Вы находитесь на странице: 1из 279


ББК 28я721
Серия основана в 1999 году
Коллектив разработчиков олимпиадных заданий
Н. П. Максимова, О. И. Бородин, М. А. Джус, Ю. И. Кожуро, Ж. Е. Мелешко,
О. В. Молчан, В. Е. Мямин, Н. М. Орел, Д. Б. Сандаков, В. И. Хвир, Е. А. Храмцова,
В. А. Цинкевич, В. В. Черник
Составитель В. А. Цинкевич

канд. биол. наук, доц. каф. микробиологии Белорус. гос. унта
А. Г. Песнякевич (раздел «Задания для подготовки к олимпиадам»)

Олимпиады по биологии / сост. В. А. Цинкевич. — Минск :

О-54 Аверсэв, 2014. — 544 c. : ил. — (Школьникам, абитуриентам,
ISBN 9789851905658.
Предлагаемое пособие включает задания разной степени сложности, рекомен-
дуемые для подготовки к олимпиаде по биологии, а также задания, использовав-
шиеся при проведении второго (районного), третьего (областного) и четвертого
(заключительного) этапов Республиканской олимпиады в 2003—2010 гг.
Предназначено для учащихся, учителей, абитуриентов, студентов и всех
интересующихся биологией.
УДК  57(075.3)
ББК  28я721

Справочное издание

Цинкевич Вадим Анатольевич
Ответственный за выпуск Д. Л. Дембовский
Подписано в печать 16.12.2013. Формат 60×84 1/16.
Бумага газетная. Печать офсетная.
Усл. печ. л. 31,62. Уч.изд. л. 19,27. Ти­­раж 3100 экз. Заказ     
Общество с дополнительной ответственностью «Аверсэв».
Свидетельство о государственной регистрации издателя, изготовителя, распространителя
печатных изданий № 1/15 от 02.08.2013. Ул. Н. Олешева, 1, офис 309, 220090, Минск.
Email: info@aversev.by; www.aversev.by
Контактные телефоны: (017) 2680979, 268-08-78.
Для писем: а/я 3, 220090, Минск.
Государственное предприятие
«Издательство “Белорусский Дом печати”».
ЛП № 02330/0494179 от 03.04.2009.
Просп. Независимости, 79, 220013, Минск.

ISBN 9789851905658 © Цинкевич В. А., составление, 2014

© Оформление. ОДО «Аверсэв», 2014

Школьные олимпиады позволяют выявить учеников, проявляющих наи-
больший интерес к изучению отдельных предметов. Нередко участие в олим-
пиадах не только закрепляет этот интерес, но и помогает школьникам опреде-
литься с будущей профессией.
В Беларуси Республиканская олимпиада по биологии проводится в 4 этапа:
1 — школьный (в учреждениях образования);
2  — районный (областные центры) или городской (районные центры
и другие города);
3 — областной или городской (Минск);
4 — заключительный (республиканский).
Каждый этап Республиканской олимпиады по биологии организуется
определенным образом и преследует свои цели.
Первый этап — отбор учащихся, проявляющих интерес к биологии, в рам-
ках отдельной школы.
Второй этап — отбор учащихся, владеющих углубленными знаниями по
биологии (повышенный уровень сложности).
Третий этап — отбор учащихся, не только имеющих глубокие теорети-
ческие знания, но и обладающих практическими навыками и умениями. На
данном этапе обязательным является проведение практического тура, задания
которого представляют собой лабораторные мини-эксперименты. Традиционно
практический тур проводится по следующим разделам биологии:
— ботаника, зоология, анатомия и физиология человека (9 класс);
— анатомия и физиология растений, биотехнология, физиология человека
и животных, биохимия, микробиология, экология (10­—11 классы).
Во время практического тура учащиеся должны продемонстрировать уме-
ние работать с различными оптическими (лабораторный микроскоп, стереоско-
пический микроскоп, лупа) и другими специальными приборами и оборудовани-
ем, делать морфологические и морфофункциональные описания биологических
объектов, приготавливать микропрепараты, проводить простейшие эксперимен-
тальные исследования. При оценке навыков учащихся индивидуально учитыва-
ются техника проведения эксперимента, оформление записей и рисунков, работа
с определителями, интерпретация полученных результатов.
По мере продвижения к заключительному этапу не только увеличивается
количество заданий, глубина и широта охвата курса биологии, но и появляются
задания из разделов, которые учащимся еще предстоит изучить в школьном курсе.
4 Введение  5

Цель заключительного этапа олимпиады — выявление наиболее инфор-

мированных в области биологии учащихся, способных применить знания в но-
вых или нестандартных ситуациях.
Победители заключительного этапа Республиканской олимпиады по био-
логии принимают участие в Международной биологической олимпиаде.
Предлагаемое пособие включает задания повышенной сложности, реко-
мендуемые для подготовки к олимпиаде по биологии, в также задания, исполь-
зовавшиеся при проведении второго (районный), третьего (областной) и чет-
вертого (заключительный) этапов Республиканской олимпиады в 2003–2010
Первый раздел — задания, рекомендуемые для подготовки к олимпиадам.
Он включает тесты, сгруппированные по категориям. Первая категория — это
тесты с одним правильным ответом. Обычно при проведении олимпиад анало-
гичные задания включают в часть А теоретического тура. В пособии они сгруп-
пированы по разделам биологии.
Вторая категория — вопросы, требующие нестандартного (математиче-
ского) обозначения правильного ответа. Здесь представлены задания двух ти-
пов. Первый тип — определение правильности предложенных высказываний
(утверждений). Верные утверждения обозначаются знаком «+», неверные  —
знаком «–». Второй тип — решение неравенства, где между двумя утверждени-
ями необходимо поставить знак «>», «<» или «=». Задания такого типа пред-
лагаются на олимпиадах сравнительно недавно (начиная с 2006 г.).
Третья категория — практические задания. На 3-м и 4-м этапах Республи-
канской олимпиады в лабораториях (по разделам биологии) проводится практиче-
ский тур. Перечень лабораторий известен заранее. Обязательным элементом здесь
является практическая (экспериментальная) работа, а также такие теоретические
задания, решение которых требует умений применять знания в нестандартной
ситуации. Успех выполнения заданий практического тура зависит от навыков ра-
боты в лабораторных условиях, использования в исследовательской деятельности
оптических приборов, умений наблюдать и фиксировать ход эксперимента, пользо-
ваться определительными таблицами, анатомировать биологические объекты, из-
готавливать срезы, а также от неукоснительного следования инструкциям, в которых
описан алгоритм выполнения работы. Задания, отмеченные в пособии звездочкой,
заимствованы без изменений из различных источников.
Второй, третий, четвертый разделы — задания олимпиад прошлых лет,
сгруппированные по этапам проведения — районные, областные и республи-
Автор надеется, что пособие станет полезным при подготовке и проведе-
нии школьных олимпиад по биологии, и будет признателен всем, кто выскажет
пожелания и замечания по его содержанию.
Автор также выражает благодарность доценту кафедры микробиологии
Белорусского государственного университета Александру Георгиевичу Песня-
кевичу за ценные советы, данные в процессе рецензирования.
6 Тестовые задания с одним правильным ответом Микробиология. Протистология. Микология. Лихенология 7

5. Выберите верное утверждение, характеризующее одну из стадий

конъюгации у инфузорий:
а) макронуклеус делится и образует 2 ядра;
б) первое деление микронуклеуса не приводит к редукции числа
Тестовые задания хромосом;
в) микронуклеус делится несколько раз и образует 8 ядер;
с одним правильным ответом г) в результате деления микронуклеуса образуются пронуклеусы;
д) макро- и микронуклеус последовательно делятся и образуют
Микробиология. Протистология. 4 ядра.
Микология. Лихенология 6. Мелкие пылевидные мешочки, состоящие из одной или несколь-
1. Выберите признаки, характерные для пеницилла. ких клеток водорослей, оплетенных тонкими гифами грибов:
1 — продукт выделения — мочевина; 2 — в состав клеточной стенки а) соредии; в) гаплоидные споры;
входит муреин; 3 — фотосинтезирующий организм; 4 — размножа- б) изидии; г) диплоидные споры.
ется спорами; 5 — мицелий отсутствует; 6 — вызывает фитофтороз
7. Закрытые коллатеральные, расположенные по всей площади по-
перечного сечения стебля или несколькими кругами, проводящие
а) 1, 4, 5; в) 1, 3, 4; д) 1, 4.
пучки, окруженные склеренхимной обкладкой, — признак рас­
б) 2, 4, 6; г) 1, 2, 6;
2. Лишайники представляют собой симбиотический организм, со- а) двудольных; г) однолетних;
стоящий из гриба и: б) травянистых; д) многолетних.
а) цианобактерий; г) бурых водорослей; в) однодольных;
б) харовых водорослей; д) низших мхов.
8. Сходство клеток животных и бактерий в том, что и те и другие
в) красных водорослей;
3. Выберите признаки, общие для улотрикса, спирогиры и ульвы. а) оформленное ядро; г) плазматическую мембрану;
1 — многоклеточные организмы; 2 — формируют 4-жгутиковые б) митохондрии; д) гликокаликс.
споры; 3 — размножаются половым путем; 4 — имеют хлорофиллы в) лизосомы;
a и b; 5 — обитают только в морской воде. 9. Грибы опята, питающиеся мертвыми органическими остатками
а) 1, 3, 4; в) 1, 3, 4, 5; д) 2, 3, 5. деревьев, относят к группе:
б) 1, 2; г) 2, 4; а) сапрофагов; г) фитофагов;
4. Найдите соответствие между органеллами движения и организма- б) паразитов; д) мутуалистов.
ми, для которых они характерны. в) автотрофов;
I — ложноножки (псевдоподии); II — реснички; III — жгутики. 10. В клетках какого из перечисленных видов одноклеточных имеется
1 — амеба дизентерийная; 2 — вольвокс; 3 — инфузория туфелька; аксостиль (опорный тяж)?
4 — эвглена зеленая; 5 — хламидомонада; 6 — амеба обыкновенная. а) Амебы; г) трихомонады;
а) I — 1, 6; II — 3; III — 2, 4, 5; в) I — 6; II — 5; III — 1, 2, 3, 4; б) трипаносомы; д) опалины.
б) I — 1, 5; II — 3; III — 2, 4, 6; г) I — 1, 6; II — 5; III — 2, 3, 4. в) солнечника;
8 Тестовые задания с одним правильным ответом Микробиология. Протистология. Микология. Лихенология 9

11. Клетки колонии вольвокса: рибосомы; 8 — имеют митохондрии; 9 — ДНК хромосом связана
а) гаплоидные; г) тетраплоидные; с белками-гистонами; 10 — имеют кольцевую ДНК.
б) диплоидные; д) триплоидные. а) 1, 2, 4, 9; в) 3, 4, 7, 9; д) 1, 5, 7, 9.
в) полиплоидные; б) 1, 5, 6, 10; г) 1, 7, 10;
12. Раковина у пресноводной раковинной амебы арцеллы (Arcella sp.) 17. Азотфиксирующие бактерии рода Rhizobium вступают в симбиоз
состоит из: с представителями семейства растений:
а) хитиноидного органического вещества; а) Бобовые (Fabaceae);
б) карбоната кальция; б) Тыквенные (Cucurbitaceae);
в) кремнезема; в) Крестоцветные (Brassicaceae);
г) песчинок кварца; г) Розоцветные (Rosacea);
д) органического вещества, пропитанного CaCO3. д) Маревые (Chenopodiaceae).
13. Непереваренные остатки пищи у инфузории туфельки удаляются: 18. Для колонии вольвокса неверно утверждение:
а) через сократительные вакуоли; а) клетки колонии гаплоидны;
б) через порошицу; б) клетки колонии соединены цитоплазматическими тяжами;
в) в любом месте клеточной мембраны; в) яйцеклетка значительно крупнее сперматозоида;
г) через клеточный рот (цистом). г) клетки колонии несут два жгутика;
14. Двунитевая ДНК бактерий вида А превращается в однонитевую д) в процессе образования половых клеток принимают участие все
при температуре 76 °С, а бактерий вида Б — при 78 °С. Выберите особи колонии.
верное утверждение: 19. Актиномицеты относятся к:
а) количество пар Г-Ц в ДНК вида А больше, чем в ДНК вида Б; а) миксомицетам; г) бактериям;
б) количество пуринов в ДНК вида Б меньше, чем в ДНК вида А; б) примитивным грибам; д) вирусам.
в) количество пиримидинов в  ДНК вида Б больше, чем в  ДНК в) протистам;
вида А;
г) нуклеотидный состав ДНК не имеет значения для параметров 20. К накипным лишайникам относится:
ее тепловой денатурации. а) уснея бородатая;
б) аспицилия съедобная («лишайниковая манна»);
15. Первыми прокариотами на Земле вероятней всего были: в) цетрария исландская;
а) бактерии — возбудители заболеваний; г) кладония оленья;
б) бактериофаги; д) пармелия бороздчатая.
в) актиномицеты;
г) хемосинтезирующие бактерии; 21. Из перечисленных признаков для цианобактерий характерны:
д) молочнокислые бактерии. 1 — все виды способны к азотфиксации; 2 — отдельные виды яв-
ляются компонентом лишайников; 3 — относятся к группе грам­
16. Укажите признаки, характерные для бактерий (Eubacteria). отрицательных бактерий; 4 — в цитоплазме имеют специализи-
1 — прокариоты; 2 — клеточная стенка отсутствует; 3 — эукарио- рованные лизосомы; 5 — являются исключительно хемотрофами.
ты; 4 — клетки делятся митотически; 5 — размножаются простым а) 1, 2, 4; в) 1, 3, 5; д) 1, 2.
бинарным делением; 6  — имеют 70S рибосомы; 7  — имеют 80S б) 2, 3; г) 4, 5;
10 Тестовые задания с одним правильным ответом Микробиология. Протистология. Микология. Лихенология 11

22. В отличие от базидиальных грибов хитридиомицеты: 28. Микоплазмы не имеют:

а) не имеют органов полового размножения; а) мезосом; г) плазмалеммы;
б) образуют многоядерный несептированный мицелий; б) нуклеоида; д) цитоплазмы.
в) имеют клеточную стенку, состоящую из целлюлозы; в) клеточной стенки;
г) на определенном этапе жизненного цикла образуют клетки со
жгутиками; 29. Белок флагеллин входит в состав органоида движения:
д) способны к фотосинтезу. а) сперматозоидов позвоночных;
б) половых клеток фораминифер;
23. В промышленности аспергилл используют для получения:
в) клеток колонии вольвокса;
а) этилового спирта; г) диэтилового эфира; г) бактерий;
б) лимонной кислоты; д) искусственного меда. д) трипаносом.
в) кисломолочных продуктов;
30. Палочка Коха является возбудителем:
24. К грибам относятся:
а) гриппа;
1  — аскомицеты; 2  — хитридиомицеты; 3  — планктомицеты;
б) оспы;
4 — дейтеромицеты; 5 — актиномицеты.
в) пневмонии;
а) 1, 2, 4; г) 1, 5; г) туберкулеза легких;
б) 1, 2, 3; д) 1, 3. д) гонореи.
в) 3, 4, 5;
31. В клетках грибов отсутствуют(-ет):
25. Размножение голых амеб происходит:
а) вакуоли;
а) путем амитотического деления;
б) ядро;
б) путем митотического деления;
в) эндоплазматическая сеть;
в) путем мейотического деления;
г) пластиды;
г) половым путем;
д) рибосомы.
д) нет верного ответа.

