с различными ти-
ного времени, консультации преподавателей; пами компьютеров и различными ОС, в качестве ра-
• обсуждать возникающие вопросы в Интернет-сооб- бочей среды АИСКЗ нами был выбран Интернет (тип
ществах в интерактивном режиме; приложения – Web-приложение). Для работы Web-
• использовать существующие мультимедийные приложения нужен Web-браузер, который по умолчанию
электронные библиотеки; всегда устанавливается в современных операционных си-
• оперативно найти применение полученным знаниям стемах, поэтому преимущество такой схемы очевидно.
на практике. Отсутствие Интернета не мешает использовать АИСКЗ,
Ранее [5] нами сообщалось о создании нового муль- так как в любом учебном заведении есть локальная вы-
тимедийного портала, позволяющего проводить дистан- числительная сеть, и АИСКЗ можем быть установлена на
ционные занятия по основам программирования. По- Web-сервер этой сети.
сетителям портала предлагается пройти курс из 27–30 Для новой АИСКЗ были определены следующие тре-
занятий. Каждое занятие содержит раздел теоретических бования:
знаний, необходимых для написания и реализации про- 1. Информационная система должна функциониро-
ектов занятия и набор однотипных проектов для закре- вать практически на любом компьютере и с любой ОС.
пления нового материала. Для осуществления контроля 2. Информационная система должна иметь простой,
знаний на портале реализовано три вида тестов: проме- понятный и удобный интерфейс.
жуточный, контрольный и итоговый. 3. Информационная система должна работать ста-
В данной работе сообщается о создании нового муль- бильно, гарантировать сохранность результатов тестиро-
тимедийного портала, позволяющего осуществлять ди- вания.
станционный автоматизированный контроль знаний. Те- 4. Информационная система должна быть легко на-
стовые задания вводятся в автоматизированную систему в страиваема, должна иметь установщик системы.
виде текстовых файлов и легко могут быть адаптированы 5. Информационная система должна использовать
под различные цели. общую базу для хранения всех настроек системы.
6. Информационная система должна обеспечи-
“Young Scientist” . #12 (35) . Vol. I . December 2011 Computer Science 97

вать возможность масштабирования и инвариантности полученный запрос, и результат выполнения запроса пе-
­тестов. ресылают обратно пользователю.
7. В информационной системе должны быть реализо- На рис. 2 представлена логическая структура АИСКЗ.
ваны механизмы визуализации результатов тестирования.
8. Информационная система должна быть защищена
от возможности несанкционированного доступа.
9. Информационная система должна содержать про-
стой механизм регистрации новых участников.
10. Информационная система должна иметь возмож-
ность демонстрации ошибок для участников тестов.
11. В информационной системе должна быть воз-
можность размещения дополнительных учебных матери-
алов.
12. В информационной системе должен быть элек-
тронный журнал с регистрацией имени, дня и времени по-
сещения. Также в журнале должно быть записано время
прохождения теста.
На рис. 1 представлен процесс взаимодействия поль-
зователя с АИСКЗ.

Рис. 2. Логическая структура АИСКЗ

Пользователь формирует запрос на получение HTML-


документа с PHP-кодом (например, запрос на вывод
оценок какого-либо ученика) с помощью браузера и пере-
дает его Web-серверу через канал связи. Web-сервер, по-
лучив запрос, передает управление запрошенному PHP-
скрипту. PHP-скрипт делает запрос на выбор данных из
базы данных АИСКЗ и формирует HTML-документ на
основе полученных данных. Далее HTML-документ от-
правляется через канал связи обратно в браузер пользо-
вателя.
На рис. 3 представлена физическая структура АИСКЗ.

Рис. 1. Взаимодействие пользователя с АИСКЗ

Пользователь составляет запрос посредством своего


браузера, (браузер может быть любой – Internet Explorer,
Opera, Mozilla Firefox, Apple Safari, Google Chrome). Бра-
узер пользователя формирует запрос и передает его се-
тевой подсистеме операционной системы, которая по-
сылает запрос на сервер, на котором находится АИСКЗ
посредством канала связи (каналом может выступать Ин-
тернет или локальная сеть). Сервер принимает запрос, и
Рис. 3. Физическая структура АИСКЗ
передает запрос АИСКЗ. Скрипты АИСКЗ обрабатывают
98 Информатика «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Рис. 4. Главная страница АИСКЗ

На схеме показано взаимодействие учеников и препо-


давателей с АИСКЗ. Ученики проходят тесты, отправляют
результаты на Web-сервер через Интернет или Интранет.
АИСКЗ записывает все результаты в базу данных АИСКЗ.
Ученики могут запросить у АИСКЗ просмотр своих ре-
зультатов. Преподаватели разрабатывают тестовые за-
дания, и помещают их в базу данных АИСКЗ. Также они
могут получить отчеты о выполненном тестировании. Рис. 5. Регистрация в системе АИСКЗ
Для создания системы мы использовали следующие
технологии:
• XHTML (англ. Extensible Hypertext Markup некоторое время на указанный адрес электронный почты
Language – расширяемый язык разметки гипертекста) должно прийти сообщение со ссылкой на регистрацию но-
для разметки текста на странице. вого пользователя. После перехода по ссылке из письма
• CSS (англ. Cascading Style Sheets – каскадные та- новый пользователь будет активирован.
блицы стилей) для описания внешнего вида системы. После выполнения регистрации можно зайти в систему
• JavaScript (скриптовый язык программирования) АИСКЗ, используя данные регистрации. После входа по-
для обеспечения в системе интерактивности и обеспе- является главная страница АИСКЗ, (см. рис. 6).
чения безопасности вводимых данных в систему. Слева находится главное меню тестирующей системы.
• PHP (англ. PHP: Hypertext Preprocessor – PHP: В нем содержится 3 пункта:
препроцессор гипертекста) для написания всей вычисли- 1. Просмотр тестов – здесь можно выбрать нужный
тельной части системы и работы с базой данных. тест и приступить к его выполнению.
• MySQL (свободно распространяемая система 2. Создание теста – этот пункт меню предназначен
управления базами данных) для хранения тестов, оценок, для создания нового теста.
журналов АИСКЗ. 3. Оценки – здесь можно узнать оценки за прой-
денные тесты.
Апробация АИСКЗ на занятиях по информатике Чтобы приступить к выполнению теста необходимо пе-
рейти на страницу «Просмотр тестов» и напротив нуж-
Разработанная нами АИСКЗ была апробирована на ного теста щелкнуть по ссылке «Начать». После прохо-
практике. Адрес АИСКЗ в Интернете – www.easytest. ждения теста результат можно посмотреть на странице
moysite.info. Главная страница АИСКЗ представлена на «Оценки» (см. рис. 7).
рис. 4. Новая АИСКЗ по информатике прошла апробацию на
Для начала работы с АИСКЗ предварительно необ- Социологическом факультете МГУ им. М.В. Ломоносова,
ходимо пройти регистрацию, перейдя по ссылке «Реги- факультете Точных наук и инновационных технологий
страция». Процесс регистрации изображен на рис. 5. МГГУ им. М.А. Шолохова и показала свою высокую эф-
Необходимо ввести логин, пароль (2 раза) и адрес элек- фективность.
тронной почты, затем нажать кнопку «Готово». Через
“Young Scientist” . #12 (35) . Vol. I . December 2011 Computer Science 99

Рис. 6. Главная страница АИСКЗ

Рис. 7. Оценки пользователя

Заключение виде текстовых файлов, они легко масштабированы и ин-


В работе представлена новая автоматизированная ин- вариантны относительно содержания. При изменении
формационная система контроля знаний удаленного до- содержательной части тестов возможно использование
ступа для использования в дистанционной форме об- АИСКЗ для проведения контроля знаний по различным
учения. Так как тестовые задания вводятся в систему в учебным дисциплинам.

Литература:

1. Официальный сайт Президента России / Интернет-ресурс http://www.kremlin.ru.


2. Стратегия развития информационного общества в Российской Федерации / «Российская газета», № 34 от 16
февраля 2008 г.
3. Огородников Е.В. Метод параллельных циклов в информационных технологиях. – М.: МГПУ, 2006, 77 С.
4. Фесенко В.В., Прончев Г.Б. Современные информационные технологии в общеобразовательной школе // Мо-
лодой ученый, 2011, №10 (33), Т.1, С. 88–92.
5. Мясникова О.В., Прончев Г.Б., Прончева Н.Г. Мультимедийный портал для организации занятий по програм-
мированию // Молодой ученый, 2010, № 6 (17), С. 345–347.
100 Химия «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

ХИМИЯ

Получение атмосферостойкого полимерного материала с магнитными свойствами


Струк Надежда Алексеевна, студент
Национальный авиационный университет Украины (г. Киев)

В статье описывается проведение работы по выбору оптимального соотношения составляющих для по-
лучения атмосферостойкого полимерного материала с магнитными свойствами. Построены кривые, отра-
жающие изменение вязкостных свойств магнитного покрытия во времени.
Ключевые слова: полиуретан, гексаферит бария, атмосферостойкость, триметилолпропан, фенилбу-
тиленгликоксысилан, намагничивание.