26. Хлорофилл у одноклеточных эукариот, способных к фотосинтезу, 32. Плодовые тела большинства грибов образованы:
локализуется в: а) мицелием;
а) хромопластах; б) микоризой;
б) хроматофорах; в) отдельными конидиями;
в) плазмалемме; г) ризоидами;
г) эндоплазме в виде свободных зерен; д) микоплазмой.
д) мембране ядра.
33. Организмы, принимавшие основное участие в формировании ме-
27. Трихомонада (Trichomonas vaginalis) у человека паразитирует в: ловых отложений, — это:
а) почках; г) желчных протоках печени; а) радиолярии; г) трилобиты;
б) кровеносных сосудах; д) коже. б) кокколитофоры; д) белемниты.
в) мочеполовых путях; в) коралловые полипы;
12 Тестовые задания с одним правильным ответом Ботаника 13

34. Хемолитотрофы могут использовать в качестве источника энергии Ботаника

1. Большая часть стебля пятилетней сосны образована:
1 — молекулярного водорода; 2 — ионов NH+4 ; 3 — ионов желе-
за; 4 — натриевых солей фосфорной кислоты; 5 — хлорида ртути; а) меристемой; г) эпиблемой;
6 — крахмала; 7 — гликогена. б) паренхимой; д) эндодермой.
а) 2, 3, 4, 5; в) 1, 3, 7; д) 1, 2, 3. в) ксилемой;
б) 6, 7; г) 4, 5, 6; 2. У мужского гаметофита сосны обыкновенной формируются:
35. Кремнезем является основным компонентом клеточной стен- 1 — сперматозоиды; 2 — антеридии; 3 — спермии; 4 — эндосперм;
­ки у: 5 — вегетативная клетка; 6 — микропиле.
а) диатомовых водорослей; а) 1, 2, 4; в) 3, 5; д) 1, 3, 6.
б) цианобактерий; б) 2, 4, 6; г) 2, 5, 6;
в) зеленых водорослей; 3. Цветки, соответствующие описанию: «В виде мотылька, состоя-
г) инфузорий; щий из 5 чашелистиков, 5 лепестков разной формы (парус, кры-
д) эвглен. лья, лодочка), 10 тычинок; завязь из одного плодолистика», при-
36. У хлореллы размножение осуществляется при помощи: надлежат растению семейства:
а) зооспор; г) апланоспор; а) Крестоцветные;
б) тетраспор; д) коньюгации. б) Бобовые;
в) синзооспор; в) Губоцветные;
г) Сложноцветные;
37. Крахмал не является запасным веществом у: д) Пасленовые.
а) хлореллы; г) нителлы;
4. Ученые доказали, что без яровизации многие растения (свекла,
б) ламинарии; д) хары.
сельдерей и другие) не способны к цветению. Яровизация в сель-
в) хламидомонады;
ском хозяйстве — это:
38. Основная функция сократительной вакуоли в  клетках проти- а) выдерживание растений при высоких температурах;
стов — это: б) выдерживание растений при низких температурах;
а) фагоцитоз; в) выдерживание растений при низкой влажности;
б) пиноцитоз; г) выдерживание растений при высокой влажности;
в) осморегуляция; д) обработка семян растений фитогормонами.
г) пищеварение;
д) запасание питательных веществ. 5. Укажите, какой перечень типов плодов точно соответствет при-
веденному перечню растений:
39. К автогетеротрофным организмам относится: капуста, липа, фасоль, одуванчик, картофель.
а) арцелла; г) хламидомонада; а) стручок, костянка, стручок, семянка, крылатка;
б) хлорелла; д) хара. б) стручок, орех, боб, семянка, ягода;
в) хлорококк; в) стручок, орешек, стручок, крылатка, коробочка;
г) семянка, костянка, боб, семянка, ягода.
14 Тестовые задания с одним правильным ответом Ботаника 15

6. Какое из перечисленных растений имеет корневище? 11. Выберите признаки, характеризующие ирис желтый.
а) Ветреница лютичная; 1 — жилкование листьев дуговое; 2 — корневая система стержне-
б) лук медвежий; вая; 3 — проводящие пучки без камбия; 4 — в проводящих пуч-
в) каштан конский; ках есть камбий; 5 — плод ягода; 6 — плод стручок; 7 — семена
г) сосна обыкновенная; с эндоспермом; 8 — опыление перекрестное; 9 — ветроопыляемое
д) молодило отпрысковое. растение.
а) 2, 4, 5, 7, 8; в) 1, 3, 6, 8; д) 3, 5, 7, 9.
7. К какому отделу растений относится дикранум метловидный?
б) 1, 4, 5, 9; г) 1, 3, 5, 7, 8;
а) Голосеменные; г) Папоротниковидные;
б) Моховидные; д) Хвощевидные. 12. Мужским гаметофитом покрытосеменных является:
в) Покрытосеменные; а) семязачаток; г) клетки-антиподы;
б) пыльцевое зерно; д) зрелая яйцеклетка.
8. Установите соответствие между организмами и особенностями их
в) клетки-синергиды;
жизненных циклов.
I — стадия гаметофита доминирует над стадией спорофита; 13. Выберите признаки, характерные для корня покрытосеменных
II — стадия спорофита доминирует над стадией гаметофита. растений.
1 — дикраниум скученный; 2 — кедр ливанский; 3 — политрихи- 1 — поглощение воды и минеральных солей; 2 — закрепление рас-
ум волокнистый; 4 — сальвиния плавающая; 5 — сфагнум бурый; тения в почве; 3 — накопление запасных веществ; 4 — участвует
6 — гинкго двулопастный. в образовании спор; 5 — несет верхушечную почку; 6 — несет ли-
стья; 7 — генеративный орган.
а) I — 4, 5; II — 1, 2, 3, 6;
б) I — 1, 3, 5; II — 2, 4, 6; а) 4, 5, 6, 8; в) 1, 2, 3, 5, 6; д) 1, 2, 3, 4, 7.
в) I — 1, 5; II — 2, 3, 4, 6; б) 1, 2, 3; г) 1, 2, 3, 8;
г) I — 1, 5, 6; II — 2, 3, 4.
14. Расположите структуры анатомического строения трехлетнего
9. Выберите признаки, характерные для сосудов ксилемы (I) и сито- стебля липы, начиная с наружного.
видных трубок флоэмы (II). 1 — перидерма; 2 — паренхима первичной коры; 3 — вторичная
1 — клетки мертвые; 2 — клетки живые; 3 — окружены клетками- флоэма; 4 — остатки первичной флоэмы; 5 — камбий; 6 — древе-
спутницами; 4 — поперечные перегородки между клетками имеют сина; 7 — сердцевина.
мелкие отверстия; 5 — поперечные перегородки отсутствуют. а) 7 → 4 → 6 → 5 → 3 → 2 → 1; г) 6 → 7 → 5 → 4 → 1 → 3 → 2;
а) I — 2, 5; II — 1, 3, 4; б) 7 → 3 → 5 → 4 → 6 → 2 → 1; д) 1 → 2 → 4 → 3 → 5 → 6 → 7.
б) I — 1, 3; II — 2, 5, 4; в) 5 → 7 → 6 → 5 → 3 → 1 → 2;
в) I — 1, 5; II — 2, 3, 4;
15. Какие из перечисленных видоизменений вегетативных частей рас-
г) I — 1, 5, 4; II — 2, 3;
тений относятся к видоизменениям листьев?
д) I — 2, 3, 4; II — 1, 5.
1 — клубни картофеля; 2 — колючки барбариса; 3 — колючки бо-
10. Какая из приведенных тканей растений не является образователь- ярышника; 4 — усик гороха; 5 — усик винограда; 6 — корнеплод
ной? свеклы; 7 — корневые клубни георгины.
а) Перицикл; в) ксилема; а) 2, 4, 6; в) 2, 5, 7; д) 2, 3, 4, 6.
б) камбий; г) феллоген. б) 1, 2, 4, 5; г) 2, 4;
16 Тестовые задания с одним правильным ответом Ботаника 17

16. К листопадным растениям относятся: а) склеренхима; г) лубяные волокна;

1 — кипарис; 2 — лиственница; 3 — гинкго; 4 — вяз; 5 — тополь; б) склереиды; д) клетки-спутницы.
6 — кедр. в) колленхима;
а) 2, 3, 4, 5; в) 2, 3, 6; д) 1, 3, 4, 5. 23. Бесполое поколение растений, жизненный цикл которых проходит
б) 1, 2, 4, 5; г) 1, 3, 6; с ритмическим чередованием половых и бесполых поколений, —
17. Мякоть плодов груши имеет крупчатую консистенцию. Ботаник
решил выяснить, в чем причина крупчатой консистенции, и обна- а) спорофит; в) гаметофит;
ружил, что в мякоти плодов груши присутствуют округлые мерт- б) заросток; г) зооспора.
вые клетки с очень толстыми одревесневшими оболочками. Эти
24. Половое поколение в жизненном цикле папоротников — это:
клетки были названы:
а) зигота; г) гаметофит;
а) трахеиды; г) склереиды;
б) зооспора; д) спорофит.
б) чечевички; д) лубяные волокна.
в) спермий;
в) перидерма;
25. Прикрепление к почве у печеночных мхов осуществляется за счет:
18. Выберите гриб, относящийся к отделу аскомицетов, или сумчатых
грибов: а) только главного корня;
б) придаточных корней;
а) подберезовик; г) сыроежка желтая;
в) главного и боковых корней;
б) пекарские дрожжи; д) стеблевая головня ржи. г) ризоидов;
в) трутовик обыкновенный; д) таллом не связан с почвой.
19. Мертвые клетки, суженные на концах, оболочки их утолщены 26. В отличие от покрытосеменных у всех голосеменных отсутству-
и лигнифицированы, имеют окаймленные поры — это: ет(-ют):
а) лубяные волокна; г) трахеиды; а) камбий; г) семядоли;
б) сосуды; д) чечевички. б) вторичная ксилема; д) спорофит.
в) склереиды; в) перикарпий;
20. Мембрана вакуоли растительной клетки — это:
27. На спорофите бурых водорослей образуются:
а) тегумент; г) тилакоид;
а) только женские гаметы; г) гаметангии;
б) кутикула; д) тургор.
б) только мужские гаметы; д) спорангии.
в) тонопласт;
в) мужские и женские гаметы;
21. Крупный, сильно рассеченный, похожий на ветку лист папорот-
ника — это: 28. У липы мелколистной начало образованию боковых корней да-
а) рахис; г) энация;
б) примордий; д) вайя. а) эндодерма;
в) почка; б) центральный цилиндр;
в) перицикл;
22. Опорная (механическая) ткань растений, клетки которой содер- г) сердцевинные лучи;
жат цитоплазму, ядро и органоиды, — это: д) эпиблема.
18 Тестовые задания с одним правильным ответом Ботаника 19

29. Для насекомоядных растений потребляемые ими членистоногие 34. Эндосперм у покрытосеменных растений образуется в результате:
являются основным источником: а) слияния спермия с яйцеклеткой;
а) воды, необходимой для прорастания семян; б) слияния центральной клетки со спермием;
б) магния и цинка, необходимых для роста и развития; в) разрастания синергид;
в) углеводов; г) разрастания антипод;
г) азота, необходимого для образования белка; д) деления клеток нуцеллуса.
д) ненасыщенных жирных кислот, необходимых для выживания
в экстремальных условиях природной среды. 35. Укажите, какие из перечисленных элементов относятся к флоэме.
30. Для каких экологических групп растений характерны хорошо раз- 1  — сосуды; 2  — трахеиды; 3  — клетки-спутницы; 4  — склере­
витые корневые волоски? иды; 5 — ситовидные трубки; 6 — пропускные клетки энтодермы;
1 — склерофиты; 2 — мезофиты; 3 — гидрофиты; 4 — гигрофиты. 7 — эпиблема; 8 — перицикл.
а) 1, 3; в) 2, 4; д) 1. а) 1, 2, 7, 8; в) 3, 6, 7; д) 2, 4, 7.
б) 1, 2; г) 3, 4; б) 3, 5; г) 1, 5, 6, 8;

31. У каких растений гаметофит и спорофит непосредственно связаны 36. Плод стручок имеют:
друг с другом? а) редька дикая, капуста пекинская, хрен обыкновенный, горчица;
1 — маршанция многообразная; 2 — политрихум обыкновенный; б) тыква, огурец бешеный, дыня, редька дикая;
3 — щитовник мужской; 4 — сальвиния плавающая; 5 — эфедра; в) фиалка душистая, береза повислая, ольха черная, дуб череш­
6 — селагинелла сибирская; 7 — можжевельник; 8 — магнолия. чатый;
а) 1, 2, 5, 7, 8; в) 4, 5; д) 6, 8. г) гвоздика, лютик едкий, ветреница дубравная, кубышка желтая;
б) 2, 3, 5, 8; г) 4, 6, 7, 8; д) фасоль посевная, горох посевной, соя, люцерна желтая.