И спользование лакокрасочного покрытия со специ-


альными магнитными свойствами известно давно.
Главное и первоначальное его назначение – сохранение и
ляет им проникать внутрь полимерной композиции и обес-
печивает более полное связывание изоцианатных групп.
Для определения наиболее подходящего сшивающего
защита информации с помощью магнитных лент. Однако, агента и оптимальной его концентрации проводятся реоло-
магнитные материалы, которые сейчас используются, гические исследования растворов ненаполненные систем.
обладают низкими магнитными свойствами, что приводит Реологические и вязкостные свойства исследовались в
к потере информации и разрушению аппаратуры от элек- зависимости от количества сшивающего агента, который
трических разрядов, магнитных полей, телефонных разго- вводился в систему, и времени выдержки системы.
воров. Это объясняется низкой коэрцитивной силой этих Как сшивающие агенты используются фенилбутиленг-
материалов. Поэтому необходимым является получение ликоксисилан (ФБС) и триметилолпропан (ТМП).
магнитной полимерной композиции с атмосферостой- В композициях, модифицированных ТМП, вязкость во
кими свойствами. Одним из перспективных композици- времени пропорционально возрастает с увеличением со-
онных материалов является полиуретан. Как магнитный держания сшивающего агента. Оптимальное значение
порошок предлагается использование гексафериту бария. вязкости системы наблюдается при введении ТМП 30%.
Для сравнения, его коэрцитивная сила приравнивается Дальнейшее увеличение содержания ТМП приводит к
к 9000 эрстед тогда как коэрцитивная сила кобальта и уменьшению скорости образования устойчивой системы.
хрома равна до 1000 эрстед. В композициях, модифицированных ФБС, значение
Но магнитные полимерные системы такого состава вязкости во времени возрастает с увеличением содер-
еще не нашли применения, поскольку остается нере- жания сшивающего агента до 15%. При дальнейшем вве-
шенной проблема сочетания полиуретана и гексафериту дении ФБС наблюдается уменьшение вязкости системы,
бария в стойку композицию. Для решения этой проблемы что вызвано разбавлением системы низкомолекулярным
было проведено научное исследование многоатомным спиртом.
Соотношение между количеством изоцианатных и ги- Сравнивая эти два графика, видно, что лучшим сшива-
дроксильных групп является важным фактором, вли- ющего агента является ТМП, поскольку полученная ком-
яющим на свойства покрытий. При увеличении этого позиция имеет больший показатель вязкости. При вве-
соотношения твердость полиуретановых покрытий уве- дении 15 мас.% ФБС вязкость составляет 19 Пз, а при
личивается, а их эластичность уменьшается. При форми- введении 30 мас.% ТМП – 22 Пз.
ровании полиуретановых покрытий помимо основной ре- Однако эти данные не обеспечивают прогнозирование
акции – изоцианатного полиприсоединения и движения других физико-механических свойств композиции. Поэ-
уретановых связей тому для подтверждения того, что оптимальное содержание
R – NCO + HO – R’ → R – NH – C – OR’ ТМП именно 30% проводим дополнительные исследо-
|| вания ненаполненные полиуретановых композиций с раз-
O личным содержанием ТМП в качестве сшивающего агента.
могут происходить побочные процессы, что связано Из приведенных в таблице 1 данных видно, что по-
с неполным связыванием изоцианатных групп. Для ре- лимерная композиция без сшивающего агента дольше
шения этой проблемы в полимерную матрицу дополни- твердеет и имеет самые низкие значения показателей
тельно вводятся низкомолекулярные сшивающие агенты, твердости и прочности при разрыве. Полиуретановая ком-
имеющие небольшую подвижную структуру, что позво- позиция с содержанием ТМП 20 мас.% И 30 мас.% За-
“Young Scientist” . #12 (35) . Vol. I . December 2011 Chemistry 101

Рис. 1. Рост вязкости во времени для композиций, Рис. 2. Рост вязкости во времени для композиций,
модифицированных ТМП модифицированных ФБС

Таблица 1. Физико-механические свойства полиуретановых пленок


(исходной и модифицированных триметилолпропаном)

Содержание триметилолпропана, Жизнеспособность Относительная Прочность при разрыве,


мас.% композиции, час твердость МПа
0 50 0,44 65,8
5 35 0,56 62,9
10 30 0,78 68,0
20 25 0,82 72,4
30 25 0,85 75,7

твердевают быстрее, образуя устойчивую систему. Зна- лишь на 40% и образуется 30% гель-фракции. Скорость
чения показателей относительной твердости близки по преобразования низкая. Это говорит о том, что образу-
значению. Однако, по показателю прочности при разрыве, ется неустойчивая система, для затвердения которой не-
видно, что содержание ТМП 30 мас.% Обеспечивает об- обходимо много времени. В композициях с содержанием
разование более устойчивой, стабильной системы с до- 10–15% ГФБ степень превращения за изоцианатными
статочно высокими физико-механическими свойствами. группами увеличивается быстрее, чем при 5% ГФБ, од-
После проведения исследований ненаполненных по- нако достигает лишь значения 16%. Степень превра-
лиуретановых композиций необходимо определить опти- щения за гель-фракцией составляет 83%. То есть полу-
мальное содержание магнитного наполнителя – гексафе- ченная система является достаточно устойчивой, имеет
риту бария. значительно более низкий показатель времени затверде-
Спектральным методом было проведено исследование вания, однако остаточное количество изоцианатных групп
полимерных композиций с различным содержанием маг- все еще способствует прохождению побочных процессов.
нитного наполнителя. На основе полученных данных по- Композиции, содержащие 20–30% ГФБ, характери-
строен график зависимости изменения конверсии изоци- зуются полным связыванием изоцианатных групп лишь
анатных групп и процентного содержания гель-фракции за 60 минут, что сводит к минимуму возможность про-
во времени. текания побочных процессов. Степень превращения за
В полимерной композиции, в состав которой входит гель-фракции приближается к 100%. То есть полученная
5% ГФБ, наблюдается связывание изоцианатных групп композиция является устойчивой, стабильной, быстро за-
102 Химия «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Рис. 3. Динамика уменьшения изоцианатных групп и накопления гель-фракции во времени в полимерных


магнитных композициях: 1, 1 ‘ – 20–30% ГФБ, 2, 2’ – 10–15% ГФБ, 3, 3 ‘ – 5% ГФБ

твердевает и сохраняет свои качества в течение длитель- сводит к минимуму возможность протекания побочных
ного времени. Реакционная система с содержанием ГФБ процессов и позволяет получить полимерную композицию
20–30% имеет большее количество активных центров, с высоким содержанием гель-фракции.
что создает благоприятные условия для получения по- 3. Установлен оптимальный состав исходных компо-
крытия с высокой атмосферостойкостью. нентов полиуретановой композиции: 30% ТМП и 20–
1. На основе проведенных исследований установлено, 30% ГФБ. Разработанное атмосферостойкое покрытие
что оптимальным является использование как сшиваю- с магнитными свойствами обладает коэрцитивную силу
щего агента триметилолпропану. Полученная система 7500 эрстед.
обладает высокими физико-механическими свойствами. 4. Получено полиуретановую композицию с необходи-
2. Обнаружено, что введение гексафериту бария обес- мыми магнитными и эксплуатационными характеристи-
печивает полное связывание изоцианатных групп, что ками.
“Young Scientist” . #12 (35) . Vol. I . December 2011 Biology 103

БИОЛОГИЯ

Экологическая характеристика зеленой жабы при обитании


в степной зоне Предкавказья
Айрапетян Маргарита Владимировна, магистрант
Кубанский государственный университет (г. Краснодар)

Ц елью работы стало изучение возрастной и половой тысяч человек). Она наиболее подвержена отрицатель-
структур популяций зеленой жабы Bufo viridis, а ному влиянию урбанизации. На территории, примыка-
также соотношения фенотипов – полиморфизма окраски ющей к станице, находится несанкционированная свалка
спины, обитающих в трех популяциях степной зоны Пред- с бытовыми отходами. Участок соседствует с оживленной
кавказья. Было проведено исследование биотопов, в автомобильной дорогой, которая служит дополнительным
разной степенью антропогенного загрязнения. Такие ис- источником мусора.
следования в Крыловском районе проводились впервые. № 2 – поселок Ключевой (300 человек). Данный би-
Сбор материала проводился в период весны-лета-осени отоп считается слабо подверженным вредному влиянию
2011 года. Результаты сравнивались между собой, а также урбанизации. Здесь встречаются стихийные свалки бы-
с данными других исследователей из других регионов. тового мусора, в связи с низкой экологической культурой
Животные, обитающие на границе двух сред – водной населения. К участку примыкает весьма оживлённая до-
и наземной, являются удобными объектами для целей би- рога. Проживающие на территории люди могут играть
омониторинга, поскольку состояние их организма отра- роль фактора беспокойства для животных, особенно в пе-
жает состояние окружающей среды [10, с. 45]. Зеленая риод уборки урожая с сельхозугодий.
жаба, наряду с озерной лягушкой, является наиболее мас- № 3 – отделение № 6 (3 человека). Он слабо под-
совым видом бесхвостых амфибий на территории Красно- вержен влиянию антропогенных факторов, так как отно-
дарского края [4, с. 45]. Поэтому объектом изучения была сится к утраченным населенным пунктам. На территории
использована зеленая жаба, обитающая в биотопах с отделения № 6 практически нет свалок с бытовым му-
разной степенью загрязнения. Были отловлены как поло- сором, дорог и других факторов беспокойства.
возрелые, так и неполовозрелые особи на всех маршрутах. В возрастной структуре популяций зеленой жабы мы
После того, как животные вылавливались, определялась выделяли 3 возрастные группы: сеголетки, неполовоз-
длина тела, пол, возрастная группа и морфа животного. релые (с длиной тела менее 60 мм) и половозрелые (с
После этого жаб отпускали. длиной тела более 60 мм). Исследования проводились в
В популяциях зеленой жабы Bufo viridis в Западном три этапа: весной – с 14.05.11 по 24.05.11 г.; летом – с
Предкавказье отмечены следующие варианты окраски 18.06.11 по 20.08.11 г.; осенью – с 11.09.11 по 20.10.11 г.
спины животных: общий фон - светлый или темный; зе- Всего было поймано 100 особей.
леные пятна на этом фоне - отдельные, мелкие или слив- Численность особей различных возрастных групп в
шиеся. Таким образом, существуют следующие морфы: трех биотопах показана в таблице 1. Согласно критерия
1 - фон светлый, пятна отдельные; 2 - фон темный, пятна Пирсона между всеми тремя популяциями отсутствуют
отдельные; 3 - фон светлый, пятна слившиеся; 4 - фон различия в распределении особей по возрастным группам
темный, пятна слившиеся [8, с. 91]. (χ2 = 3,17; 4,15; 0,25 при χ2ст = 5,99).
Для исследования были выбраны 3 биотопа: № 1 – В наших выборках доминирующей оказалась группа
станица Новосергиевская (с населением около 2000 неполовозрелых особей, которая в трех биотопах соста-

Таблица 1. Соотношение зеленых жаб различных возрастных групп в трех биотопах

Биотоп Возрастная группа


сеголетки неполовозрелые половозрелые
№1 6 26 19
№2 3 19 5
№3 3 14 5
104 Биология «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Таблица 2. Размеры особей зеленой жабы разных возрастных групп из трех биотопов (lim, x ± mx) в мм