32. Заросток папоротника отличается от проростка покрытосеменных 37. Определите тип плода по описанию: «Небольшой плод с кожи-
растений тем, что: стым перикарпием, не срастающимся с  семенем; часто плоды
а) служит для бесполого размножения; снабжены летучками; плоды характерны для растений семейства
б) развивается из споры; Сложноцветные».
в) на нем образуются споры; а) Боб; г) орех;
г) имеет хорошо развитые придаточные корни; б) стручок; д) коробочка.
д) его клетки делятся мейотически. в) семянка;

33. Укажите неверное утверждение в отношении растений отдела Хво- 38. Укажите признаки, характерные для анемофильных растений.
щеобразные: 1 — редукция околоцветника; 2 — увеличение числа семязачатков
а) в жизненном цикле доминирует гаметофит; в завязи; 3 — уменьшение числа семязачатков в завязи; 4 — сложно-
б) в современной флоре отдел представлен только одним родом; скульптурированная экзина; 5 — гладкая экзина; 6 — увеличение
в) в состав оболочек входит кремнезем; поверхности рыльца пестика; 7 — уменьшение поверхности рыль-
г) имеют побеги, состоящие из четко выраженных междоузлий ца пестика.
и узлов; а) 1, 2, 5; в) 1, 3, 5, 6; д) 2, 5, 6.
д) корневищные многолетние травянистые растения. б) 1, 3, 4, 7; г) 1, 2, 4, 6;
20 Тестовые задания с одним правильным ответом Ботаника 21

39. Укажите вторичные изменения клеточных стенок покровных тка- 44. Укажите признаки, характерные только для представителей от-
ней растений, препятствующие транспирации. дела Magnoliophyta.
1 — кутинизация; 2 — ослизнение; 3 — суберинизация; 4 — лигни- 1 — главный корень; 2 — придаточные корни; 3 — сложные листья;
фикация; 5 — минерализация. 4 — прилистники; 5 — тип стели — эустель; 6 — трахеи; 7 — три-
а) 1, 3, 5; в) 1, 2, 3, 4; д) 4, 5. плоидный эндосперм; 8 — спермии.
б) 2, 4, 5; г) 1, 3; а) 1, 3, 6, 7; в) 2, 4, 7; д) 1, 3, 5, 8.
б) 1, 2, 5, 8; г) 4, 5, 7;
40. Процесс образования семян у цветковых растений без оплодотво-
рения называется: 45. Ткань корня, в которой передвижение воды в зоне всасывания осу-
а) апомиксис; г) гаметогенез; ществляется только по симпласту, называется:
б) партеногенез; д) спорогенез. а) ризодерма;
в) копуляция; б) паренхима первичной коры;
в) перицикл;
41. Изображенное на рисунке действие является примером: г) энтодерма;
а) анемофилии; д) ксилема.
б) энтомофилии;
46. Апокарпный гинецей характерен для:
в) орнитофилии;
г) хироптерофилии; а) лютика едкого; г) тюльпана;
д) гидрофилии. б) ромашки аптечной; д) тыквы.
в) лилии;

47. Укажите признаки, которые характеризуют эволюционно молодые

(специализированные) группы покрытосеменных растений.
1 — актиноморфные цветки; 2 — зигоморфные цветки; 3 — апо-
карпный гинецей; 4 — ценокарпный гинецей; 5 — полузамкнутые
плодолистики; 6 — плодолистики со сросшимися краями; 7 — ци-
42. В каком семействе цветковых растений не встречаются двудомные клические цветки; 8 — спиральные цветки.
особи? а) 1, 3, 4, 7; в) 1, 4, 5; д) 2, 8.
а) Розоцветные; б) 2, 4, 6, 7; г) 2, 3, 5, 8;
б) Мальвовые;
в) Гераниевые; 48. Укажите признаки, которые отличают растения класса Однодоль-
г) Крестоцветные, или Капустные; ные от растений класса Двудольные.
д) Губоцветные, или Яснотковые. 1 — количество элементов цветка кратно трем; 2 — мочковатая кор-
невая система; 3 — сетчатое жилкование листьев; 4 — проводящие
43. У всех представителей именно этого отдела растений тип стели — пучки не имеют камбия; 5 — проводящие пучки расположены по
протостель: одному кругу; 6 — стержневая корневая система; 7 — дуговое или
а) Magnoliophyta; г) Pinophyta; параллельное жилкование листьев.
б) Rhyniophyta; д) Bryophyta. а) 1, 3, 4, 7; в) 1, 4, 5; д) 3, 4, 5, 6.
в) Polypodiophyta; б) 2, 4, 6, 7; г) 1, 2, 4, 7;
22 Тестовые задания с одним правильным ответом Ботаника 23

49. К фанерофитам (I) и гемикриптофитам (II) по Раункиеру относят: 54. Какие растения обычно сохраняют первичную анатомическую
1 — марь белую; 2 — березу повислую; 3 — веронику лекарствен- структуру?
ную; 4 — клевер ползучий; 5 — лебеду; 6 — ольху черную; 7 — май- 1 — двудольные; 2 — однодольные; 3 — голосеменные; 4 — хвоще-
ник двулистный. видные; 5 — плауновидные.
а) I — 2, 6; II — 3, 4; а) 1, 2; в) 2, 4, 5; д) 2, 3, 4.
б) I — 1, 6; II — 2, 3, 4, 5; б) 2; г) 4, 5;
в) I — 2, 6; II — 1, 3, 4, 5;
г) I — 3, 4; II — 2, 6; 55. Покровными у растений являются ткани:
д) I — 1, 3, 4; II — 2, 5. 1 — феллоген; 2 — эпиблема; 3 — эндодерма; 4 — флоэма; 5 — пе-
рицикл; 6 — перидерма.
50. Укажите вещества, участвующие в образовании клеточной стенки
растений. а) 2, 6; в) 2, 3, 4, 6; д) 1, 2, 3, 6.
б) 2; г) 1, 3, 5;
1 — фосфолипиды; 2 — пектин; 3 — хитин; 4 — парамилон; 5 — му-
реин; 6 — гемицеллюлоза; 7 — целлюлоза; 8 — крахмал; 9 — субе- 56. Цветок у покрытосеменных и шишка у голосеменных являются
рин; 10 — лигнин. видоизменением:
а) 1, 2, 3, 9; в) 1, 2, 6, 7, 10; д) 2, 7, 9. а) побега; г) плода;
б) 2, 5, 6, 9; г) 2, 6, 7; б) семязачатка; д) гаметофита.
в) зародышевого мешка;
51. Устьица располагаются в:
а) ризодерме; 57. К длиннодневным растениям относятся(-ится):
б) эпидерме; 1  — земляника; 2  — просо; 3  — рожь; 4  — лен; 5  — хризантема;
в) перидерме; 6 — соя.
г) эпиблеме; а) 1, 2, 4; в) 2; д) 1, 3, 5, 6.
д) осевом цилиндре. б) 3, 4, 6; г) 1, 3, 4;
52. Лигнин вызывает: 58. Для растений семейства Сложноцветные (Asteracea) характерно
а) опробковение клеточных стенок; соцветие:
б) образование придаточных корней; а) кисть; г) головка;
в) рост междоузлий; б) корзинка; д) сложный колос.
г) одревеснение клеточной стенки; в) колос;
д) созревание плодов.
59. Каллоза обеспечивает осеннюю остановку флоэмного транспорта
53. К метаморфозам корня относятся: у растений путем:
1 — корневище; 2 — корневой чехлик; 3 — филлокладии; 4 — лу- а) ингибирования процесса фотосинтеза;
ковица; 5 — корнеплод; 6 — шипы; 7 — корневые шишки; 8 — ды- б) закупорки сосудов;
хательные корни. в) закупорки ситовидных пластинок;
а) 1, 2, 5; в) 5, 7, 8; д) 1, 5, 6, 8. г) усиления синтеза абсцизовой кислоты;
б) 2, 3, 5, 7; г) 3, 4, 6, 8; д) флоэмный транспорт не прекращается в зимний период.
24 Тестовые задания с одним правильным ответом Ботаника 25

60. Сборные плоды формируются из: 64. Растение, жизненный цикл которого изображен на рисунке, — это:
а) одного цветка с несколькими отдельными плодолистиками; а) эфедра двухколосковая;
б) нескольких цветков, расположенных на одной оси (соцветие б) одуванчик лекарственный;
колос); в) тисс ягодный;
в) нескольких цветков, расположенных на одном уровне (соцветие г) щитовник мужской;
корзинка); д) волчье лыко.
г) одного цветка с синкарпным гинецеем;
д) многих цветков с синкарпным гинецеем.
61. Укажите процессы, обеспечивающие движение воды с минераль-
ными солями по сосудам ксилемы.
1 — диффузия ионов в растворе, заполняющем сосуды ксилемы;
2 — транспирация; 3 — адгезия; 4 — когезия; 5 — нагнетающее дей-
ствие корневого давления.
а) 1, 5; г) 2, 5;
б) 3, 4; д) 1, 3.
в) 2, 4, 5;
62. Представленной диаграмме цветка соответ-
ствует следующее описание:
65. Известно, что осмотическое давление в растительной клетке равно
а) чашечка отсутствует, число тычинок равно
0,7 МПа. Клетку помещают в растворы с разным осмотическим
числу пестиков, гинецей с 5 плодолистиками;
давлением. Укажите, в каких растворах будет происходить плаз-
б) чашечка и венчик с одинаковым количеством
частей, число тычинок в 2 раза больше, чем молиз растительной клетки.
лепестков и чашелистиков, гинецей с 5 пло- 1 — 0,09 МПа; 2 — 0,5 МПа; 3 — 0,7 МПа; 4 — 0,9 МПа; 5 — 1,1 МПа;
долистиками; 6 — 0,2 МПа.
в) число чашелистиков в 1,5 раза меньше числа лепестков, число а) 1, 2, 3, 6; г) 1, 6;
тычинок в 2 раза меньше числа лепестков, гинецей с 5 плодоли- б) 3, 4, 5; д) 1, 4, 5.
стиками; в) 4, 5;
г) чашечка и венчик с одинаковым количеством частей, число ты-
чинок в 2 раза больше, чем лепестков и чашелистиков, гинецей 66. Укажите правильные утверждения.
с 8 плодолистиками; 1 — боковые побеги закладываются в энтодерме; 2 — боковые по-
д) чашечка и венчик с одинаковым количеством частей, число ты- беги закладываются в апикальной меристеме; 3 — боковые корни
чинок в 4 раза больше, чем лепестков и чашелистиков, гинецей закладываются в корневом чехлике; 4 — боковые корни заклады-
с 6 плодолистиками. ваются в перицикле; 5 — клетки, содержащие пояски Каспари, рас-
63. Какой гормон можно использовать для усиления образования кор- положены в энтодерме; 6 — клетки, содержащие пояски Каспари,
ней при размножении растений черенками? расположены во флоэме.
а) Гиббереллин; г) ауксин; а) 1, 2, 4; г) 1, 6;
б) цитокинин; д) абсцизовую кислоту. б) 3, 4, 5; д) 2, 3, 6.
в) этилен; в) 4, 5;
26 Тестовые задания с одним правильным ответом Ботаника 27

67. Химические формулы каких растительных пигментов изображены 69. Корнеплод редиса представляет собой утолщенный:
на рисунках 1 и 2? а) только придаточный корень;
б) только главный корень;
в) стебель в основании главного побега;
г) стебель в основании главного побега и утолщенное основание
главного корня;
д) боковой побег.

70. Четырехгранная форма поперечного сечения стебля характерна

а) одуванчика лекарственного; г) мятлика;
б) пижмы обыкновенной; д) пырея ползучего.
в) мяты перечной;

71. Плод многоорешек характерен для:

Рис. 1 а) малины, костяники, ежевики; г) ежевики, земляники;
б) вишни, липы; д) малины, морошки.
в) ветреницы, лютика;

72. Плод арахиса — это:

а) коробочка; г) боб;
б) стручок; д) семянка.
в) орех;

73. Клубень земляной груши (топинамбура) является видоизменен-

Рис. 2
а) побегом; г) придаточным корнем;
а) 1 — хлорофилл а; 2 — β-каротин; б) боковым корнем; д) листом.
б) 1 — гемоглобин; 2 — хлорофилл а; в) главным корнем;
в) 1 — хлорофилл b; 2 — гемоглобин;
г) 1 — β-каротин; 2 — ксантофилл; 74. Утолщение корня как результат деятельности вторичных боковых
д) 1 — хлорофилл b; 2 — ксантофилл. меристем можно наблюдать у:

68. Какое количество семязачатков находится на семенной чешуе а) однодольных и папоротникообразных;

женской шишки сосны обыкновенной? б) голосеменных и папоротникообразных;
в) голосеменных и двудольных;
а) 1; в) 4; д) 6.
б) 2; г) 5; г) однодольных и двудольных;
д) папоротникообразных и хвощей.
28 Тестовые задания с одним правильным ответом Зоология 29

75. Образование первичного крахмала у покрытосеменных растений Зоология

происходит в: 
а) лейкопластах; в) хлоропластах; 1. Пищеварительная система у представителей класса Ленточные
б) хромопластах; г) цитоплазме. черви состоит из:
а) передней и средней кишки;
76. Пентациклические цветки характерны для: б) передней, средней и задней кишки (без пищеварительных же-
а) лилейных; г) норичниковых; лез);
б) ирисовых; д) крестоцветных. в) передней, средней, задней кишки и пищеварительных желез;
в) орхидных; г) фагоцитарных клеток;
д) отсутствует.
77. В каких(-ой) группах(-е) современных растений встречается раз-
носпоровость? 2. Иксодовые клещи являются:
1 — моховидные; 2 — хвощевидные; 3 — плауновидные; 4 — папо- а) возбудителями малярии;
ротниковидные; 5 — голосеменные. б) возбудителями энцефалита;
а) 1, 3, 5; г) 1; в) переносчиками возбудителя энцефалита;
б) 2, 3, 4; д) 1, 2, 3, 4, 5. г) переносчиками возбудителя малярии;
в) 3, 4, 5; д) нет правильного ответа.
78. Укажите признаки, нехарактерные для дикранума метловидного. 3. На головогруди у паукообразных располагается:
1 — имеются антеридии; 2 — имеются сперматозоиды; 3 — в жиз- а) 6 конечностей;
ненном цикле доминирует спорофит; 4  — имеются архегонии; б) 4 пары конечностей;
5 — образуется первичный эндосперм; 6 — имеются только при- в) 3 пары конечностей;
даточные корни. г) 5 пар конечностей;
а) 3, 5, 6; г) 1, 4, 6; д) 6 пар конечностей.
б) 1, 2, 4; д) 1, 2, 4, 6.
в) 2, 3, 5; 4. Развитие с полным метаморфозом характерно для представителей
этих отрядов насекомых:
79. Самый внутренний слой микроспорангия покрытосеменных рас-
тений — это: 1 — сетчатокрылые; 2 — двукрылые; 3 — термиты; 4 — уховертки;
5 — вши; 6 — поденки.
а) тапетум; г) интегумент;
а) 1, 4, 5; в) 1, 2, 5; д) 1, 5, 6.
б) экзина; д) микропиле.
б) 2, 4, 6; г) 2, 3, 6;
в) интина;
5. У каких членистоногих органами выделения являются мальпиги-
евы сосуды?
1 — речной рак; 2 — паук-крестовик; 3 — камчатский краб; 4 — май-
ский жук; 5 — креветка пресноводная; 6 — навозник обыкновен-
а) 1, 2, 4; в) 2, 3, 6; д) 3, 4, 5.
б) 4, 5, 6; г) 2, 4, 6;
30 Тестовые задания с одним правильным ответом Зоология 31