Возрастная группа
Биотоп
сеголетки неполовозрелые половозрелые
34 - 38 42 - 62 61 - 120
№1
36,8 ± 0,12 49,7 ± 4,25 71,0 ± 7,54
38 - 40 43 - 60 61 - 78
№2
39,3 - 0,15 52,4 ± 5,00 69,0 ± 4,18
38 - 40 43 - 58 61 - 78
№3
39,3 ± 0,10 52,4 ± 3,70 69,3 ± 3,90

Таблица 3. Соотношение самцов и самок зеленой жабы в трех биотопах

Биотоп Самцы Самки


№1 11 40
№2 8 19
№3 7 15

вила 50,9; 70,3 и 63,6 % соответственно. Таким образом, личным соотношениям самцов и самок. Причина такого
в наиболее урбанизированном биотопе неполовозрелые явления, на наш взгляд, связана с фактором беспокой-
особи составляют половину всей популяции, а в менее ур- ства со стороны людей и степенью бытового загрязнения
банизированных – две трети. биотопов. В литературе есть сведения о том, что в Цен-
Отличительная особенность динамики возрастного со- тральном Предкавказье соотношение самцов и самок зе-
става популяций – небольшое количество зеленых жаб леной жабы 3 : 1 - 2 :1 [2, с. 87]. В Крыму в степных по-
старшей возрастной группы. Количественное соотно- пуляциях самцов больше, чем самок в 4 раза, а в горной
шение различных возрастных групп определяется чи- популяции - в 1,3 раза [11, с. 240]. Только в одном иссле-
сленностью приплода и гибелью животных определенного довании, проведенном в украинских Карпатах, отмечено
возраста. Самая старшая возрастная группа – отмечена в преобладание самок над самцами в 1,5 раза [12, с. 267].
биотопе № 1, при этом количество жаб, размеры которых Соотношение фенотипов у зеленой жабы изучалось по
превышают 90 мм исчисляется единицами. Видимо, такие вариантам рисунка окраски спины [8, с. 90–91].
особи в данных популяциях погибают в большей мере. По- Известно, что полиморфизм очень широко распро-
этому популяции представлены многочисленными непо- странен в природе. Полиморфная популяция, состоящая
ловозрелыми особями для своего восстановления. По на- из множества генотипов, различающихся по своей спе-
шему мнению причинной такого явления является фактор циализации, лучше защищена от возможных колебаний
беспокойства со стороны человека. внешних условий [9, с. 132].
Длина тела особей зеленой жабы из разных биотопов Признаки окраски, хотя и описывают, но использу-
показана в таблице 2. Достоверных различий в средних ются при сравнениях популяций в меньшей степени. Рас-
размерах всех трех возрастных групп зеленой жабы, пой- пространено непроверенное мнение об их неустойчивости
манных в различных биотопах, нет. в онтогенезе и даже по сезонам. Тем не менее, известно,
Из литературы известно, что длина тела производи- что полиморфизм окраски чаще, чем изменчивость других
телей зеленой жабы колеблется в пределах 60–85 мм. признаков, зависит от малого числа генов, что делает их
Самцы становятся половозрелыми при длине тела 53–58 особенно удобными для описания генетических различий
мм, но среди самок половозрелых особей такого размера в структуре природных популяций [1, с. 52]. Стабильность
нет. Длина тела самок, впервые участвующих в размно- развития как способность организма к развитию без нару-
жении, 63–68 мм [6, с. 25–29]. Среди половозрелых со- шений и ошибок является чувствительным индикатором
отношение численности полов (самки: самцы) за весь пе- состояния природных популяций [5, с. 161].
риод активности – 0,8:1,0 [7, с. 169]. Изучение половой На всех трех маршрутах выявлены особи со всеми 4
структуры популяций зеленой жабы Bufo viridis, показало вариантами фенотипа (таблица 4). В популяциях из би-
(таблица 3), что соотношение самцов и самок в каждой из отопов №1 и №3 преобладают особи с темной окраской
популяций разное: в биотопе № 1–1 : 4; в биотопах № 2 спины, а в популяции из биотопа № 2 - особи со светлой
и № 3–1 : 2. Во всех трех популяциях преобладают самки. окраски спины. В то же время, в популяции из биотопа №
В биотопе № 1, где присутствует максимальное антро- 1 особей с отдельными и слившимися пятнами поровну, а
погенное влияние, отмечена самая низкая доля самцов. в популяциях из биотопов № 2 и № 3 преобладают особи
Разная степень антропогенных нагрузок приводит к раз- со слившимися пятнами.
“Young Scientist” . #12 (35) . Vol. I . December 2011 Biology 105

Таблица 4. Соотношение зеленых жаб различных морф в трех биотопах

Морфа
Биотоп Фон светлый, пятна Фон светлый, пятна Фон темный, пятна Фон темный, пятна
отдельные слившиеся отдельные слившиеся
№1 16 8 10 17
№2 4 15 3 5
№3 3 2 4 13

Таблица 5. Соотношение полов зеленых жаб различных морф в трех биотопах

Морфа Соотношение
Фон светлый, пятна Фон светлый, пятна Фон темный, пятна Фон темный, пятна самцов и
Биотоп
отдельные слившиеся отдельные слившиеся самок
самцы самки самцы самки самцы самки самцы самки
№1 0 16 2 6 1 9 11 6 14:37
№2 0 4 0 15 1 2 5 0 6:21
№3 0 3 0 2 2 2 4 9 6:16

ИТОГО 0 23 2 23 4 13 20 15 26:74

В целом, распределение особей с 4 разными морфами в Основная часть самцов темного фона – 84,6 %, самки
популяции из биотопа № 2 достоверно отличается от двух светлого фона – 62 %. На наш взгляд любые антропо-
других популяций (χ2 = 13,54 и 13,41 при χ2ст = 7,81). генные нагрузки приводят к изменению полового соотно-
Различий в распределении особей из популяций № 1 и № шению особей в сторону увеличения доли самок.
3 не обнаружено (χ2 = 4,84 при χ2ст = 7,81). По данным Песковой Т.Ю. [9, с. 130–146], в чистом
В рассмотренных популяциях встречаются все 4 водоеме особи всех четырех цветовых морф после раз-
морфы. В биотопах № 1 и № 3 преобладает морфа 4 (фон множения гибнут в равной степени; а в загрязненных во-
темный пятна слившиеся) 33,3 и 61,9 % соответственно, доеме животные обоих полов морф 2 и 3 гибнут сущест-
а в биотопе № 2 морфа 2 (фон светлый пятна слившиеся), венно в большей степени, чем остальные две морфы, у
во всех трех биотопах самая редка морфа 3 (фон темный самок лучше выживают особи морфы 1. Таким образом,
пятна отдельные) от 11 до 19,6 %. Но вместе с тем, темный в условиях загрязнения после истощающего жаб размно-
окрас самцов различается на разных маршрутах: № 1–55 жения более устойчивы морфы 1 и 4, а менее устойчивы
%, № 2 – 25, № 3–87 %. Проявления полиморфизма по морфы 2 и 3.
окраске спинной стороны зеленой жабы у самок наиболее В наших же исследованиях также самой устойчивой
значительны. оказалась морфа 4, а менее всего устойчива морфа 3.
В биотопе № 1 среди самок преобладают особи морфы Полиморфность популяций в большей степени выра-
1, а среди самцов - морфы 4. В этой популяции среди жена в биотопе № 1 с самым высоким уровнем урбани-
особей обоих полов редко встречается морфа 2. В попу- зации, что, по видимому, позволяет данной популяции
ляции из биотопа № 2 (пос. Ключевой) редко встреча- выжить.
ются морфы 1 и 3, максимально представлена морфа 2. По мнению Т.И. Жуковой [3, с. 103], можно достаточно
Среди самок здесь преобладают особи с морфой 2, а среди уверенно утверждать, что в тех случаях, когда совокупное
самцов с морфой 4. У жаб из самого чистого биотопа № антропогенное воздействия на популяцию животных и
3 преобладающей является морфа 4, а остальные морфы среду обитания достаточно существенны, но не вызывают
представлены практически поровну. Большинство самок её безусловного уничтожения, эти воздействия могут ста-
в биотопе № 3 имеют морфы 1 и 2, а самцы – морфу новиться главной причиной динамики популяции. Естест-
4 - таблица 5. Согласно критерию Пирсона различия во венное изменений условий существования популяции при
встречаемости самцов и самок разных морф достоверны в этом играет лишь второстепенную роль и влияние этих из-
биотопах №1 и №2 (χ2 = 19,45 и 23,14 при χ2ст = 7,81) и менений на популяцию скрывается результатами антро-
недостоверны в биотопе № 3 (χ2 = 3,00). погенных воздействий.
Таким образом, различия во встречаемости морф среди Судя по нашим данным, уровень антропогенной на-
особей разного пола отмечены во всех трех биотопах. грузки (понижающийся от биотопа № 1 к биотопу № 3)
106 Биология «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

сказывается на всех рассмотренных популяционных пока- туре популяций зеленой жабы, но не оказывает заметного
зателях - возрастной, половой и фенотипической струк- влияния на размеры особей всех возрастов.

Литература:

1. Береговой В.Е. Материалы по полиморфизму скальной ящерицы на северном Кавказе // Вопросы экологии
позвоночных животных. Волгоград, 1973. С. 52.
2. Высотин А.Г., Тертышников М.Ф. Земноводные Ставропольского края // Животный мир Предкавказья и со-
предельных территорий. Ставрополь, 1988. С. 87–121.
3. Жукова Т.И. Влияние антропогенных воздействий на численность и структуру популяций озерной лягушки //
Антропогенные воздействия на природные комплексы и экосистемы. Волгоград, 1978. С. 103.
4. Жукова Т.И. Размножение зеленой жабы в окрестностях г. Краснодара // Фауна и экология животных в усло-
виях ирригации земель. Элиста, 1990. С. 45–51.
5. Захаров В.М. Асимметрия животных. М.: Наука, 1987. с. 161.
6. Козарь Ф.В. Размножение зеленой жабы в Приднестровье. // Фауна и экология амфибий и рептилий. Крас-
нодар, 1984. С. 25–29.
7. Матковский А.В., Стариков В.П., Ляпков С.М. Особенности экологии серой жабы (Bufo bufo Linnaeus, 1758)
на северной границе ареала (Западная Сибирь, природный парк «Сибирские увалы») // Вопросы герпето-
логии. Санкт-Петербург, 2011. С. 169.
8. Пескова Т.Ю. Внутрипопуляционный полиморфизм окраски зеленой жабы // Актуальные проблемы герпето-
логии и токсинологии. Вып. 6. Тольятти, 2003. С. 90–91.
9. Пескова Т.Ю. Сезонная динамика полиморфизма окраски зеленой жабы в чистом и антропогенно загряз-
ненном биотопах Западного Предкавказья // Актуальные проблемы герпетологии и токсинологии. Вып. 9. То-
льятти, 2006. с. 130–146.
10. Пескова Т.Ю., Жукова Т.И. Использование земноводных для биоиндикации загрязнения водоёмов // Наука
Кубани. 2007. № 2. С. 45–54.
11. Щербак Н.Н. Земноводные и пресмыкающиеся Крыма. Киев, 1966. 240 c.
12. Щербак Н.Н., Щербань М.И. Земноводные и пресмыкающиеся украинских Карпат. Киев, 1980. С. 267.

R/K – инверсия клеток или концепция неоднородности жизненной стратегии


высших эукариот на клеточном уровне
Гришин Дмитрий Викторович, кандидат биологических наук, научный сотрудник
Государственный институт кровезаменителей и медицинских препаратов Минпромторга РФ (г. Москва)

В настоящей работе был сформулирован комплекс представлений о неоднородности процессов ста-


рения высших эукариот на клеточном уровне. Подобная гетерогенность выражается, прежде всего, в пе-
реходе организма, на клеточном уровне, в процессе онтогенеза, от старения летального типа, превалиру-
ющего на ранних этапах индивидуального развития, к старению витального типа, которое свойственно
уже более поздним стадиям постнатального развития. Получены данные, свидетельствующие о присут-
ствии обратной зависимости между возрастной динамикой экспрессии целого ряда митогенов и измене-
нием продолжительности пресинтетического периода жизненного цикла эукариотических клеток. Приве-
денные данные свидетельствуют в пользу того, что основой позиционируемой неоднородности процессов
старения является R/K – инверсия или перемена жизненной стратегии развития организма на молекулярно-
клеточном уровне.
Ключевые слова: летальный тип старения, витальный тип старения, продолжительность G1-фазы, ми-
тогены, правило Хейфлика, R/K-инверсия.

Современный взгляд на проблему биологического особенностей организма, возникающее с наступлением


старения зрелости и выражающееся в постепенном снижении адап-
тационных свойств организма. Подобные изменения могут
Старение как явление наблюдается практически у всех затрагивать как функцию отдельных клеток, так и целый
организмов. В самом общем смысле биологическое ста- организм, т.е. старение представляет собой совокупность
рение можно определить как изменение биологических возрастзависимых отклонений от гомеостаза на молеку-
“Young Scientist” . #12 (35) . Vol. I . December 2011 Biology 107

лярном, субклеточном, клеточно-тканевом и системном и уровень экспрессии некоторых внутриклеточных мито-


уровнях [1]. Фундаментальная наука выделяет генетиче- генов, указывают на то, что клетки, составляющие кле-
ские теории старения, когда запрограммированные на ге- точные популяции макроорганизма, последовательно
нетическом уровне «биологические часы» регулируют проходят в своём развитии этапы R- и K- стратегии.
процессы онтогенеза, нейроэндокринные теории, а также
теории накопления повреждений. Однако это разделение Стареющая клетка как структурно-функциональная
довольно условно. В настоящее время превалируют две единица стареющего организма
большие группы теорий старения: стохастические (ве-
роятностные) теории и теории программированного ста- Клеточный цикл это повторяющаяся, с определённой
рения [2]. регулярностью, совокупность событий, обеспечивающих
деление клеток. Клеточный цикл любой клетки включает
Общая характеристика динамических моделей несколько неизменных стадий: G1 – фаза – период перед
в биологии популяций синтезом ДНК или пресинтетический период, S-фаза –
период синтеза или репликации ДНК, G2-фаза – период
Важным параметром, характеризующим реальные со- между синтезом ДНК и митозом, а также завершающий
общества является ограниченность ресурсов или ем- этап – собственно, митоз [4]. Неизменные по очерёдности,
кость экологической ниши (К) – это максимально воз- эти фазы, однако, могут иметь разную продолжитель-
можная численность популяции в данных условиях. Для ность, что зависит от ряда факторов, важнейшими из ко-
популяций характерен также прирост, биотический по- торых, предположительно, являются возраст организма и
тенциал или мальтузианский параметр (r). Прирост по- тип клеток. В 1961 г. профессор стенфордского универси-
пуляции может быть положительным, нулевым и отри- тета Леонард Хейфлик, при проведении серии уникальных
цательным. При увеличении численности популяции эта опытов, получил результат, свидетельствующий о способ-
величина линейно уменьшается. В этом случае темп роста ности эукариотических клеток, даже в идеальных условиях
популяции описывается логистическим уравнением Фер- культивирования, делиться только ограниченное число
хюльста (1) [3]: раз (50±10) [5]. Было установлено также, что при пере-
севах клетки проходят in vitro ряд морфологически разли-
(1) чимых стадий, после чего их способность к пролиферации
постепенно утрачивается. Последняя фаза жизни клеток
где P – численность популяции, t – время, параметр в культуре была приравнена к клеточному старению, а
r характеризует скорость роста (размножения), а K – ём- сам феномен получил, по имени автора, название предела
кость среды. Хейфлика. Первым следствием из этого правила явля-
Исходя из названия коэффициентов, в экологии часто ется факт того, что с увеличением возраста донора клеток,
различают две стратегии поведения видов: r-стратегия число делений, на которые способны клетки организма,
предполагает бурное размножение и короткую продол- существенно уменьшается, что приводит к представлению
жительность жизни особей и К-стратегия – низкий темп о существовании некоего «счетчика» делений, ограничи-
размножения и долгую жизнь особей в популяции. Попу- вающего общее их число, при этом целесообразно отме-
ляции видов, у которых рождаемость и смертность в зна- тить, что переход клетки из одной её жизненной фазы в
чительной мере зависят от действия внешних факторов, другую определяется особыми белками-митогенами на-
подвержены быстрому изменению биотического потен- зывающимися циклинами, а также их ко-регуляторами,
циала. Эти популяции редко достигают численности К и такими как, например, ядерные рецепторы к стероидным
существуют за счет высокой плодовитости (высокое зна- гормонам вкупе с их гормональными лигандами [6]. После
чение rmax). Такой способ сохранения популяций называ- экспрессии, под влиянием стимулирующих факторов ци-
ется R-стратегия. R-Стратеги характеризуются высокой клины взаимодействуют с циклинзависимыми киназами,
плодовитостью, низкой конкурентоспособностью, бы- образуя активный холоэнзим, который призван фосфори-
стрым развитием и короткой продолжительностью жизни. лировать белки-мишени, участвующие в инициации про-
Популяции видов, у которых рождаемость и смертность в цессов, приводящих к смене фаз клеточного цикла [7, 8].
значительной мере зависят от их плотности, в меньшей Из множества циклинов, наиболее интересным, прежде
степени зависят от действия внешних факторов. Эти по- всего с точки зрения настоящей работы, является циклин
пуляции называются равновесными, или стационарными. D1, определяющий этап перехода клетки из фазы G1 к
Они поддерживают численность, близкую к величине К, S-фазе, т.е. к подготовительному этапу перед клеточным
поэтому способ сохранения таких популяций называется делением. Таким образом, на основании всего сказанного
К-стратегия. К-Стратеги характеризуются более низкой выше, можно сформулировать основную цель данной ра-
смертностью, высокой конкурентоспособностью, дли- боты как изучение зависимости продолжительности G1
тельным развитием и длительной продолжительностью периода интерфазы клеточного цикла от возраста донора
жизни. Имеющиеся биогенные показатели, такие как клеточного материала, на примере пульпарных фибро-
продолжительность отдельных стадий жизненного цикла бластов, а также изучение взаимосвязи данных процессов
108 Биология «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

с возрастными изменениями уровней экспрессии циклина ForAR–5’–AACGACTGCACCATCGACAAGTTCC-3’; RevAR – 5’


D1 и ядерных рецепторов (на примере рецепторов к ан- –GCACGGAGATGATCTCGGCCATCATCT – 3’. Режим ампли-
дрогенам – AR). фикации точный: 95°С – 3 мин; (94°С – 10с, 60°С – 30с,
72°С – 2 мин)x25 (кол-во циклов); 10°С – хранение.
ЭКСПЕРИМЕНТАЛЬНАЯ ЧАСТЬ
Получение клеточных линий фибробластов человека Количественно-конкурентный метод ПЦР