6. Какой организм является промежуточным хозяином в цикле раз- 11. Образование половых клеток у гидры возможно благодаря деле-
вития печеночного сосальщика? нию клеток:
а) Человек; а) эпителиально-мускульных; г) интерстициальных;
б) свинья; б) нервных; д) железистых.
в) рыба; в) сенсорных;
г) моллюск;
д) личинка стрекозы. 12. В большинстве потовых желез кожи млекопитающих происходит
7. Укажите виды пресмыкающихся, обитающих в Беларуси.
а) мерокринная;
1 — прыткая ящерица; 2 — геккон; 3 — гаттерия; 4 — агама; 5 — ве- б) апокринная;
ретеница; 6 — живородящая ящерица; 7  — гадюка; 8 — кайман; в) мерокринная и апокринная;
9 — уж обыкновенный; 10 — медянка. г) голокринная;
а) 1, 2, 5, 6, 7, 9, 10; г) 1, 4, 7, 8, 9; д) голокринная и апокринная.
б) 1, 3, 5, 7, 8, 9; д) 1, 5, 7, 8, 9.
в) 1, 5, 6, 7, 9, 10; 13. Укажите животное, у которого внутренний слой образован клет-
ками, несущими жгутик, окруженный воротничком:
8. Для борьбы с насекомыми — вредителями сельского хозяйства
а) гидра стебельчатая; г) бадяга озерная;
обычно используют:
б) аурелия аурита; д) бычий цепень.
а) гербициды; в) планария молочно-белая;
б) инсектициды;
в) животных-орнитофагов; 14. Найдите соответствие между животными и личинками, которые
г) животных-энтомофагов; для них характерны.
д) животных-ихтиофагов. 1 — коралл красный; 2 — нереис; 3 — кошачья двуустка; 4 — пру-
9. Выберите животных, у которых в среднем ухе расположены три довик обыкновенный; 5 — перловица; 6 — эхинококк.
слуховые косточки. а — глохидий; б — трохофора; в — мирацидий; г — планула.
1 — саламандра огненная; 2 — черепаха болотная; 3 — суслик крап- а) 1б, 2г, 3в, 4а, 5а; г) 1г, 3б, 4а, 5а, 6в;
чатый; 4 — сапсан; 5 — ондатра; 6 — кайман; 7 — кашалот; 8 — квак- б) 1г, 2б, 3в, 5а; д) 2а, 3в, 5б, 6в.
ша обыкновенная. в) 2б, 4а, 5а, 6в;
а) 1, 3, 4; г) 3, 5, 7;
б) 3, 4, 5, 7; д) 4, 5. 15. Выберите признаки, характерные для земноводных.
в) 4, 5, 6, 8; 1 — шейный отдел позвоночника образован тремя позвонками;
2 — в полости среднего уха одна слуховая косточка — стремечко;
10. Из предложенных видов животных выберите раздельнополых. 3 — имеется мигательная перепонка; 4 — имеются трахеи и бронхи;
1 — махаон; 2 — пиявка медицинская; 3 — эхинококк; 4 — песко- 5 — зародыш развивается в амниотической полости; 6 — у личинок
жил; 5 — морской конек черноморский; 6 — улитка виноградная. присутствует орган боковой линии.
а) 1, 3, 6; г) 2, 3, 6; а) 1, 2, 6; г) 1, 2, 5, 6;
б) 1, 4, 5; д) 3, 4, 5. б) 2, 4; д) 2, 3, 5.
в) 2, 4, 6; в) 2, 3, 6;
32 Тестовые задания с одним правильным ответом Зоология 33

16. Сросшиеся кости ступни птиц (кости плюсны и предплюсны) об- 21. Укажите признаки, характеризующие строение кольчатых червей.
разуют: 1 — тело снаружи покрыто хитиновой кутикулой; 2 — кровеносная
а) голень; в) бедро; система замкнутая и имеется однокамерное сердце; 3 — вторичная
б) цевку; г) плечо. полость тела; 4 — у большинства кровь содержит дыхательные пиг-
17. Конечность, включающая щеточку и корзиночку, характерна для менты; 5 — органы выделения нефридиального типа; 6 — большин-
этих насекомых: ство почвообитающих видов развивается с метаморфозом.
а) пилильщики; г) муравьи-листорезы; а) 2, 3, 5, 6; в) 3, 5, 6; д) 3.
б) осы-блестянки; д) термиты. б) 1, 3, 2, 5; г) 3, 4, 5;
в) шмели; 22. У представителей каких классов животных в секрете слюнных же-
18. Ланцетник — примитивное хордовое животное. Укажите призна- лез содержатся пищеварительные ферменты?
ки, которые сближают его с беспозвоночными животными. 1 — насекомые; 2 — хрящевые рыбы; 3 — птицы; 4 — паукообраз-
1 — однослойный эпителий; 2 — органы выделения сходны с орга- ные; 5 — костные рыбы; 6 — млекопитающие.
нами выделения кольчецов; 3 — кровеносная система незамкнутая; а) 3, 6; в) 2, 3, 5, 6; д) 6.
4 — имеется сердце, сходное по строению с сердцем моллюсков; б) 1, 4, 6; г) 1, 3, 4, 5;
5 — трубчатая нервная система; 6 — движение крови по кровенос- 23. Какие из перечисленных животных относятся к эктопаразитам (I)
ной системе осуществляется за счет сокращения сердца. и эндопаразитам (II)?
а) 2, 3; в) 3, 5, 6; д) 1, 3, 4.
б) 1, 2, 5; г) 1, 2; 1 — вошь свиная; 2 — блоха крысиная; 3 — эхинококк; 4 — лентец
широкий; 5 — минога речная; 6 — ланцетовидный сосальщик.
19. Найдите соответствие между животными и продуктами азотистого
а) I — 1, 2, 6; II — 3, 4, 5; г) I — 1, 2, 5; II — 3, 4, 6;
обмена, которые они предпочтительно выделяют.
б) I — 2, 5; II — 1, 3, 4, 6; д) I — 1; II — 2, 3, 4, 5, 6.
1 — лимнокалянус; 2 — понтопорея; 3 — ехидна; 4 — линь; 5 — аль- в) I — 3, 4, 6; II — 1, 2, 5;
батрос; 6  — планария молочно-белая; 7  — коала; 8  — скопа;
9 — байкальская нерпа; 10 — черепаха болотная. 24. У речного рака в базальном членике антеннул находятся:
I — аммиак; II — мочевина; III — мочевая кислота. а) статоцисты; г) глаза;
а) I — 1, 2, 6; II — 5, 4, 7, 9; III — 3, 8, 10; б) коксальные железы; д) ногочелюсти.
б) I — 1, 2, 4, 6; II — 3, 7, 9; III — 5, 8, 10; в) отростки печени;
в) I — 1, 3, 6; II — 2, 3, 4, 9; III — 5, 7, 8, 10;
25. Мандибулы отсутствуют у членистоногих, относящихся к классу:
г) I — 2, 4; II — 1, 3, 9; III — 5, 6, 7, 8, 10;
д) I — 1, 4, 3, 9; II — 6, 7, 8, 10; III — 2, 5. а) насекомые; г) губоногие многоножки;
б) ракообразные; д) паукообразные.
20. Выберите вид животного, для которого характерны следующие в) двупарноногие многоножки;
признаки: способность к  регенерации, отсутствуют нейроны,
фильтрационный тип питания. 26. Позвоночник пресмыкающихся состоит из отделов:
а) Дождевой червь; а) туловищного и хвостового;
б) медуза аурелия; б) шейного, туловищного и хвостового;
в) бадяга речная; в) шейного, грудного, поясничного и хвостового;
г) бычий цепень; г) шейного, грудного, поясничного, крестцового и хвостового;
д) беззубка удлиненная. д) шейного, грудного и хвостового.
34 Тестовые задания с одним правильным ответом Зоология 35

27. Выберите признаки, общие для первозверей и других млекопита- 32. У какой из личиночных стадий развития печеночного сосальщика
ющих. органы чувств развиты наиболее хорошо?
1 — наличие млечных желез; 2 — плечевой пояс с хорошо выражен- а) Марита; г) мирацидий;
ными коракоидами; 3 — наличие клоаки; 4 — отсутствие волосяно- б) спороциста; д) адолескарий.
го покрова; 5 — откладывают яйца; 6 — эндотермность. в) редия;
а) 2, 4, 5; в) 2, 3, 5; д) 1, 6. 33. Животные, у которых впервые в процессе эмбрионального раз-
б) 3, 4, 6; г) 1, 2, 3, 6; вития появляется группа клеток (крестообразная группа клеток),
расположенная между эктодермой и энтодермой, — это:
28. Какие из перечисленных организмов являются аммониотеличе­
а) шестилучевые кораллы; г) бескишечные турбеллярии;
б) восьмилучевые кораллы; д) мюллеровские личинки.
1 — крот европейский; 2 — гидра обыкновенная; 3 — уж обыкновен- в) гребневики;
ный; 4 — майский жук; 5 — короед сосновый; 6 — карась золотой;
7 — страус африканский; 8 — рысь европейская. 34. Способность воспринимать поляризованный свет известна для:
а) 1, 2, 8; в) 6, 7, 8; д) 2, 6. 1 — собак; 2 — обезьян; 3 — пчел; 4 — дафний; 5 — клопов; 6 — пла-
б) 3, 4, 5, 7; г) 1, 3, 4, 6; нарий.
а) 1, 2; в) 3, 5; д) 1, 2, 3.
29. Какие животные относятся к отряду Непарнокопытные (Peris­so­dac­ б) 3, 4, 5; г) 4, 6;
1 — тапиры; 2 — пекари; 3 — свиньи дикие; 4 — зебры; 5 — носороги; 35. Найдите соответствие между ферментами слюны и животными,
в слюне которых они находятся.
6 — гуанако; 7 — тарпаны; 8 — олени; 9 — жирафы; 10 — окапи.
I — амилазы; II — протеиназы; III — целлюлазы.
а) 1, 2, 3, 9, 10; в) 2, 5, 7, 9, 10; д) 2, 4, 6, 7.
1 — млекопитающие; 2 — пресмыкающиеся; 3 — насекомые; 4 — па-
б) 1, 4, 5, 7; г) 2, 3, 4;
уки; 5 — брюхоногие моллюски; 6 — дождевые черви.
30. Наличие каких органов зрения позволяет животным видеть изо- а) I — 1; II — 3, 4, 5; III — 6; г) I — 1; II — 3, 4; III — 5;
бражение предметов? б) I — 1, 2; II — 4, 5; III — 6; д) I — 3; II — 1, 4, 5; III — 6.
в) I — 2; II — 1, 3, 4; III — 5;
1 — фоторецепторные клетки эпидермиса; 2 — глазки с пигмент-
ным бокалом; 3 — глазные ямки; 4 — камерные глаза; 5 — глаза 36. Наличие хелицер и педипальп характерно для следующих живот-
с линзой. ных:
а) 1, 2, 4, 5; в) 4, 5; д) 1, 2, 4. 1  — нереис; 2  — сколопендра; 3  — сольпуга; 4  — лжескорпион
б) 1, 3, 5; г) 2, 3, 4; книжный; 5 — жук колорадский; 6 — сенокосец; 7 — каракатица;
8 — муха скорпионная.
31. В какой из приведенных пар видов оба вида являются гермафро-
а) 1, 2, 4, 8; в) 3, 4, 6; д) 1, 2, 3.
дитами? б) 1, 4, 5; г) 5, 6, 7;
а) Термиты, циклопы;
б) пауроподы, ногохвостки; 37. Гипобранхиальная борозда (эндостиль) характерна для:
в) морские желуди, морские уточки; а) ланцетника; г) кошачьей акулы;
г) омары, осы-блестянки; б) азиатской черепахи; д) стерляди.
д) морские пауки, морские крабы. в) нереиса;
36 Тестовые задания с одним правильным ответом Зоология 37