Источником фибробластов служила зубная пульпа, Метод основан на совместной амплификации матрицы
полученная из удалённых зубов людей мужского пола раз- целевой ДНК (амплификанты генов циклинов и андроге-
ного возраста [9]. Доноры клеток были сгруппированы новых рецепторов) и определённого количества внутрен-
в соответствии с возрастом на следующие группы: 15– него ДНК-стандарта (конкурента), несущего те же сайты
20, 25–40, и 55–75 лет. Ткани, извлечённые из пульпы связывания для праймеров [12, 13]. Так, как исходное со-
предварительно очищенного и раздробленного зуба в сте- держание конкурента известно, и принимая, что эффек-
рильных условиях измельчались и переносились в среду тивность амплификации целевого гена и конкурентной
M199 с 1% фетальной сывороткой (FCS), соответствую- ДНК одинакова, соотношение количества двух продуктов
щими антибиотиками и 1 мг/мл бычьего сывороточного ПЦР, определяемое электрофоретически при помощи
альбумина. Ткани пульпы обрабатывались коллагеназой компьютерной программы DNA Gel Analysis Software
и ДНКазой в течение одного часа при 36°С. Действие (Helicon), представляет собой соотношение целевой ДНК
ферментов прерывалось посредством добавления охла- и ДНК конкурента в пробе до амплификации. Конку-
ждённой среды Игла МЕМ с солями Эрла, с глутамином рентом является синтетическая последовательность це-
(ПанЭко, Россия) в 1% FCS с соответствующими анти- левых генов с запланированной центральной делецией
биотиками. После отмывки, суспензия пульпарных клеток для того, чтобы в ходе ко-амплификации получить фраг-
центрифугировалась в течение 5 мин. при 4000 об/мин, менты, отличающиеся по молекулярному весу на электро-
после чего осадок ресуспендировался в том же объёме фореграмме.
среды Игла МЕМ с 5% FCS, переносился в стерильные
плашки и инкубировался при 37°С в атмосфере 5% CO2 Статистическая обработка результатов исследования.
для миграции клеток из эксплантатов [10]. После дости-
жения первичной культурой состояния монослоя, она об- Культуры клеток пульпарных фибробластов полу-
рабатывалась трипсином (0,02%) в течение 10–15 мин, чались от репрезентативной выборки представителей
после чего трипсин удалялся, и клетки вновь суспендиро- разных возрастных групп (мужчины в возрасте 15–20
вались в той же среде. Затем проводился рассев в новые лет, 25–40 лет, 55–75 лет) по принципу, описанному в
флаконы, в итоге получали клеточную культуру, готовую материалах и методах. Клетки культивировались в по-
для дальнейшего субкультивирования. Субкультивиро- вторах, для последующего изучения экспрессии генов с
вание производилось до достижения клетками 70% от мо- периодичностью каждые два часа. Статистическая об-
нослоя в среде Эрла с глутамином и добавлением 10 % работка результатов исследований проводилась при по-
фетальной сыворотки, помимо этого, для имитации есте- мощи программы Statistic 5.773, методом вариационной
ственного гормонального фона организма, в качестве статистики, включая вычисление средних величин (М) и
основного лиганда андрогеновых рецепторов, в среду до- стандартных ошибок средних величин (±m). Для оценки
бавлялись 0,1–0,2 мкМ тестостерона. достоверности различий средних величин применяли кри-
терий Стьюдента td [14]. Достоверной считали значимость
Проведение полимеразной цепной реакции (ПЦР), p≤0,05.
сопряженной с обратной транскрипцией.
РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ
Изучение экспрессии целевых митогенов прово-
дилось косвенно, на основании данных об уровне эк- В процессе анализа литературных данных была выд-
спрессии их мРНК. Суммарную РНК выделяли с ис- винута гипотеза, заключающаяся в том, что одним из ос-
пользованием реактива «TRIZOL» (Life Technologies, новных условий увеличения продолжительности жиз-
Inc.) согласно рекомендациям производителя, базирую- ненного цикла клеток эукариот по мере взросления
щимся на стандартной методике [11]. Синтезированная макроорганизма, является увеличение пресинтетиче-
кДНК использовалась для амплификации методом ПЦР ского периода их интерфазы. Известно, что основными
со специфическими праймерами. Для амплификации гена физиологическими факторами, определяющими и уско-
циклинаD1 были спланированы праймеры For-СD1–5’– ряющими процесс перехода клетки из фазы G1 в фазу
ATGGAGCACCAGCTGCTGTGCTGCGA – 3’; Rev-CD1 5’– GAT- S являются митогены белковой природы, к основным из
GTCCACGTCCCGCACGTCGGTG – 3’; для амплификации гена которых можно отнести циклин D1 [15], экспрессирую-
AR были спланированы праймеры, комплементарные щийся в первой половине G1 фазы под влиянием ядерных
к наиболее константным областям обеих изоформ АR: рецепторов и их гормональных лигандов. При этом кон-
“Young Scientist” . #12 (35) . Vol. I . December 2011 Biology 109

Рис. 1. a.) – Динамика экспрессии мРНК циклина D1 и рецепторов к андрогенам пульпарных фибробластов,
полученных от доноров разных возрастных групп (за 100% уровень экспрессии белка принимается максимум
экспрессии соответствующего белка у молодых особей). b.) – Общий вид зависимости продолжительности G1 –
периода интерфазы от возраста донора клеточного материала.

центрация циклина, обычно, достигает своего максимума норов разного возраста, позволило оценить его динамику
к середине G1 периода и снижается до минимума к началу на протяжении интерфазы, при этом, благодаря циклич-
S периода. Таким образом, циклин D1 вполне мог рассма- ности экспрессии митогена, пресинтетический и синтети-
триваться в качестве некоего маркера смены периодов ческий периоды были хорошо дифференцируемы.
жизненного цикла клеток. Производилось выделение то- Результаты данных исследований свидетельство-
тальной клеточной РНК для проведения ОТ-ПЦР и коли- вали в пользу предположения о возрастопосредованной
чественно-конкуррентной ПЦР. Определение количества обратной зависимости между динамикой экспрессии ци-
ПЦР продукта проводилось при помощи программы DNA клина D1 и рецепторов к андрогенам и продолжительно-
Gel Analysis Software (Helicon). стью G1-периода клеточного цикла эукариот (рис 1.a.,b.).
В процессе работы было сделано предположение, что Настоящее исследование показывает также, на примере
внутриклеточная концентрация данных митогенов и их ко- АR, что в разные возрастные периоды одинаковый гормо-
регуляторов не стабильна не только в течение жизнен- нальный фон оказывает различное влияние на длитель-
ного цикла клетки, но и на протяжении жизни организма ность интерфазы однотипных клеток, что обусловлено
в целом. Для проверки данной гипотезы были получены прежде всего разным уровнем экспрессии соответству-
культуры клеток фибробластов от репрезентативной вы- ющих рецепторов и разной степенью чувствительности
борки мужчин разных возрастных групп по принципу, опи- клеток одного и того же типа к гормональным лигандам.
санному в материалах и методах. Так как науке известны
факты стимулирующего влияния ядерных рецепторов на R/K – инверсия клеток эукариот как основа
биосинтез циклинов [16], то в полученных клетках также онтогенетического перехода организма
определялся и уровень экспрессии мРНК рецепторов к от летального типа старения к витальному
андрогенам, для ориентировочной оценки корреляции их
количественного изменения с динамикой возрастных из- Анализ литературы и полученные теоретические и на-
менений уровня экспрессии циклина D1 и продолжитель- учно-практические данные, касающиеся зависимости
ности G1-периода. Для повышения точности определения продолжительности интерфазы от уровня экспрессии ми-
в пробы вводили ДНК-конкурент, представлявший собой тогенов, свидетельствуют, что в процессе индивидуаль-
синтетические гены циклина и рецепторов к андрогенам, с ного развития клетки многоклеточного организма в со-
индуцированной центральной делецией для последующего ответствующих клеточных популяциях, в определённый
различения амплификантов гель-электрофоретически момент времени, в целях «самосохранения», вступают
(синтез делетированных генов производился в ЗАО Ев- на путь перемены собственной жизненной стратегии, что
роген, Россия). Соотношение количества ПЦР-продукта и выражается в увеличении времени между последующими
его конкурента эквивалентно соотношению целевой ДНК митотическими делениями, по мере взросления орга-
и конкурента в пробе до амплификации. При этом за 100% низма, за счёт постепенного роста продолжительности G1
уровень экспрессии изучаемых митогенов принималась периода интерфазы клеток (рис. 1.b.), чему сопутствует и,
наибольшая их концентрация у молодых доноров в на- вероятно, способствует возрастное снижение уровня эк-
чальный период культивирования клеток (рис. 1.a.). спрессии таких митогенов и корегуляторов как циклин
Определение референсных пределов уровней эк- D1 и ядерные рецепторы (рис. 1.a.). В настоящей статье
спрессии мРНК циклина D1 в клетках, полученных от до- эти данные являются опорной точкой для формирования
110 Биология «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

представлений о том, что законы описывающие динамику усталости» клеток с увеличенной интерфазой. Кроме того
популяций организмов, могут быть применены и для опи- ярким фенотипическим проявлением активации подобной
сания динамики развития популяций клеток в процессе стратегии является общеизвестное накопление в клетках
онтогенеза отдельно взятого организма. Мы полагаем, избыточного количества различного рода включений (ме-
что в процессе индивидуального развития, клетки высших ланин, липофусцин и др.), вовлечённых в противодей-
эукариот претерпевают постепенную молекулярно-ге- ствие окислительному стрессу. Аналогия с динамикой
нетическую инверсию своих жизненных принципов, что популяций макроорганизмов позволяет, для описания ди-
выражается в смене так называемой «R» – стратегии су- намики жизненного цикла клеточных популяций, приме-
ществования на «К» – стратегию. Для большей ясности нить модифицированное логистическое уравнение, разра-
тут необходимо отметить, что под «R» – стратегией, при- ботанное бельгийским математиком Ферхюльстом (2) [3]:
менительно к клеткам, мы понимаем стратегию расточи-
тельства, характерную для ранних этапов онтогенеза ин-
(2)
дивидуума, заключающуюся в коротком жизненном цикле
клеток, преимущественно за счёт сокращённого G1 – пе-
риода их интерфазы, что проявляется в интенсивном об- Как видно, уравнение (2) представляет собой диффе-
новлении клеточных поколений. Подобная стратегия ренциальное уравнение первого рода с разделяющимися
превалирует у молодых форм, обеспечивая собственно переменными. Произведя ряд соответствующих преобра-
фенотипическое проявление молодости как таковой, вы- зований выражения (2) можно найти интервал времени
ражающееся в слаженности работы всех органов и си- ∆t, за который клетки-представители однородной ткани
стем и в высокой регенеративной способности тканей. многоклеточного организма достигнут предельных зна-
Однако длительное поддержание стратегии «молодости» чений G1-периода в ходе онтогенеза (3):
чрезвычайно не выгодно клеткам любого живого суще-
ства, так как оно требует постоянной высокой метаболи-
(3)
ческой напряженности, которая истощает как отдельные
клетки, так и организм в целом, подталкивая его на путь
скорого (летального) старения. В качестве примера R – коэффициент, отражающий скорость, с которой
данных слов можно привести негативное влияние «R»- фаза G1 достигает своих максимальных значений; –
клеточной стратегии на продолжительность жизни мигра- продолжительность G1-периода интерфазы на начальных
ционных рыб семейства лососевых (Salmonidae) [17]. И этапах онтогенеза; – продолжительность пресинтети-
именно для противодействия подобным негативным мо- ческого периода на конечных этапах онтогенеза; ∆t – ин-
ментам, по нашему мнению, в клетках многих высокоор- тервал времени; К – асимптотическое значение g (то есть,
ганизованных эукариот, эволюционно, на генотипическом видовой физиологический предел величины пресинтети-
и, вероятно, также на эпигенетическом уровне, начал вы- ческого периода).
рабатываться единый механизм «демпфинга» прогрессии Решением уравнения (3) является график, который в
клеточного цикла, позволяющий подавляющему боль- идеализированном виде представляет собой стандартную
шинству клеток, на определённом этапе постэмбриональ- S-образную кривую, угол наклона которой определяется
ного развития, перестраиваться с расточительной «R» – величиной коэффициента «R» (4) (рис. 2.).
стратегии существования на умеренную «К» – стратегию.
В чём же, спрашивается, преимущество «К» – стратегии (4)

над «R» – клеточной стратегией? Преимущество сво- Физиологический смысл уравнения (3) сводится к тому,
дится к снижению скорости размножения и увеличению что по мере роста параметра «R», т.е. скорости дости-
степени выживаемости клеток в режиме щадящего (ви- жения фазой G1 своих максимальных значений, морфо-
тального) старения, которое обеспечивается снижением логически однородные клетки организма быстрее при-
напряженности обменных процессов и увеличении про- ближаются к пределу Хейфлика. Таким образом, высокие
должительности интерфазы клеточного цикла, преиму- значения коэффициента «R» являются условиями, опре-
щественно за счёт уменьшения уровня экспрессии мито- деляющими «R» – стратегию существования клеток эу-
генов и корегуляторов, что, в итоге, приводит к редукции кариот (рис. 2.).
частоты смены клеточных поколений (следует отметить,
что частота смены клеточных поколений в разных тканях ЗАКЛЮЧЕНИЕ И ВЫВОДЫ
имеет свои особенности, однако мы говорим о тенденции,
которая имеет общую направленность для всех клеток ор- Полученные теоретические и научно-практиче-
ганизма). «К» – стратегия превалирует у возрастных ор- ские результаты свидетельствуют о том, что с увели-
ганизмов, обеспечивая, собственно, фенотипические про- чением возраста донора клеток увеличивается время
явления старости, выражающиеся в падении слаженности между последующими клеточными делениями, за счёт
работы органов и систем, снижении регенеративной спо- более продолжительного пребывания клеток в G1 пе-
собности тканей, прежде всего ввиду «физиологической риоде интерфазы, вследствие возрастного снижения
“Young Scientist” . #12 (35) . Vol. I . December 2011 Biology 111

Рис. 2. Семейство идеализированных S-образных кривых, характеризующих динамику жизненного цикла


клеток в составе организма (Δt – интервал времени (из формулы 3), за который большинство морфологически
однородных клеток организма увеличивают свой G1-период до максимальных значений; график 1 характерен
для клеток с R-стратегией, в то время как кривая 3 типична для клеток с К-стратегией)

уровня экспрессии митогенов, приводящего, фактически, такие, например, как некоторые пресмыкающиеся и че-
к возрастному повышению порога чувствительности ловек. В данной работе была сформулирована концепция
клеток-мишеней к регулирующим сигналам. Иными сло- R/K инверсионного сопротивления клеток эукариот ста-
вами, идентичные по своему тканевому происхождению рению летального типа. В соответствии с этой концеп-
клетки старых и молодых организмов одного и того же цией, у организмов с летальным старением преобладает
вида, имеют различную продолжительность жизненного расточительная стратегия R-типа с быстрой сменой по-
цикла, преимущественно за счёт разного времени их пре- колений клеток и быстрым исчерпанием жизненного по-
бывания в пресинтетическом периоде интерфазы. Нами тенциала, в то время как клетки эукариот с витальным
были введены понятия летального и витального типов типом старения осуществляют в процессе онтогенеза обя-
старения, в соответствие с чем эукариоты могут быть раз- зательный инверсионный переход от R-жизненной стра-
делены на две большие группы: жизненные формы с пре- тегии к К-стратегии, проявляющейся возрастзависимым
валирующим летальным (скоротечным) типом старения, снижением уровня экспрессии внутриклеточных мито-
например многие насекомые и проходные рыбы, а также генов, медленной сменой клеточных поколений и сбере-
существа с витальным (медленным) типом старения, жением жизненных ресурсов.

Литература:

1. Москалёв А.А.// Успехи геронтол. 2010. Т. 23. № 1. С. 9–20.


2. Schulz-Aellen M.-F. Aging and human longevity. Boston: Birkhauser, 1997. 283 p.
3. Базыкин А.Д. Нелинейная динамика взаимодействующих популяций. ИКИ, 2003.
4. De Souza C.C. and Osmani S.A. // Eukaryotic Cell. 2007. 6 (9):1521–1527.
5. Hayflick L. // Experimental Cell Research. 1965. V.37. P. 614–636.
6. Klein E.A., Assoian R.K. // Journal of Cell Science. 2008. V.121. C. 3853–3857.
7. Musgrove E.A., Lee C.L., Buckley M.F., Sutherland R.L. // Cell Biology. 1994. V. 91. P. 8022–8026.
8. Shankung Lin, Huey-Chung Huang // Mol Pharmacol. 2001. V.60. P. 768–775.
9. Tran-Hung L., About I. // European Cells and Materials. 2007. V.13. P.4.
10. Kasinathan P., Knott J.G., Moreira P.N. // Biology of Reproduction. 2001. V.64. P. 1487–1493.
11. Chomczynski P. & Sacchi N. // Nature Prot., 2006. V.1. P. 581–585.
12. Studer. E. // Z. Lebensm. Unters. Forsch. 1998. V. 207. P. 207–213.
13. Hardegger. M. // Eur. Food Res Technol. 1999. V. 209. P. 83–87.
14. Куликов Л.В., Никишов А.А., Математическое обеспечение эксперимента. M.: – Издат. РУДН, 1994.
15. Resnitzky D., Reed S.I., // Mol. Cell. Biol. 1995. 15 (7): 3463–3469.
16. Dongho Geum, Woong Sun. //Mol. Reproduction and Development. 1997. V.46. P.450–458.
17. Maldonado T.A., Jones R.E., Norris D.O. // J. Neurobiol. 2002. V.53. P.21–35.
112 Биология «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Сравнительный анализ структуры и производительности древостоев,


сформировавшихся из подроста
Дебков Никита Михайлович, ассистент
Томский государственный университет

Введение рекомендованных для использования в практической ле-


сохозяйственной деятельности [7].
Вопрос о сохранении подроста и тонкомера при лесораз-
работках имеет давнюю историю и уходит своими корнями Результаты и их обсуждение
к временам Петра Великого, который, передав огромные
площади лесов заводам Демидовых, предписал вести сле- Рассматривая высотную структуру темнохвойно-ке-
дующее хозяйство в них: «леса заводские велено разделить
дровых элементов насаждений мелкотравно-зелено-
на участки; по вырубке лесосек оставлять их под поросль,
мошного типа леса, можно констатировать тот факт, что
при этом наблюдать за молодняком и особенно предохра- средние высоты этих насаждений больше таковых по
нять их от огня» [1, с. 56]. Впоследствии несколько поко-
ТХР. Причем в среднем для ели превышение составляет
лений лесоводов России исследовали эту проблему (до- 10%, пихты – 16% и кедра – 47%. Что касается лист-
статочно подробная хронология этого описана в [2]). На венных пород, то четкой закономерности не наблюдается,
сегодняшний день общепринятым положением считается и в среднем разницы практически нет. В отношении тол-
значительное сокращение сроков поспевания древостоев щины древостоев ситуация несколько иная и динамика по
[3, 4]. Что касается исследования качества и производи-породам различная: для ели разницы нет, для пихты есть
тельности, в том числе сравнительного анализа с естест-тенденция некоторого снижения толщины по сравнению
венными насаждениями, то таких работ немного. с табличными показателями – на 11%, а для кедра на-
оборот просматривается устойчивая тенденция превы-
Объекты и методика шения толщины (на 75%). У лиственных пород опять же
существенных различий с ТХР не прослеживается. Также
В связи с этим нами были проведены лесотаксаци- не просматривается различий в сумме площадей сечения
онные работы в насаждениях, сформировавшихся из со- и густоты древостоев с нормативными показателями.
храненного подроста на вырубках 35–50-летней давности Похожая ситуация наблюдается в зеленомошном типе
в пределах южной тайги Томской области. В 1969–1971 леса, где показатели темнохвойных пород по высоте выше
годах на территории Калтайского лесничества разрабаты- табличных у пихты на 36%, ели – 19% и кедра – 41%. У
вались насаждения зеленомошных и разнотравных типов березы также в среднем на 12% выше высоты древостоев
леса примерного состава 4П2Е1К2Б1Ос с запасами 260– по сравнению с ТХР. Средний диаметр елового, пихтового
380 м3/га по традиционной технологии узкопасечным ме- и березового элементов леса исследуемых насаждений не
тодом (ручная валка бензопилой и трелевка трактором имеет различий с табличными значениями. А вот по кедру
ТДТ-40 с чокерной оснасткой) с целью сбережения под- по-прежнему существует значительное превышение на
пологового возобновления составом 7П2Е1К+Б. 84%. Что касается суммы площадей сечения, то разницы
В основу исследований положен метод пробных пло- нет, а вот густота ниже нормативной в среднем на 25%.
щадей (ПП). В общей сложности заложена 21 ПП в пяти Интересная картина наблюдается в папоротниковом
наиболее распространенных типах леса (мелкотравно-зе- типе леса, где нет различий в высотах и по темнохвойным,
леномошный, зеленомошный, папоротниковый, травяно- и по лиственным элементам леса. Заниженные показа-
болотный, разнотравный), где произведены соответст- тели по диаметру характерны для пихты (-17%) и березы
вующие таксационные работы [5]. В том числе методом (-9%). Аналогичная ситуация наблюдается в отношении
пропорционально-ступенчатого представительства от- густоты (-10%) и суммы площадей сечения (-23%).
бирались модельные деревья в количестве 22–38 штук В травяно-болотном типе леса высоты темнохвойно-
на пробную площадь, зависевшего от состава древостоя. кедрового элемента леса значительно превышают пока-
Всего было спилено и обмерено по стандартной методике затели ТХР: для ели на 22%, пихты – 32% и кедра –57%.
617 модельных деревьев ели, пихты, кедра, осины и бе- По березе различий нет. Диаметр по всем породам, за
резы [6]. Объем ствола определялся по сложной формуле исключением кедра, также соответствует табличным зна-
срединных сечений. чениям. У кедра же стабильное завышение в среднем на
Сравнительный анализ производительности и других 130%. Что касается суммы площадей сечения и густоты,
таксационных показателей изучаемых древостоев (та- то они тоже существенно ниже нормативных показателей
блица 1, рисунок 1) проведен по общим таблицам хода (15 и 34% соответственно).
роста полных (нормальных) древостоев (ТХР), одо- В разнотравном типе леса однозначно видимой зако-
бренных Федеральным агентством лесного хозяйства и номерности не просматривается, однако, в целом показа-
“Young Scientist” . #12 (35) . Vol. I . December 2011 Biology 113