38. Наличие вторичной полости тела (целома) характерно для пред- 44. Укажите насекомых, развивающихся с полным метаморфозом.
ставителей этих классов животных: 1 — вши; 2 — блохи; 3 — жесткокрылые; 4 — стрекозы; 5 — ручей-
1  — Turbellaria; 2  — Nematoda; 3  — Polychaeta; 4  — Amphibia; ники; 6 — тли.
5 — Cestoda; 6 — Oligochaeta. а) 1, 2, 4; в) 1, 2, 3, 4; д) 3, 4, 5, 6.
а) 1, 3, 5; в) 2, 3, 4; д) 1, 6. б) 2, 3, 6; г) 2, 3, 5;
б) 3, 4, 6; г) 1, 2, 5;
45. К какому классу относится чесоточный зудень?
39. Выберите личинок ракообразных.
а) Insecta; г) Oligochaeta;
1 — трохофора; 2 — велигер; 3 — науплиус; 4 — зоеа; 5 — метанау-
б) Crustacea; д) Polychaeta.
плиус; 6 — мюллеровская личинка.
в) Arachnida;
а) 1, 2, 3, 6; в) 1, 3, 4, 6; д) 2, 5, 6.
б) 2, 3, 5; г) 3, 4, 5; 46. Одна из стадий развития печеночного сосальщика — это:
40. Движение морской звезды осуществляется благодаря работе си- а) мирацидий; г) финна;
стемы: б) плероцеркоид; д) онкосфера.
а) перигемальной; г) кровеносной; в) корацидий;
б) амбулакральной; д) выделительной.
47. Некоторые ученые объединяют птиц и пресмыкающихся в общую
в) нервной;
группу зауропсид. Какой ископаемый организм сочетал в себе при-
41. Плакоидная чешуя характерна для: знаки этих классов?
1 — ската хвостокола; 2 — леща; 3 — судака; 4 — белуги; 5 — коша- а) Ихтиостег; г) археоптерикс;
чьей акулы; 6 — осетра русского. б) стегоцефал; д) латимерия.
а) 1, 5; в) 4, 6; д) 2, 3, 4, 6. в) иностранцевия;
б) 2, 3; г) 1, 4, 5, 6;
48. Укажите виды рыб, для которых характерно живорождение.
42. Укажите класс животных, представителям которого соответ-
ствует следующая характеристика: гомойотермные амниоты, 1 — молот-рыба; 2 — колюшка трехиглая; 3 — белуга; 4 — прото­
правая дуга аорты, клоака, губчатые легкие. птерус; 5 — скат-хвостокол; 6 — кунья акула.
а) Amphibia; г) Aves; а) 1, 3, 4, 6; в) 2, 4, 6; д) 2, 6.
б) Reptilia; д) Mammalia. б) 1, 5, 6; г) 1, 3, 5;
в) Insecta;
49. У птиц, чтобы достигнуть правой дуги аорты, кровь из правого
43. Назовите отдел многокамерного желудка жвачных животных,
желудочка должна последовательно пройти по:
в котором происходит расщепление пищи под действием фермен-
тов желудка: 1 — легочным венам; 2 — легочным артериям; 3 — правому пред-
а) книжка; сердию; 4 — левому предсердию; 5 — левому желудочку; 6 — ниж-
б) рубец; ней полой вене.
в) сычуг; а) 1 → 2 → 5 → 4; г) 2 → 1 → 5 → 4;
г) сетка; б) 3 → 2 → 4 → 5; д) 6 → 3 → 4 → 5.
д) пища в желудке не расщепляется. в) 2 → 1 → 4 → 5;
38 Тестовые задания с одним правильным ответом Зоология 39

50. Укажите животных, которые занесены в Международную Черную 56. Какие изменения в кровеносной системе амфибий способствовали
книгу (список исчезнувших животных Земли). выходу земноводных на сушу?
1 — сапсан; 2 — стеллерова корова; 3 — ехидна; 4 — тарпан; 5 — вом- а) Спинной и брюшной сосуды;
бат; 6 — дронт. б) двухкамерное сердце;
а) 2, 3, 4; в) 2, 4, 6; д) 1, 3, 6. в) трехкамерное сердце и 1 круг кровообращения;
б) 1, 2, 4, 5; г) 4, 5, 6; г) трехкамерное сердце и 2 круга кровообращения;
51. Жизненный цикл дафнии проходит по типу: д) кожное дыхание.
а) гаметогамии; г) метагенеза; 57. Крылья у насекомых располагаются на сегментах:
б) партеногенеза; д) редупликации. а) груди и брюшка; г) головогруди и брюшка;
в) гетерогонии; б) только груди; д) только брюшка.
52. Органы, расположенные попарно в каждом сегменте у дождевого в) головогруди;
червя и состоящие из воронки с ресничками и  извитой трубочки, 58. Сперматозоиды и яйцеклетки у сцифоидных медуз образуются в:
которая открывается на боковой стороне тела, входят в состав
системы: а) эктодерме;
б) энтодерме;
а) пищеварительной; г) нервной;
в) мезоглее;
б) выделительной; д) органов чувств.
в) кровеносной; г) базальной мембране;
д) нет правильного ответа.
53. Структура, которая отсутствует у двустворчатых моллюсков (по
59. У большинства представителей подкласса Высшие раки (Mala­
сравнению с брюхоногими моллюсками), — это:
costraca) органами выделения во взрослом состоянии являются:
а) радула; г) сердце;
б) нога; д) почки. а) максиллярные железы; г) мальпигиевы сосуды;
в) печень; б) антеннальные железы; д) тазовые почки.
в) протонефридии;
54. Промысловыми видами ракообразных являются:
60. Органами дыхания у паука-крестовика служат:
1 — устрицы; 2 — мидии; 3 — омары; 4 — крабы; 5 — кальмары;
6 — голотурии. а) только легочные мешки;
а) 2, 3, 4; в) 2, 3, 6; д) 1, 2, 5. б) только трахеи;
б) 3, 4; г) 4, 5, 6; в) легочные мешки и трахеи;
г) кожные покровы и легкие;
55. Выберите признаки, характерные для прудовика (I) и беззубки (II). д) жабры.
1 — раздельнополый организм; 2 — тело разделено на голову, туло-
вище и ногу; 3 — жаберное дыхание; 4 — развитие без метаморфоза; 61. Развитие многощетинковых червей протекает:
5 — имеется радула; 6 — раковина двустворчатая; 7 — имеются а) с метаморфозом, личинка трохофора;
слюнные железы. б) с метаморфозом, личинка пилидий;
а) I — 1, 2, 4, 7; II — 1, 3, 5, 6; г) I — 2, 3, 4, 5; II — 1, 6, 7; в) без метаморфоза, личиночных стадий нет;
б) I — 2, 4, 5, 7; II — 1, 3, 6; д) I — 5, 7; II — 1, 2, 3, 4, 6. г) с неполным метаморфозом, личинка наяда;
в) I — 1, 3, 6; II — 2, 4, 5, 7; д) нет правильного ответа.
40 Тестовые задания с одним правильным ответом Зоология 41

62. Укажите особенности строения плоских червей, которые можно 68. Взрослая (дефинитивная) стадия развития насекомых — это:
отнести к алломорфозам (идиоадаптациям): а) нимфа; г) куколка;
а) двусторонняя симметрия тела; б) имаго; д) марита.
б) разнообразные органы прикрепления (крючья, присоски, бот­рии); в) наяда;
в) первичная полость тела;
69. Первая личиночная стадия многих ракообразных (циклопы и др.),
г) формирование трех зародышевых листков.
ведущая планктонный образ жизни, — это:
63. Основной функцией гемолимфы насекомых является: а) науплиус; г) мюллеровская личинка;
а) резервирование питательных веществ в организме; б) зоеа; д) трохофора.
б) выведение из гемоцеля конечных продуктов метаболизма и их в) велигер;
экскреция в заднюю кишку; 70. Паразитирующая на рыбах личинка пресноводных двустворчатых
в) снабжение тканей и органов кислородом и выведение из них моллюсков семейства Перловицы (Unionidae) — это:
углекислого газа;
а) нимфа; г) корацидий;
г) снабжение тканей и органов питательными веществами и транс-
б) глохидий; д) цистицерк.
порт конечных продуктов метаболизма;
в) мирацидий;
д) опорная функция.
71. Разновидность костной ткани, входящая в состав плакоидной че-
64. Рептилий от амфибий отличает: шуи рыб и составляющая основную массу зуба млекопитающих,
а) замкнутая кровеносная система; называется:
б) наличие клоаки; а) дентин; г) космин;
в) трехкамерное сердце; б) гоноин; д) коллаген.
г) метанефрическая почка; в) эмаль;
д) строение передних конечностей.
72. Укажите отряд вторичноводных млекопитающих, лишенных во-
65. У хрящевых рыб чешуя: лосяного покрова и кожных желез:
а) ганоидная; г) плакоидная; а) Ластоногие; г) Китообразные;
б) космоидная; д) костная ктеноидная. б) Хищные; д) Трубкозубые.
в) костная циклоидная; в) Хоботные;
66. К животным с радиальным типом симметрии относятся: 73. Скопление ядовитых желез, расположенных по бокам головы
а) аскарида, актиния, майский жук; у жаб называется:
б) губка-бадяга, дождевой червь, устрица; а) паротиды; г) уростиль;
в) каракатица, луна-рыба, офиура; б) жало; д) тельсон.
г) офиура, актиния, аурелия; в) чернильная железа;
д) стеклянная губка, дождевой червь, острица.
74. Структурная единица фасеточного глаза членистоногих со све-
67. Соединительнотканный мешок, окружающий сердце некоторых топреломляющим, светочувствительным и  светоизолирующим
беспозвоночных и всех позвоночных, — это: аппаратом — это:
а) миокард; г) перикард; а) палочка; г) радужка;
б) предсердие; д) луковица аорты. б) омматидий; д) сетчатка.
в) желудочек; в) колбочка;
42 Тестовые задания с одним правильным ответом Зоология 43

75. Гибкая хитиноидная пластинка, несущая ряды зубцов в  глотке 81. Многие дельфины способны долго находиться под водой. Это свя-
у брюхоногих моллюсков, — это: зано с:
а) радула; г) челюсть; а) отсутствием шерстного покрова и способностью поглощать кис-
б) раковина; д) язык. лород через покровы тела;
в) кутикула; б) наличием четырехкамерного сердца и двух кругов кровообра-
76. Третий отдел многокамерного желудка жвачных животных, со- в) пониженной чувствительностью дыхательного центра к нако-
единяющий сетку с сычугом, называется: плению в крови углекислого газа;
а) аппендикс; г) панкреас; г) наличием в ротовой полости скрытых жабр;
б) книжка; д) стома. д) нет верного ответа.
в) рубец;
82. Личинкой сцифоидных медуз является:
77. Твердые образования (чаще состоящие из минерального веще- а) эфира;
ства), расположенные в органах равновесия ряда беспозвоночных б) пелидий;
и всех позвоночных, — это: в) глохидий;
а) отолиты; г) статоцисты; г) мирацидий;
б) остеоны; д) статобласты. д) корацидий.
в) остеобласты;
83. Выберите верное утверждение:
78. Самопроизвольное отбрасывание конечностей, хвоста или других а) все первичноротые имеют кровеносную систему;
частей тела у животных — это: б) все вторичноротые имеют кровеносную систему;
а) танатоз; г) автогамия; в) развитие с  метаморфозом характерно только для первично­
б) регенерация; д) автоинвазия. ротых;
в) автотомия; г) у всех первичноротых образование мезодермы происходит эн-
тероцельным способом;
79. Членик ноги членистоногих, подвижно соединяющий тазик и бе- д) у всех вторичноротых образование целома происходит тело­
дро, — это: бластическим способом.
а) вертлуг; г) эпиподит;
84. Выберите признаки, характеризующие всех плоских червей.
б) лапка; д) базиподит.
в) протоподит; 1  — пространство между кожно-мускульным мешком и  вну-
тренними органами заполнено паренхимой; 2 — кожно-мускуль-
80. Провизорный орган, обеспечивающий питание, дыхание и крове­ ный мешок состоит из слоя эпителия и  одного слоя мускула-
творение у зародышей костных рыб, — это: туры; 3  — органы выделения  — протонефридии; 4  — развитие
а) желточный мешок; без метаморфоза; 5  — имеют присоски; 6  — трехслойные жи-
б) аллантоис; вотные.
в) амнион; а) 1, 3, 4; г) 1, 2, 5;
г) хориоаллантоис; б) 1, 3, 6; д) 2, 3, 5.
д) белковая оболочка. в) 2, 4, 5;
44 Тестовые задания с одним правильным ответом Анатомия и физиология человека 45

85. Хлорагогенные клетки, расположенные у дождевого червя на по- Анатомия и физиология человека
верхности кишечника, участвуют в:
1. Определите жизненную емкость легких спортсмена, если извест-
а) пищеварении;
но, что дыхательный объем равен 700 мл, дополнительный объ-
б) размножении;
ем — 2000 мл, резервный — 2500 мл, а общий объем легких со-
в) выделении;
ставляет 6000 мл:
г) образовании клеток крови;
д) нейтрализации гуминовых кислот, попадающих в  кишечник а) 1550 мл; г) 4500 мл;
с пищей. б) 3050 мл; д) 2700 мл.
в) 5300 мл;
86. Из перечисленных классов животных к вторичноротым отно­сятся:
1 — Scyphozoa; 2 — Oligochaeta; 3 — Cephalochordata; 4 — Gastropoda; 2. Двустворчатый клапан расположен между:
5 — Reptilia; 6 — Asteroidea; 7 — Crustacea. а) левым предсердием и левым желудочком;
а) 3, 5, 6; г) 1, 3, 7; б) правым предсердием и правым желудочком;
б) 1, 5, 6; д) 4, 7. в) левым желудочком и аортой;
в) 2, 3, 5, 7; г) правым желудочком и легочной артерией;
д) легочными венами и левым предсердием.
87. Подтип Оболочники (Tunicata) входит в состав типа:
3. Центральный отдел зрительного анализатора располагается в:
а) Chordata; в) Annelida;
б) Echinodermata; г) Arthropoda. а) теменной доле коры больших полушарий;
б) продолговатом мозгу;
88. Функцию яйцевода у птиц и рептилий выполняет(-ют): в) мозжечке;
а) вольфов канал; г) евстахиева труба; г) среднем мозгу;
б) мочеточники; д) задняя кишка. д) затылочной доле коры больших полушарий.
в) мюллеров канал;
4. Укажите, какие положения верно характеризуют условные реф-
89. Атлант и эпистрофей — это позвонки: лексы человека.
а) шейного отдела позвоночника рыб; 1 — врожденные, наследственно передающиеся реакции организ-
б) шейного отдела позвоночника рептилий; ма; 2 — являются индивидуально специфичными; 3 — появляют-
в) грудного отдела позвоночника птиц; ся при первом же воздействии раздражителя; 4 — непостоянны;
г) шейного отдела позвоночника амфибий; 5 — рефлекторные дуги замыкаются в коре больших полушарий;
д) крестцового отдела позвоночника рептилий. 6 — характерны только для млекопитающих.
90. Хищная птица-ихтиофаг, обычно гнездится по берегам крупных а) 2, 3, 5; в) 1, 4, 6; д) 2, 4, 5.
водоемов: б) 1, 3, 6; г) 3, 5, 6;
а) скопа; г) канюк; 5. Найдите соответствие между эндокринными железами и гормона-
б) ястреб-перепелятник; д) лунь болотный. ми, которые они выделяют.
в) черный коршун; I — передняя доля гипофиза; II — задняя доля гипофиза; III — кора
надпочечников; IV — щитовидная железа.
1 — аспаротоцин; 2 — соматотропин; 3 — кортизол; 4 — тироксин.
46 Тестовые задания с одним правильным ответом Анатомия и физиология человека 47