Таблица 1. Лесотаксационная характеристика насаждений,


сформировавшихся из предварительного возобновления

Сумма площадей
Давность рубки, лет

Высота, м Диаметр, см Густота, шт/га

Класс бонитета
сечения, м2/га

Возраст, лет
Номер ПП

Наши данные

Наши данные

Наши данные

Наши данные
Состав

Разница, %

Разница, %

Разница, %

Разница, %
ТХР

ТХР

ТХР

ТХР
МЕЛКОТРАВНО-ЗЕЛЕНОМОШНЫЙ ТИП ЛЕСА (МЗМ)
36П 18,5 17,2 +8 18,9 22,0 -14 78
15Е 19,9 18,6 +7 20,7 21,0 – 1 86
8К 15,6 10,9 +43 15,8 11,1 +42 59
1 45 32,7 32,1 +2 1294 983 +32 II.9
37Ос 18,6 17,0 +9 14,6 19,0 – 23 42
+С, 24,7 – – 42,4 – – –
Б 19,0 – – 14,5 – – –
44Е 15,3 12,9 +19 17,5 18,4 -5 74
21К 13,8 10,1 +37 16,9 9,8 +72 71
7 39 21П 18,2 16,6 +10 18,3 21,1 – 13 75 31,6 26,9 +17 1296 1486 -13 III.6
12Б 13,7 13,5 +1 10,8 11,7 – 8 32
+С 21,3 – – 23,7 – – –
28П 12,8 11,4 +12 10,9 14,5 -25 53
20Е 15,3 14,2 +8 15,9 15,6 +2 64
13К 11,8 7,8 +51 11,9 6,7 +78 44
11 45 24,9 25,3 -2 1736 1453 +19 III.4
38Б 16,7 17,3 – 3 12,5 16,3 – 23 45
ед.С, 15,3 – – 23,1 – – –
Лц 8,7 – – 6,4 – – –
21П 14,7 11,9 +23 12,0 15,1 -20 55
14Е 16,6 15,5 +7 16,1 16,2 – 1 56
7К 13,8 9,1 +52 13,2 8,4 +57 50
12 42 27,8 27,5 +1 1335 1115 +20 III.0
41Б 20,6 18,9 +9 21,3 19,2 +11 74
15Ос 18,7 20,1 – 7 13,3 27,2 – 51 33
+С 21,7 – – 24,3 – – –
41Е 15,7 14,9 +5 18,2 16,4 +11 67
23С 20,3 18,8 +8 24,8 21,5 +15 81
10П 19,6 19,9 – 1 22,4 24,8 – 10 73
15 37 18Б 14,9 15,5 – 4 13,9 14,0 – 1 38 25,4 31,5 -19 887 1296 -32 III.1
+К, 10,9 – – 13,2 – – 42
Ос 19,0 – – 18,2 – – –
ед.Лц 12,2 – – 7,8 – – –
63К 14,3 9,5 +50 16,8 9,0 +87 52
22П 13,7 10,9 +26 14,7 14,5 +1 64
21 47 24,8 23,9 +4 961 1470 -35 III.6
8Е 16,8 16,2 +4 18,2 18,9 – 4 96
7Б 18,9 17,1 +10 20,9 16,0 +31 44
37Е 11,2 9,4 +19 10,8 10,7 +1 56
19П 11,2 8,2 +37 10,4 10,3 +1 41
23 38 12К 9,5 6,4 +48 10,4 4,9 +112 37 20,4 20,1 +1 1985 2464 -19 III.7
32Б 12,6 12,5 +1 10,6 10,6 0 29
ед.С 10,7 – – 17,3 – – –
ЗЕЛЕНОМОШНЫЙ ТИП ЛЕСА (ЗМ)
44П 14,4 11,4 +26 13,5 15,0 -10 66
21Е 14,0 11,2 +25 14,2 12,8 +11 65
4 38 20,9 23,7 -12 1387 1898 -27 III.6
19К 11,2 7,6 +47 12,4 6,4 +94 43
16Б 14,0 11,8 +19 10,0 9,8 +2 27
41К 13,5 10,7 +26 17,4 10,8 +61 58
25Е 13,4 11,4 +17 12,3 13,1 – 7 66
28Б 15,9 14,3 +11 14,7 13,7 +7 47
10 36 +С, 19,8 – – 28,1 – – – 23,6 23,7 0 1126 1638 -31 III.8
Лц 14,6 – – 15,7 – – –
ед.П, 15,7 – – 14,8 – – –
Ос 16,4 – – 16,0 – – –
114 Биология «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Таблица 1. Лесотаксационная характеристика насаждений,


сформировавшихся из предварительного возобновления (окончание)

38Е 13,2 11,6 +14 14,0 13,3 +5 67


36П 11,3 7,7 +47 11,9 10,2 +17 49
16 40 26,4 22,3 +18 1889 2255 -16 III.9
12К 10,2 6,8 +50 10,6 5,4 +96 39
14Б 14,2 13,5 +5 11,5 11,7 – 2 32
ПАПОРОТНИКОВЫЙ ТИП ЛЕСА (ПТ)
23П 16,6 16,2 +2 16,8 20,6 -18 73
20Е 21,2 20,9 +1 21,2 26,8 – 21 100
2 49 21,2 30,9 -31 737 887 -17 II.4
54Б 20,4 20,9 –2 18,0 19,4 – 7 44
+К 16,7 – – 22,5 – – –
27П 18,5 18,7 -1 18,4 23,9 -23 86
18Е 19,8 18,0 +10 20,6 21,3 – 3 111
18 49 25,5 30,8 -17 867 898 -3 II.5
8К 17,0 – – 24,3 – – –
47Б 21,2 20,7 +2 16,8 19,0 – 12 43
48П 20,3 18,5 +10 21,2 23,6 -10 85
18Е 23,1 21,6 +7 27,8 23,9 +16 81
22 48 27,1 34,5 -21 818 911 -10 II.3
33Б 20,1 20,2 0 16,7 18,3 – 9 41
ед.К 18,9 – – 21,2 – – –
ТРАВЯНО-БОЛОТНЫЙ ТИП ЛЕСА (ТБ)
56Е 16,3 17,0 -4 18,0 18,9 -5 77
23П 14,9 12,7 +17 16,9 16,8 +1 73
5 42 9К 11,1 7,8 +42 14,0 6,7 +109 44 19,9 31,9 -38 785 1357 -42 III.9
6Лц 25,8 – – 48,0 – – –
6Б 12,6 12,5 +1 10,7 10,6 +1 29
35Е 10,8 7,9 +37 10,8 9,1 +19 49
54Б 15,2 14,8 +3 12,1 14,2 – 15 49
6 38 +П, 9,2 – – 10,0 – – 48 18,4 20,2 -9 1461 2033 -28 IV.0
К, 11,9 – – 11,6 – – 56
Лц 17,1 – – 22,0 – – –
47Е 12,6 10,6 +19 11,9 12,2 -2 62
11Лц 19,7 – – 24,0 – – –
8 39 7К 10,3 5,9 +75 10,7 4,4 +143 46 19,7 21,0 -6 1558 2133 -27 III.7
31Б 13,4 12,5 +7 11,0 10,6 +4 29
+П 11,4 – – 10,1 – – 54
44Е 11,1 8,1 +37 11,3 9,3 +21 50
12К 9,9 6,4 +55 11,6 4,9 +137 37
14 38 8П 9,1 7,0 +30 9,5 9,3 +2 46 17,9 19,2 -7 1540 2623 -41 III.7
7Лц 19,6 – – 15,8 – – –
29Б 13,6 13,5 +1 11,2 11,7 – 4 32
РАЗНОТРАВНЫЙ ТИП ЛЕСА (РТР)
60Е 15,4 13,8 +12 15,9 15,0 +6 62
11П 14,2 11,9 +19 15,9 14,4 +10 44
26Б 17,2 17,3 –1 12,1 16,3 – 26 45
9 38 18,6 28,7 -35 814 1603 -49 III.2
+К, 9,7 – – 15,8 – – 42
ед.Лц, 16,4 – – 17,1 – – –
С 13,6 – – 12,8 – – –
38Е 14,8 14,7 +1 16,4 16,1 +2 66
35Лц 27,4 – – 48,5 – – –
13 39 8К 16,6 – – 21,4 – – – 30,8 28,3 +9 1041 1649 -37 III.5
18Б 14,2 13,9 +2 12,5 12,1 +3 33
+П 16,4 – – 19,5 – – –
20П 14,1 12,3 +15 13,2 16,3 -19 71
19Е 15,5 15,8 –2 13,4 17,2 – 22 70
19 48 7К 16,5 – – 23,5 – – – 22,8 27,3 -16 1093 1208 -9 II.8
41Б 18,6 16,8 +11 15,8 15,7 +1 43
13Ос 20,4 20,1 +1 17,3 24,4 – 29 41
72Е 16,8 14,8 +13 19,6 17,2 +14 86
10К 12,3 8,0 +54 13,6 7,4 +84 35
24 37 15Б 13,6 12,5 +9 11,2 10,6 +6 29 21,3 27,4 -22 975 1452 -33 III.8
+П 8,0 – – 13,3 – – 32
ед.Лц 8,5 – – 6,7 – – –
“Young Scientist” . #12 (35) . Vol. I . December 2011 Biology 115

400
Запас, куб. м/га

300
200
100
0
1 7 11 12 15 21 23 4 10 16 2 18 22 5 6 8 14 9 13 19 24

МЗМ ЗМ ПТ ТБ РТР

Номера ПП и типы леса

Наши данные ТХР

Рис. 1. Динамика производительности древостоев, сформировавшихся из предварительного возобновления

тели по высотам и диаметрам совпадают в среднем с та- леса обусловлены существенно более высокими сред-
бличными значениями. А вот сумма площадей сечения и ними высотами и, отчасти диаметрами (у кедра), при ра-
густота существенно отличается от таковых по ТХР и сов- венстве остальных показателей. Несколько иная картина
падает с динамикой травяно-болотного типа леса (-16% и в зеленомошном типе леса, где также средние высоты
-34% соответственно). всех пород выше табличных значений. Однако диаметры
При рассмотрении динамики запасов древостоев по и сумма площадей сечения равны нормативным показа-
типам леса также были выявлены существенные расхо- телям, но снижена густота, что впрочем, не влияет на про-
ждения с данными по ТХР. Для зеленомошной группы изводительность, поскольку связь между густотой и за-
типов леса: мелкотравно-зеленомошного и зеленомош- пасом отрицательная средней тесноты (-0,68).
ного типа леса, характерно превышение показателя про- В разнотравной группе типов леса (разнотравный и
изводительности исследуемых насаждений в среднем на папоротниковый тип леса) в силу сниженных высот, ди-
15 и 24% соответственно. Противоположная тенденция аметров, густот и сумм площадей сечения наблюдается
складывается в травянистой группе типов леса: папо- пониженная производительность относительно данных
ротниковом и разнотравном типах леса, где наблюда- по ТХР. Для этих насаждений характерна тесная поло-
ется уменьшение запасов древостоя по сравнению с нор- жительная связь между густотой, суммой площадей се-
мативными значениями на 16% и 14% соответственно. чения и запасами древесины, т.е. чем гуще древостой,
Что касается травяно-болотного типа леса, то четкой за- тем больше сумма площадей сечения и соответственно
кономерности не прослеживается, однако большая часть выше производительность насаждения. С одной стороны
насаждений имеет более высокий показатель производи- в этих типах леса темнохвойные породы испытывают
тельности (на 18%). жесткую конкуренцию со стороны лиственных пород, а
Для упрощения понимания зависимости производи- с другой практически не происходит пополнения древе-
тельности древостоев от различных факторов были рас- сного яруса. Обусловлено это тем, что достаточно мед-
считаны коэффициенты корреляции для основных показа- ленно протекают лесовосстановительные процессы под
телей, оказывающих ключевое влияние на формирование пологом леса.
запаса древостоев (таблица 2). В отношении насаждений травяно-болотного типа леса
В результате видно, что завышенные показателей складывается аналогичная закономерность, как в мелко-
производительности в мелкотравно-зеленомошном типе травно-зеленомошном типе леса.

Таблица 2. Корреляция между основными таксационными показателями древостоев,


сформировавшихся из предварительного возобновления

Тип леса Связь между густотой и суммой Связь между густотой Связь между запасом и суммой
площадей сечения и запасом площадей сечения
Мелкотравно- -0,39 -0,45 +0,82
зеленомошный
Зеленомошный +0,66 -0,68 +0,10
Папоротниковый +0,80 +0,79 +1,0
Травяно-болотный -0,59 -0,90 +0,68
Разнотравный +0,62 +0,60 +0,98
116 Биология «Молодой учёный» . № 12 (35) . Том I . Декабрь, 2011 г.

Вывод сильной конкуренцией. Отдельно надо отметить, что


как высота, так и диаметр кедрового элемента леса су-
Таким образом, на вырубках 35–50-летней давности щественно превышает показатели таблиц хода роста
в пределах южной тайги Томской области формируются нормальных (полных) древостоев. Необходимо отме-
темнохвойные насаждения из подроста, которые имеют тить, что лиственные элементы леса по ходу роста пра-
структуру и производительность отличную от ТХР. Такая ктически не имеют отличий от нормативных значений. В
детерминация обусловлена в большей степени типоло- целом для насаждений из подроста всех типов леса от-
гической принадлежностью. При этом для темнохвойно- мечено относительно низкая густота насаждений. Од-
кедровых элементов леса насаждений всех основных нако, несмотря на это обстоятельство, в зеленомошной
типов леса характерны завышенные значения средних группе типов леса не наблюдается снижение суммы пло-
высот, однако наиболее существенные различия отме- щадей сечений и соответственно производительности. А
чены в древостоях мелкотравно-зеленомошного, зе- вот в разнотравной группе типов леса запасы древесины
леномошного и травяно-болотного типов леса. Что ниже нормативных, как раз вследствие сниженной гу-
касается средних диаметров насаждений, то кроме папо- стоты, приводящей к падению сумм площадей сечения.
ротникового типа леса, разницы в сравнении с таблич- В травяно-болотном типе леса проявляется закономер-
ными показателями бывают как в сторону завышения, ность аналогичная таковой в зеленомошных типах леса.
так и занижения, причем амплитуда небольшая. Для па- Исходя из вышеприведенного анализа, для насаждений
поротникового типа леса характерны пониженные зна- из подроста требуется разработать отдельные лесотак-
чения толщин изучаемых древостоев, что обусловлено сационные нормативы.

Литература:

1. Шелгунов Н.В. История русского лесного законодательства / Н.В. Шелгунов. – СПб, 1859. – 71 с.
2. Дебков Н.М. К истории вопроса о сохранении подроста / Н.М. Дебков, В.С. Паневин // Леса России в XXI веке:
материалы 3-й международной научно-практической интернет-конференции. – Санкт-Петербург, 2010. – С.
85–88.
3. Моисеев Н.А. Результаты рубок с сохранением хвойного тонкомера и крупного подроста в лесах Севера / А.Н.
Моисеев, И.В. Волосевич, Г.Н. Дядицын // Лесное хозяйство. – 1966. – № 5. – С. 6–10.
4. Vyalykh N.J. Final felling and reforestation system in the north of European Russia // Metsantuttimustaitoks.
tiedonartola. – 2000. – № 790. – P. 23–28.
5. ОСТ 56–63–83. Площади пробные лесоустроительные. Метод закладки. – М., 1983. – 60 с.
6. Таксация товарной структуры / А.Г. Мошкалев [и др.]. – М.: Лесн. пром-сть, 1982. – 160 с.
7. Швиденко А.З. Таблицы и модели хода роста и продуктивности насаждений основных лесообразующих пород
Северной Евразии (нормативно-справочные материалы) / А.З. Швиденко [и др.]. – М., 2008. – 886 с.

Влияние разных типов питания на степень окислительной модификации белков


плазмы крови кролика (Oryctolagus cuniculus)
Тарасов Сергей Сергеевич, аспирант
Нижегородский государственный университет им. Н.И. Лобачевского

Научный руководитель: Крылов В.Н., доктор биологических наук, профессор

А ктивные формы кислорода (АФК), к которым отно-


сятся О2-, НОО, Н2О2, ОН-, образуются в результате
реакций многоступенчатого восстановления молекуляр-
с участием кислорода в различных субклеточных струк-
турах клетки и при различных её функциональных состо-
яниях [3,13].
ного кислорода. АФК участвуют в метаболических про- Окислительная модификация белков (ОМБ) играет
цессах организма, связанных с обменом липидов, белков, важную роль в обороте протеинов в организме. Нако-
нуклеиновых кислот, в синтезе лейкотриенов, тромбок- пление окисленных белков рассматривается как один из
санов, являются продуктами метаболических процессов, факторов регуляции синтеза и распада протеинов, акти-
ферментативных и не ферментативных, которые в норме вации мультипротеалитических протеаз, избирательно
протекают в организме [1,6,7]. Генерация АФК проис- разрушающих окислительные белки. Фактически разру-
ходит по ходу окислительно-востановительных реакций шение окислительных белков рассматривается как про-
“Young Scientist” . #12 (35) . Vol. I . December 2011 Biology 117

явление вторичной антиоксидантной защиты в орга- Определение карбонильных производных в плазме


низме [11] крови кролика проводили по модифицированной мето-
ОМБ происходит постоянно во всех живых организмах. дике Дубининой [5]. Её принцип основывается на реакции
На интенсивность деструктивных процессов и процессов взаимодействия окисленных аминокислотных остатков
распада окисленных метаболитов влияет 2 фактора: белков с 2,4 – денитрофенилгидразином (2,4 – ДНФГ)
внешний, т.е. влияние окружающей среды и внутренний – с образованием производных 2,4 – динитрофенилгидра-
процессы образования активных форм кислорода (АФК) зона [12,14]. Для анализа использовали 0,1 мл плазмы
и их утилизация в результате деятельности антиоксидан- крови кролика. К плазме приливали равный объём (1 мл)
тной системы (АС). Оба этих фактора взаимосвязаны. 0,1 М 2,4 – ДНФГ, растворённого в 2 М НСl. Инкубацию
Одним из внешних факторов, оказывающих влияние на осуществляли при комнатной температуре в течении 1
деструктивные процессы биополимеров, в том числе и на часа. Затем в пробы добавляли 20% трихлоруксусную ки-
уровень окислительной модификации белков, является слоту (ТХУ) для осаждения белков. Затем пробы центри-
питание. Это и послужило основанием для изучения вли- фугировали при 3000 g в течении 15–20 минут. Осадок
яние разных типов питания на окислительную модифи- промывали 3 раза раствором этанол – этилацетат (1:1)
кацию белков плазмы крови кролика. В связи с чем были для экстракции липидов и 2,4 – ДНФГ, который не ре-
поставлены следующие задачи: агировал с карбонильными группами окисленных белков.
1. Установить, как те или иные компоненты рациона Полученный осадок подсушивали с целью устранения
животных влияют на окислительную модификацию белка оставшегося растворителя этанол – этилацетат и затем
плазмы крови кролика. растворяли в 8 М растворе мочевины. Мочевину прили-
2. Выявить наиболее оптимальный вариант кормления вали к осадку в объёме 3 мл и выдерживали в кипящей
сельскохозяйственных животных в отношении рост био- бане в течение 5–10 минут до полного растворения. Оп-
массы и безопасность продукции. тическую плотность образовавшихсяденитрофинилгидра-
3. Выяснить, какие продукты питания усиливают зонов регистрировали на спектрофотометре СФ – 2000.
ОМБ, а какие снижает эти процессы. В результате окисления белков могут образоваться
Исследования проводили на кроликах породы «Совет- альдегидные и кетонные группировки аминокислотных
ская шиншилла» в возрасте от 3 до 5 месяцев [9]. Жи- остатков, которые взаимодействуют с 2,4 – ДНФГ. Из
вотных выращивали на кролиководческой ферме «Rab- данных литературы известно, что для алифатических аль-
bitStar» ООО «Вита Аструм» в стандартных условиях. дегид-денитрофенилгидразонов нейтрального характера
Сформированные группы выделяли из общего стада кро- спектр поглощения зарегистрирован в диапазоне 260–
ликов и в течение 2-х недель устанавливал