а) I — 1, II — 3; III — 2; IV — 4; г) I — 3, II — 4; III — 1; IV — 2; 11. Ствол головного мозга человека включает:
б) I — 2, II — 3; III — 4; IV — 1; д) I — 4, II — 1; III — 2; IV — 3. 1 — кору больших полушарий; 2 — мост; 3 — ретикулярную фор-
в) I — 2, II — 1; III — 3; IV — 4; мацию; 4— спинной мозг; 5 — гипоталамус; 6 — блуждающий нерв.
6. Найдите утверждение, неверное в отношении лимфы: а) 1, 2, 3; в) 1, 4, 6; д) 2, 4, 5, 6.
б) 2, 3, 4; г) 2, 3, 5;
а) формируется из тканевой жидкости;
б) содержит лейкоциты; 12. Вазопрессин:
в) омывает все клетки; а) усиливает выход кальция из костей в кровь;
г) по химическому составу близка к плазме крови; б) увеличивает секрецию соматотропина;
д) содержит фибриноген. в) усиливает реабсорбцию ионов Na+;
г) усиливает поглощение воды стенками дистального извитого
7. Выберите эффекты, возникающие в организме человека под воз- канальца нефрона;
действием парасимпатической нервной системы. д) стимулирует выделение тестостерона.
1 — угнетает слюноотделение; 2 — расширяет бронхи; 3 — стиму- 13. Сокращение сердечной мышцы может усилить:
лирует слезотечение; 4 — повышает кровяное давление; 5 — сти-
1  — стимуляция электрическим током блуждающего нерва;
мулирует секрецию пищеварительных соков; 6 — сужает зрачки.
2 — стимуляция симпатических нервов, идущих к сердцу; 3 — по-
а) 1, 2, 6; в) 1, 6; д) 3, 4, 5. вышение концентрации K+ в плазме крови; 4 — повышение кон-
б) 2, 3, 5; г) 3, 5, 6; центрации Ca2+ в плазме крови.
8. Водянистая влага глаза находится между: а) 2, 3; б) 1, 2, 4; в) 2, 4; г) 1, 2.
а) глазом и глазницей; 14. Укажите аминокислоты, которые могут быть синтезированы в ор-
б) хрусталиком и роговицей; ганизме человека.
в) сосудистой оболочкой и сетчаткой; 1 — лейцин; 2 — серин; 3 — пролин; 4 — изолейцин; 5 — треонин;
г) сетчаткой и глазным нервом. 6 — глутамин; 7 — аспарагин.
а) 1, 4, 5; в) 2, 3, 4, 6; д) 1, 3, 6.
9. Вторая пара черепно-мозговых нервов человека иннервирует: б) 1, 2, 4, 5; г) 2, 3, 6, 7;
а) глотку; г) кишечник; 15. Центр дыхания находится в:
б) сетчатку; д) мышцы челюстей.
а) мозжечке;
в) полукружные каналы;
б) спинном мозге;
10. Мужчина пострадал в  автомобильной аварии, ему необходимо в) таламусе;
срочное переливание крови. Анализ показал, что его группу крови г) продолговатом мозге;
определяют агглютиноген А и агглютинин β. Выберите из пред- д) затылочной области коры больших полушарий.
ложенных вариантов подходящего донора. 16. Укажите признаки, характерные для клеток гладкой мышечной
1 — женщина с кровью, содержащей агглютиноген А и агглютинин β; ткани.
2 — мужчина с кровью, содержащей агглютиноген В и агглютинин α; 1 — входят в состав скелетных мышц; 2 — длина 1—40 мм; 3 — дли-
3 — женщина с кровью, содержащей только агглютиноген АВ; 4 — на 0,1 мм; 4 — имеют веретенообразную форму; 5 — клетки много-
мужчина с кровью, содержащей только агглютинин α и β. ядерные; 6 — клетки одноядерные; 7 — работают непроизвольно.
а) 1, 2; в) 1, 4; д) 3, 4. а) 1, 3, 5; в) 2, 4, 5; д) 3, 4, 6, 7.
б) 2, 4; г) 1, 3; б) 1, 3, 5, 7; г) 2, 4, 6;
48 Тестовые задания с одним правильным ответом Анатомия и физиология человека 49

17. Восприятие цвета у человека обеспечивают структуры: 8 — образует язык; 9 — входит в состав стенок лимфатических
а) колбочки; г) простые глазки; сосудов.
б) палочки; д) вкусовые почки. а) 1, 4, 7, 8; г) 3, 5, 7, 8;
в) омматидии; б) 2, 4, 6, 9; д) 1, 3, 5, 6, 9.
в) 1, 4, 6, 9;
18. Череп человека отличается от черепа других млекопитающих:
24. Канал, соединяющий полость среднего уха с носоглоткой у чело-
а) наличием подвижного сочленения верхней и нижней челюстей; века, называется:
б) преобладанием мозгового отдела черепа над лицевым;
а) фаллопиева труба; г) наружный слуховой канал;
в) наличием швов между костями мозгового отдела;
б) евстахиева труба; д) носовой канал.
г) особенностью строения костной ткани; в) сильвиев водопровод;
д) наличием непарной лобной кости.
25. Вещества, которые воспринимаются организмом как чужеродные
19. Основной водитель ритма сердца расположен в: и вызывают специфический иммунный ответ, — это:
а) левом предсердии; в) левом желудочке; а) антигены; г) липиды;
б) правом предсердии; г) правом желудочке. б) антитела; д) протеины.
в) углеводы;
20. Ответная реакция организма на раздражение рецепторов, осущест-
вляемая при участии ЦНС, — это: 26. Гормон, вырабатываемый пилорической частью желудка челове-
ка, — это:
а) синапс; г) сократимость;
а) гастрин; г) окситоцин;
б) рефлекс; д) доминанта.
б) ренин; д) вазопрессин.
в) возбуждение;
в) инсулин;
21. Более 70 % всех лейкоцитов крови в норме могут составлять: 27. У человека при недостатке инсулина:
а) нейтрофилы; г) эозинофилы; а) повышен уровень глюкозы в крови;
б) базофилы; д) нет правильного ответа. б) усиливается процесс реабсорбции воды в почках;
в) моноциты; в) во вторичной моче высокое содержание белков;
г) развивается заболевание полиневрит;
22. Нейроны, высвобождающие медиатор ацетилхолин, называются: д) понижен уровень глюкозы в крови.
а) адреноэргические; г) диэтиламидовые;
28. Отдел пищеварительной системы человека, в котором начинается
б) холинэргические; д) дофаминовые. переваривание углеводов:
в) электрические;
а) толстый кишечник;
23. Укажите признаки, характерные для гладкой мышечной ткани. б) желудок;
в) пищевод;
1 — миоциты веретеновидной формы; 2 — миоциты разветвлены
г) двенадцатиперстная кишка;
и образуют между собой соединения — вставочные диски; 3 — мио-
д) ротовая полость.
циты имеют большую длину и содержат много ядер; 4 — медленно
сокращается и расслабляется; 5 — клетки сокращаются ритмич- 29. Структурная единица компактного вещества кости, состоящая
но под действием возбуждения, возникающего в самих клетках; из 5—20 вставленных один в один полых цилиндров, образован-
6 — со­кращается непроизвольно; 7 — сокращается произвольно; ных костной тканью, — это:
50 Тестовые задания с одним правильным ответом Анатомия и физиология человека 51

а) остеобласт; г) остеон; 36. Какое утверждение, характеризующее лимфатическую систему,

б) остеокласт; д) хондробласт. является неверным?
в) остеоцит; а) В состав лимфатической системы входят узлы и сосуды;
30. Наружная соединительнотканная оболочка кости — это: б) лимфа попадает в венозный кровоток большого круга крово­
а) диафиз; г) остеон; обращения;
б) периост; д) губчатое вещество. в) лимфа образуется из плазмы крови;
в) эпифиз; г) жидкость, проникающая из крови в ткани, собирается в лимфа-
31. Физиологически активные вещества, посредством которых в нерв- тические капилляры;
ной системе осуществляются контактные межклеточные взаимо- д) лимфа движется по сосудам благодаря сокращению окружаю-
действия, — это: щих мышц.
а) алломоны; г) нейротрансмиттеры;
37. Медицинские препараты, используемые женщинами для контра-
б) феромоны; д) нейроглия.
цепции, содержат гормон:
в) гормоны;
а) вазопрессин; г) окситоцин;
32. Тонкая подвижная диафрагма глаза человека с отверстием в цен-
б) пролактин; д) прогестерон.
тре, расположенная позади роговицы, — это:
в) тестостерон;
а) склера; г) сетчатка;
б) радужка; д) зрачок. 38. Найдите верные утверждения.
в) роговица;
1  — в  щитовидной железе образуется эритропоэтин, который
33. В общем объеме крови человека содержится … % клеток крови стимулирует образование эритроцитов; 2 — гипофиз продуциру-
и … % плазмы: ет тестостерон, который влияет на развитие вторичных половых
а) 25 и 85; в) 45 и 55; д) 75 и 35. признаков; 3 — альдостерон вырабатывается корковым веществом
б) 35 и 75; г) 65 и 45; надпочечников и участвует в удержании натрия в организме; 4 —
34. В дуге соматического рефлекса тело чувствительного нейрона рас- α-клетки островков Лангерганса вырабатывают глюкагон, кото-
положено в: рый инициирует распад гликогена печени; 5 — паратгормон выра-
а) спинномозговом ганглии; батывается паращитовидной железой и способствует сокращению
б) паравертебральном или превертебральном ганглии; мускулатуры матки во время родов; 6 — клетки Лейдинга семен-
в) передних рогах спинного мозга; ников вырабатывают прогестерон, который влияет на развитие
г) средних рогах спинного мозга; организма по мужскому типу.
д) задних рогах спинного мозга. а) 1, 2, 5; в) 1, 3, 6; д) 3, 4.
35. Желудочки головного мозга расположены в таком порядке (от б) 2, 3, 4; г) 2, 3, 4, 5;
центрального канала спинного мозга):
39. При разрушении эритроцитов в печени человека железо, входящее
а) сильвиев водопровод → 1 → 2 → 3 → 4;
в состав гема, связывается с белком с образованием:
б) 4 → сильвиев водопровод → 3 → 2 → 1;
в) 1 → 2 → сильвиев водопровод → 3 → 4; а) ферритина; г) гемоцианина;
г) 4 → 3 → 2 → 1; б) гемоглобина; д) оксида железа(III).
д) 4 → 3 → 2 → 1→ сильвиев водопровод. в) гемэритрина;
52 Тестовые задания с одним правильным ответом Анатомия и физиология человека 53

40. Какая из функций характерна для печени? 47. Найдите перечень веществ и структур, принимающих непосред-
а) Выделение пищеварительных ферментов; ственное участие в процессе свертывания крови у человека:
б) участие в синтезе витамина В12; а) эритроциты, тромбин, фибрин, гамма-глобулин;
в) синтез гормонов, регулирующих уровень глюкозы; б) базофилы, гамма-глобулин, тромбин, фибриноген;
г) деление мегакариоцитов. в) эритроциты, фибрин, тромбоциты, альфа-глобулины;
41. В какую часть двенадцатиперстной кишки открываются желчный г) тромбоциты, тромбин, протромбин, фибрин;
и панкреатические протоки? д) фибрин, протромбин, тромбоциты, нейтрофилы.
а) Восходящую; г) верхнюю;
48. Найдите соответствие между ферментами или их предшественни-
б) нисходящую; д) нет верного ответа.
ками и органами, в которых они образуются.
в) горизонтальную;
1 — трипсиноген; 2 — липаза; 3 — химотрипсиноген; 4 — мальтаза;
42. При аллергических реакциях в организме человека возрастает ко-
5 — пепсин; 6 — амилаза.
а — тонкий кишечник; б — поджелудочная железа; в — желудок;
а) нейтрофилов; г) эритроцитов; г — печень; д — слюнная железа.
б) моноцитов; д) тромбоцитов.
в) эозинофилов; а) 1б, 2абв, 3б, 4ад, 5в, 6бд; г) 1д, 2г, 3б, 4в, 5в, 6аб;
б) 1а, 2в, 3бв, 4а, 5г, 6бд; д) 1гд, 2а, 3б, 4д, 5в, 6абд.
43. Вещество, которое позволяет поддерживать в мышцах определен- в) 1в, 2а, 3г, 4д, 5бд, 6в;
ный уровень АТФ во время мышечных сокращений, — это:
а) актин; г) миоглобин; 49. Какой из перечисленных ферментов расщепляет белки до пепто-
б) креатинин; д) креатинфосфат. нов и полипептидов?
в) миозин; а) Птиалин; г) химотрипсин;
44. В отличие от хрусталика роговица: б) нуклеаза; д) амилаза.
а) входит в состав вспомогательного аппарата глаза; в) липаза;
б) обладает большей преломляющей способностью; 50. Какое событие приведет к повышению артериального давления?
в) образована из эктодермы;
г) является элементом зрительной сенсорной системы; а) Снижение тонуса симпатической нервной системы;
д) является элементом, через который проходит луч света. б) снижение тонуса парасимпатической нервной системы;
в) снижение тонуса соматической нервной системы;
45. На уровне IV—V грудных позвонков происходит:
г) снижение тонуса гладкомышечных клеток стенки артериол;
а) разделение трахеи на бронхи; д) уменьшение сердечного выброса.
б) разделение бронхов на бронхиолы;
в) впадение пищевода в желудок; 51. Корковые нефроны отличаются от юкстамедуллярных тем, что
г) переход ротоглотки в носоглотку; у них:
д) переход глотки в пищевод.
а) отсутствует мальпигиево тельце;
46. Процесс образования первичной мочи — это: б) извитые канальцы 2-го порядка впадают в почечную лоханку;
а) реабсорбция; г) фагоциоз; в) более короткая петля Генле;
б) секреция; д) пиноцитоз. г) в петле Генле не происходит реадсорбция воды;
в) фильтрация; д) почечные тельца расположены в мозговом слое почки.
54 Тестовые задания с одним правильным ответом Анатомия и физиология человека 55

52. Отдел нервной системы, являющийся главным координирующим 58. Укажите анатомические образования, характерные для прямой
центром вегетативной нервной системы, — это: кишки.
а) передний мозг; г) средний мозг; 1 — поперечные складки; 2 — кишечные ворсинки; 3 — групповые
б) мозжечок; д) спинной мозг. лимфоидные узелки; 4 — продольные складки.
в) гипоталамус; а) 1, 4; г) 2, 4;
б) 1, 2, 3; д) 1, 3.
53. Вещество, которое препятствует свертыванию крови, называется:
в) 2;
а) гистамин; г) гистидин;
б) фибриноген; д) гепарин. 59. Не входит в состав тонкого кишечника человека кишка:
в) амилаза; а) двенадцатиперстная; г) тощая;
54. В результате травмы у мужчины пострадал небольшой участок б) подвздошная; д) нет верного ответа.
коры больших полушарий. Продолжительное лечение не позво- в) слепая;
лило полностью восстановить функции организма. У мужчины 60. Самое высокое давление крови наблюдается в капиллярах:
была потеряна чувствительность участка кожи на ноге. Какой уча-
сток коры больших полушарий вероятнее всего был поврежден? а) кожи;
б) почек;
а) Левая височная доля; г) затылочная доля; в) селезенки;
б) правая височная доля; д) лобная доля. г) легких;
в) теменная доля; д) головного мозга.
55. Каким образом влияет на частоту сердечных сокращений повы-
шение рН крови? 61. Неподвижное соединение костей с помощью швов характерно для:
а) грудной клетки;
а) Повышает;
б) черепа;
б) понижает;
в) позвоночника;
в) частота сердечных сокращений не изменяется;
г) верхней конечности;
г) повышается только число систол предсердий;
д) нижней конечности.
д) повышается только число систол желудочков.
56. В состав кишечного сока не входит фермент: 62. При частоте ритма 70 ударов в минуту систо­ла желудочка сердца
человека будет длиться:
а) пепсин; г) аминопептидаза;
б) липаза; д) лактаза. а) 0,1 с; г) 0,4 с;
в) мальтаза; б) 0,2 с; д) 0,8 с.
в) 0,3 с;
57. Укажите структуры, обеспечивающие функционирование вести-
булярного аппарата человека. 63. Участие печени в процессе пищеварения заключается в:
1 — улитка; 2 — полукружные каналы; 3 — кортиев орган; 4 — слу- а) синтезе и секреции ферментов, расщепляющих белки;
ховые косточки; 5 — круглый мешочек; 6 — овальный мешочек; б) синтезе и секреции соединений, эмульгирующих липиды;
7 — мембрана овального окна. в) расщеплении макромолекулярных соединений пищи на низко-
а) 1, 2, 3; г) 2, 5, 6; молекулярные фракции;
б) 1, 2, 4, 5, 7; д) 3, 4, 7. г) превращении глюкозы в гликоген и обратно;
в) 2; д) синтезе ферментов, расщепляющих липиды.
56 Тестовые задания с одним правильным ответом Анатомия и физиология человека 57

64. Наибольшее содержание кислорода в крови: 69. Клапаны сердца образуются за счет выростов:
а) артерий малого круга кровообращения; а) миокарда; г) эпикарда;
б) вен малого круга кровообращения; б) эндокарда; д) всего перечисленного.
в) капилляров большого круга кровообращения; в) перикарда;
г) вен большого круга кровообращения;
70. Передние корешки спинномозговых нервов образованы аксона-
д) нет правильного ответа.
ми нейронов:
65. В основном из эпителиальной ткани состоит: а) только двигательных;
а) сердце; г) слюнная железа; б) только чувствительных;
б) желудок; д) гипоталамус. в) только вставочных;
в) язык; г) вставочных и чувствительных;
д) вставочных, чувствительных и двигательных.
66. Минимальным содержанием межклеточного вещества характери-
зуется ткань: 71. Гормон, взаимодействующий с ядерными рецепторами клетки-ми-
шени, — это:
а) рыхлая волокнистая соединительная;
б) плотная волокнистая соединительная; а) адреналин; г) трийодтиронин;
в) мышечная; б) инсулин; д) глюкагон.
в) соматотропин;
г) нервная;
д) эпителиальная. 72. Остеоны располагаются перпендикулярно вертикальной оси в ко-
67. В состав лицевого отдела черепа входят кости:
а) плоских; г) смешанных и плоских;
а) непарные скуловая, височная, теменная, лобная, затылочная;
б) губчатых; д) во всех типах костей.
б) парные височная и  теменная; непарные затылочная, лобная,
в) трубчатых;
клиновидная и решетчатая;
в) парные слезная и  верхнечелюстная; непарные подъязычная 73. В нервной ткани человека:
и скуловая; а) количество нейронов значительно меньше количества клеток
г) парные верхнечелюстная и скуловая; непарные нижнечелюст- нейроглии;
ная и подъязычная; б) отношение нейронов к клеткам нейроглии непостоянно и может
д) парные скуловая, теменная, лобная и затылочная. колебаться;
в) количество нейронов равно количеству клеток нейроглии;
68. Отдел головного мозга, которому соответствует следующее опи-
г) количество нейронов значительно больше количества клеток
сание: «Состоит из двух полушарий; имеет кору из серого веще-
ства; в сером веществе содержатся клетки Пуркинье, от которых
отходит множество дендритов; обеспечивает координированную 74. В крови II группы можно обнаружить:
работу всех мышц», — это: 1 — агглютиноген А; 2 — агглютиноген В; 3 — агглютинин β; 4 — аг-
а) передний мозг; г) средний мозг; глютинин α.
б) мозжечок; д) продолговатый мозг. а) 1, 3; в) 1, 4; д) 1, 2.
в) гипоталамус; б) 2, 4; г) 2, 3;
58 Тестовые задания с одним правильным ответом Цитология. Эмбриология. Генетика. Экология. Молекулярная биология 59

75. Гормон, вырабатываемый в сердце, регулирует: Цитология. Эмбриология. Генетика. Экология.

1 — объем крови в организме; 2 — ионный состав плазмы крови; Молекулярная биология
3 — клеточный состав крови; 4 — насыщенность крови кислородом;
5 — иммунный ответ. 1. Органелла, которую можно описать следующим образом: «Дву-
а) 1, 2, 3, 5; в) 1, 2; д) 4, 5. мембранная, содержащая студенистую строму, граны и структуры,
б) 2, 4; г) 2, 3; обеспечивающие биосинтез», — это:
76. Двигательная единица — это совокупность: а) ядро;
б) митохондрия;
а) мышечных волокон одной мышцы; в) хлоропласт;
б) мышечных волокон, иннервируемых одним мотонейроном; г) комплекс Гольджи;
в) актина и миозина одной мышцы;
д) шероховатый эндоплазматический ретикулум.
г) мышц-разгибателей;
д) мышц-сгибателей. 2. Фактор, уровень которого в качественном и количественном от-
ношении оказывается близким к пределам выживаемости, назы-
77. Если лабораторным крысам ввести ингибитор протеолиза, будет
нарушен синтез:
а) лимитирующий; г) биотический;
а) ацетилхолина; г) дофамина;
б) антропогенный; д) абиотический.
б) эпинефрина; д) γ-аминомасляной кислоты.
в) широкоспециализированный;
в) энкефалинов и эндорфинов;
3. Гомологичными органами являются:
78. Первый тон сердца возникает в:
а) лапа кошки и конечность медведки;
а) начале систолы предсердий;
б) начале диастолы желудочков; б) глаз человека и глаз паука;
в) начале систолы желудочков; в) передняя конечность нерпы и крыло птицы;
г) конце диастолической паузы; г) крыло бабочки и крыло летучей мыши;
д) конце диастолы желудочков. д) верхняя челюсть собаки и мандибулы жука-носорога.

79. Всасывание жирорастворимых витаминов зависит от: 4. Найдите соответствие между белками и выполняемыми ими функ-
а) количества поступающей в кишечник желчи;
б) концентрации в крови паратгормона; 1 — коллаген; 2 — пепсин; 3 — кератин; 4 — иммуноглобулин; 5 —
в) количества пепсина; гемоглобин; 6 — фибриноген; 7 — гемоцианин; 8 — глутаминсин-
г) концентрации кислоты, выделяемой железами желудка; тетаза.
д) наличия особых бактерий в тонком кишечнике. I — структурные белки; II — ферменты; III — транспортные белки;
IV — защитные белки.
80. Железа, которая не является производной эпителиальной тка- а) I — 1, 5; II — 2, 4; III — 7, 8; IV — 3, 6;
ни, — это: б) I — 3; II — 2, 8; III — 1, 4, 5; IV — 6, 7;
а) нейрогипофиз; г) яичники; в) I — 1, 3; II — 2, 8; III — 5, 7; IV — 4, 6;
б) аденогипофиз; д) поджелудочная. г) I — 1, 2; II — 3, 8; III — 5, 7; IV — 4, 6;
в) щитовидная; д) I — 4; II — 1, 3, 2, 8; III — 5, 7; IV — 6.
60 Тестовые задания с одним правильным ответом Цитология. Эмбриология. Генетика. Экология. Молекулярная биология 61

5. К немембранным структурам клетки относятся: 11. Во время мейоза образование бивалентов происходит на стадии:
1 — рибосомы; 2 — митохондрии; 3 — комплекс Гольджи; 4 — эн- а) профазы I; г) метафазы II;
доплазматический ретикулум; 5 — ядро; 6 — пластиды; 7 — цент­ б) профазы II; д) анафазы I.
риоли. в) метафазы I;
а) 1, 7; в) 3, 4, 7; д) 3, 5, 6, 7.
б) 1, 2, 6; г) 2, 3, 5; 12. У посевной фасоли с генотипом С-D- пурпурные цветки. Растения
с остальными возможными вариантами генотипов имеют белые
6. Активный фермент представляет собой сочетание апофермента и: цветки. Скрестили растения с генотипами Cсdd и ccDd (гены на-
а) кофактора; г) гема; ходятся в разных парах гомологичных хромосом). Какое расще-
б) кофермента; д) активного центра. пление по фенотипу будет у гибридов второго поколения?
в) холофермента; а) 1 белые : 1 пурпурные;
б) 3 пурпурные : 1 белые;
7. Укажите признаки, нехарактерные для гликолиза.
в) 1 пурпурные : 3 белые;
1 — реакции проходят на кристах митохондрий; 2 — чистый выход г) 4 пурпурные : 12 белые;
АТФ равен двум молекулам; 3 — реакции протекают в цитоплазме; д) 13 пурпурные : 3 белые.
4 — требуется обязательное наличие кислорода; 5 — из одной мо-
лекулы глюкозы образуется две молекулы пировиноградной кис- 13. Частота индивидов с наследуемым аутосомным рецессивным на-
лоты; 6 — образуется ацетилкофермент А; 7 — чистый выход АТФ рушением равна 36 %. Популяция, пораженная этой болезнью,
равен четырем молекулам; 8 — в итоге образуются CO2 и H2O. находится в состоянии равновесия в соответствии с законом Хар-
а) 1, 3, 5; в) 1, 4, 6, 7, 8; д) 2, 3, 4, 7. ди — Вайнберга. Определите долю носителей данного нарушения
б) 1, 2, 6, 7; г) 2, 4, 8; в этой популяции:
8. В процессе сперматогенеза второе деление мейоза происходит на а) 12,5 %; в) 48 %; д) 100 %.
стадии: б) 36 %; г) 76 %;
а) сперматид; 14. Рыба-прилипала на поверхности тела акулы является примером:
б) спермиев;
а) паразитизма; г) гиперпаразитизма;
в) сперматоцитов I порядка;
б) протокооперации; д) мутуализма.
г) сперматогониев;
д) сперматоцитов II порядка. в) комменсализма;

9. Определите, какое количество нуклеотидов в составе иРНК будет 15. Растение заразиха песчаная является:
соответствовать 48 аминокислотным остаткам в полипептиде: а) продуцентом; г) редуцентом;
а) 12; в) 48; д) 288. б) консументом I порядка; д) хищником II порядка.
б) 24; г) 144; в) консументом II порядка;

10. Набор хромосом 2n имеет: 16. Какой из указанных видов жесткокрылых является ксилофагом?
а) сперматогоний; г) сперматида; а) Божья коровка; г) мягкотелка бурая;
б) сперматоцит II порядка; д) сперматозоид. б) жужелица золотоямчатая; д) златка двупятнистая.
в) ооцит II порядка; в) мертвоед некрофорус;
62 Тестовые задания с одним правильным ответом Цитология. Эмбриология. Генетика. Экология. Молекулярная биология 63

17. Укажите растение, которому соответству- 22. Показатели, которые необходимо знать экологу для определения
ет представленное изображение анатоми- плотности вида в биоценозе:
ческого строения корня: а) сухая масса организмов биоценоза и площадь, которую занима-
а) рожь; ет биоценоз;
б) виноград; б) количество особей каждого вида и площадь, которую занимает
в) лилия; биоценоз;
г) ландыш майский; в) процентное отношение числа проб, взятых в биоценозе;
д) нарцисс. г) биомасса продуцентов, консументов и редуцентов;
д) видовой состав организмов, населяющих биоценоз.
18. Какой из организмов нельзя включить в  единую трофическую
цепь, составленную из других перечисленных видов? 23. Организмы, являющиеся консументами, — это:
а) Ягель; в) волк; 1 — анабена; 2 — петров крест; 3 — повилика полевая; 4 — клевер
б) карибу; г) косатка. пашенный; 5 — рододендрон; 6 — можжевельник обыкновенный;
7 — пырей ползучий; 8 — секвойя.
19. Бентосные организмы:
а) 1, 4, 5, 6, 7, 8; г) 2, 3;
а) активно плавают в воде и способны противостоять течению; б) 2, 4, 5, 6, 7, 8; д) 1, 2, 3, 4, 5, 6, 7, 8.
б) имеют специализированные органы прикрепления; в) 3, 4, 5, 6, 7, 8;
в) имеют многочисленные выросты или щетинки, которые увели-
чивают поверхность их тела; 24. Волос кролика состоит из белка:
г) имеют хорошо развитые органы движения — плавники; а) актина; г) виментина;
д) включают только животных, обладающих альвеолярными лег- б) миозина; д) кератина.
кими. в) тубулина;
20. Из предложенных организмов составьте пастбищную пищевую 25. В отличие от взрослого человека у ребенка до 6–7 лет отсутствуют:
цепь, которая возможна в условиях Беларуси. а) резцы; в) предкоренные зубы;
1 — листовой опад; 2 — ольха черная; 3 — сурикат; 4 — цикадка; б) клыки; г) коренные зубы.
5 — зяблик; 6 — дождевой червь; 7 — хищный клоп (антокорис);
8 — секвойя; 9 — крот; 10 — ястреб-перепелятник. 26. У людей с синдромом Патау трисомия по:
а) 2 → 4 → 3 → 10; г) 8 → 7 → 3 → 10; а) половым X-хромосомам; г) 23-й паре аутосом;
б) 1 → 6 → 9 → 10; д) 2 → 4 → 3 → 5 → 10. б) половым Y-хромосомам; д) 21-й паре аутосом.
в) 2 → 4 → 7 → 5 → 10; в) 13-й паре аутосом;

21. Один из наиболее распространенных в природе полисахаридов, 27. У человека отсутствие потовых желез является рецессивным при-
состоящий из остатков N-цетилглюкозамина и входящий в состав знаком, сцепленным с Х-хромосомой. В семье отец и сын имеют
оболочек клеток: данную аномалию, а мать здорова. Какова вероятность рождения
в этой семье еще одного сына с такой же аномалией?
а) декстирин; г) хитин;
б) парамилон; д) инулин. а) 0; г) 50 %;
в) целлюлоза; б) 10 %; д) 100 %.
в) 25 %;
64 Тестовые задания с одним правильным ответом Цитология. Эмбриология. Генетика. Экология. Молекулярная биология 65

28. Укажите особенности С3-фотосинтеза. 33. Известно, что листоед трещалка лилейная питается только на ви-
1 — акцептором CO2 служит фосфоенолпируват; 2 — акцептором дах растений семейства Лилейные. К какой трофической группе
CO2 служит рибулозобифосфат; 3 — характерен для сорго и сахар- он относится?
ного тростника; 4 — характерен для сельдерея и картофеля; 5 — а) Монофаги; в) полифаги;
промежуточным продуктом является щавелевоуксусная кислота; б) олигофаги; г) пантофаги.
6 — промежуточным продуктом являются 2 молекулы фосфогли-
цериновой кислоты. 34. Ремипедии являются:
а) 1, 4; в) 2, 3, 5; д) 1, 6. а) фототрофами;
б) 2, 4, 6; г) 1, 3, 5; б) свободно живущими гетеротрофами;
29. Двумембранным органоидом клетки являются(-ется): в) паразитами;
а) митохондрии; г) хемотрофами;
б) комплекс Гольджи; д) редуцентами.
в) гладкая эндоплазматическая сеть;
35. Паразитические виды организмов относятся к:
г) лизосомы;
д) рибосомы. а) редуцентам; г) копрофагам;
б) продуцентам; д) некрофагам.
30. Из энтодермы в процессе органогенеза формируются структуры: в) консументам;
1  — печень; 2  — поджелудочная железа; 3  — хрящевая ткань;
4 — спинной мозг; 5 — хорда; 6 — волосы; 7 — ногти; 8 — глаза; 36. Биотические взаимоотношения между раком-отшельником и ак-
9 — щитовидная железа; 10 — тела позвонков. тинией являются примером:
а) 3, 4, 5, 8, 10; в) 4, 6, 7, 8; д) 3, 5, 6, 8. а) комменсализма; г) паразитизма;
б) 1, 2, 5, 9; г) 4, 5, 6, 8, 10; б) протокооперации; д) конкуренции.
31. Определите, какие углеводы относятся к: в) квартиранства;
I — моносахаридам пентозам; II — дисахаридам; III — полисаха-
37. В сообществах живых организмов можно выделить несколько тро-
фических уровней. Наиболее значимыми среди них являются:
1 — глюкоза; 2 — фруктоза; 3 — арабиноза; 4 — сахароза; 5 — цел-
лобиоза; 6 — гликоген; 7 — ксилоза; 8 — инулин. а) хищники I порядка;
а) I — 1, 2; II — 4; III — 8; б) растения-продуценты;
б) I — 3, 7; II — 4, 5; III — 6, 8; в) травоядные животные;
в) I — 1; II — 2, 3, 4, 5; III — 8; г) хищники высшего порядка;
г) I — 7; II — 1, 2; III — 8; д) консументы высшего порядка.
д) I — 3, 4; II — 1, 2, 7; III — 5, 8.
38. В странах Карибского бассейна фикус-удушитель считается
32. К терминирующим кодонам (стоп-кодонам) относятся: символом неблагодарности и предательства. Такую славу фикус-
1 — АУГ; 2 — УГА; 3 — ГГГ; 4 — УУУ; 5 — УАГ; 6 — УАУ; 7 — УАА; удушитель приобрел благодаря особой форме взаимоотношений
8 — ААА. с другими растениями, носящей название:
а) 1, 2, 5, 7, 8; в) 1, 3, 8; д) 2, 5, 7. а) аменсализм; в) конкуренция;
б) 1, 2, 7; г) 2, 3, 4, 6, 8; б) хищничество; г) комменсализм.
66 Тестовые задания с одним правильным ответом Цитология. Эмбриология. Генетика. Экология. Молекулярная биология 67

39. Составьте правильную последовательность этапов жизненного 42. В одном из прудов рыбхоза «Птичь» было выловлено 200 кара-
цикла бактериофага. сей. Все особи были помечены и отпущены в пруд. На следующий
1 — фаг приближается к бактерии и связывается с рецепторными день было выловлено 100 карасей, из которых 50 оказались мече-
участками на поверхности бактериальной клетки; 2 — лизис бак- ными. Принимая во внимание, что популяция карасей в пруду не
териальной клетки, освобождение новых фагов; 3 — растворение изменилась, определите численность популяции карасей в этом
участка покровов бактериальной клетки и инъекция ДНК фага; пруду:
4 — репликация ДНК фага; 5 — синтез ферментов фага; 6 — инак- а) 100; в) 150; д) 250.
тивация и расщепление ДНК бактериальной клетки; 7 — спонтан- б) 50; г) 400;
ная самосборка новых фаговых частиц.
43. Определите, сколько сперматозоидов и яйцеклеток соответствен-
а) 2 → 3 → 5 → 7 → 4 → 6 → 1;
но образуется из 1850 сперматоцитов II порядка и 985 ооцитов
б) 1 → 3 → 5 → 6 → 4 → 7 → 2;
II порядка:
в) 1 → 5 → 3 → 7 → 6 → 4 → 2;
г) 5 → 3 → 1 → 7 → 4 → 6 → 2; а) 3700 и 985; г) 1280 и 1280;
д) 3 → 1 → 5 → 6 → 7 → 4 → 2. б) 5120 и 2560; д) 640 и 340.
в) 1280 и 640;
40. Найдите неправильное утверждение о генетическом материале
44. Аллель b, сцепленный с полом (локализован в X-хромосоме), ре-
цессивен и летален. Летальный ген вызывает гибель зиготы или
а) имеются вирусы, геном которых представлен РНК; эмбриона. Мужчина вступил в брак с женщиной, гетерозиготной
б) ДНК вирусов связана с гистонами; по этому гену. Определите вероятность рождения в данной семье
в) генетический материал в клетках бактерий может существовать детей — носителей летального гена:
вo внехромосомном состоянии;
а) 50 %; в) 25 %; д) 0.
г) генетический материал эукариот состоит из ДНК;
б) ≈ 33 %; г) ≈ 67 %;
д) вхождение чужеродной ДНК в клетку не всегда летально для
клетки, особенно для эукариотической. 45. Часть хроматина, которая в интерфазе сохраняет деспирализован-
ное состояние и содержит большое количество негистидиновых
41. Укажите признаки, нехарактерные для антител. белков, называется:
1 — относятся к нуклеиновым кислотам; 2  — молекула антите- а) эухроматин; г) ядрышковый организатор;
ла состоит из нуклеотидной последовательности; 3 — относятся б) гетерохроматин; д) нуклеоплазма.
к липидам; 4 — относятся к белкам; 5 — молекула антитела со- в) центромера;
стоит из двух тяжелых цепей (H-цепи) и  двух легких цепей
(L-цепи); 6  —  в  цепях антител имеются вариабельные и  кон- 46. Примером внутривидовой конкуренции являются взаимоотноше-
стантные домены; 7 — молекула антитела включает участки, не- ния между:
сущие железосодержащие простетические группы, называемые а) серыми крысами;
гемом. б) божьей коровкой и тлей;
а) 1, 2, 5; г) 4, 6, 7; в) актинией и рыбой-клоуном (амфиприоном);
б) 2, 4, 6, 7; д) 3, 5, 7. г) белым медведем и песцом;
в) 1, 2, 3, 7; д) самцами благородного оленя в период полового размножения.
68 Тестовые задания с одним правильным ответом Цитология. Эмбриология. Генетика. Экология. Молекулярная биология 69

47. У представителей типа Хордовые из мезодермы формируются: 53. Близкородственное скрещивание — это:
1 — симпатические и парасимпатические ганглии; 2 — гладкая му- а) инбридинг; г) автогамия;
скулатура; 3 — почечные канальцы; 4 — зубная эмаль; 5 — межпо­ б) аутбридинг; д) партеногенез.
звоночные диски; 6 — сетчатка глаза; 7 — поджелудочная железа; в) отдаленная гибридизация;
8 — дерма.
а) 1, 2, 3, 6; г) 3, 6, 7; 54. Полая белковая структура, в полости которой находится вирусный
б) 1, 4, 6; д) 1, 3, 7. геном, — это:
в) 2, 3, 5, 8; а) капсид; г) каркас;
б) липопротеиновая оболочка; д) бактериофаг.
48. Иод входит в состав гормона: в) муреиновая оболочка;
а) гипофиза;
б) эпифиза; 55. Экологическая группа активно плавающих живых организмов,
в) щитовидной железы; способных противостоять течению и преодолевать значительные
г) поджелудочной железы. расстояния, — это:
а) бентос; г) перифитон;
49. Фосфор содержится в:
б) нектон; д) нейстон.
а) белках; в) планктон;
б) углеводах;
в) алканах; 56. Органоид сперматозоида, расположенный на его вершине и об-
г) жирах; разующийся из элементов комплекса Гольджи, — это:
д) нуклеиновых кислотах.
а) аксостиль; г) акросома;
50. Для синтеза белка не требуется обязательное наличие: б) фрагмопласт; д) кинетосома.
в) кинетопласт;
а) аминокислот; г) иРНК;
б) комплекса Гольджи; д) рибосом. 57. Стадия эмбрионального развития зародыша многоклеточных жи-
в) тРНК; вотных, на которой он имеет однослойную стенку и полость, — это:
51. Вызывающий СПИД вирус иммунодефицита человека (ВИЧ) по- а) зигота; г) гаструла;
ражает: б) бластула; д) нейрула.
а) Т-хелперы (лимфоциты); г) все виды лимфоцитов; в) морула;
б) В-лимфоциты; д) тромбоциты.
58. Один из типов взаимодействия генов, при котором аллели одного
в) антигены;
гена подавляют проявление аллелей другого гена, — это:
52. Связанные с ДНК хромосомные белки, содержащиеся в ядрах кле- а) комплементарность;
ток растений и животных, — это: б) кумулятивная полимерия;
а) коллагены; г) альбумины; в) некумулятивная полимерия;
б) цитохромы; д) гистоны. г) эпистаз;
в) иммуноглобулины; д) кодоминирование.
70 Тестовые задания с одним правильным ответом Цитология. Эмбриология. Генетика. Экология. Молекулярная биология 71

59. Группа ферментов, катализирующих внутримолекулярные пере- а) конвергенция; г) диверсификация;

стройки органических соединений, в том числе взаимопревраще- б) дивергенция; д) дезинфекция.
ния изомеров, — это: в) катагенез;
а) липазы; г) трансферазы; 66. Сложные белки (гликопротеиды), которые специфически связы-
б) гидролазы; д) изомеразы. ваются с чужеродными веществами — антигенами, — это:
в) синтетазы;
а) энзимы; г) лигазы;
60. Внехромосомные факторы наследственности, генетические эле- б) трансферазы; д) иммобилизаторы.
менты, способные стабильно существовать в клетке в автономном, в) иммуноглобулины;
не связанном с хромосомой состоянии, — это:
67. Участок гена эукариот, который, как правило, не несет генетиче-
а) вироиды; г) плазмиды; ской информации о первичной структуре белка, кодируемого дан-
б) бактериофаги; д) капсиды. ным геном, — это:
в) вирусы;
а) интрон; г) ядрышковый организатор;
61. Совокупность живых организмов, обитающих в грунте или на по- б) экзон; д) антикодон.
верхности грунта морских и континентальных водоемов, — это: в) аллель;
а) нектон; г) плейстон;
68. Фибриллярный белок, составляющий основу волокон плотной
б) бентос; д) нейстон.
волокнистой соединительной ткани в сухожилиях и обеспечива-
в) планктон;
ющий ее прочность, — это:
62. Внутриклеточная структура эукариот, лежащая в основании рес- а) гемоглобин; г) коллаген;
ничек и жгутиков и служащая для них опорой, — это: б) энзим; д) гемоэритрин.
а) кинетопласт; г) кинетосома; в) иммуноглобулин;
б) центромера; д) кортекс. 69. Древние ископаемые люди, относящиеся к палеоантропам, — это:
в) кинетохор;
а) австралопитеки; г) кроманьонцы;
63. Процесс обособления двух первичных зародышевых листков (на- б) атлантропы; д) неандертальцы.
ружного — эктодермы и внутреннего — энтодермы) у зародышей в) питекантропы;
многоклеточных животных — это:
70. С помощью какого фермента осуществляется синтез ДНК на
а) гаструляция; г) органогенез; РНК-матрице?
б) бластуляция; д) дробление бластомеров.
а) Обратной транскриптазы; г) праймазы;
в) нейруляция;
б) ДНК-полимеразы; д) РНК-полимеразы.
64. Превосходство гибридов по ряду признаков и свойств над роди- в) лигазы;
тельскими формами, «гибридная сила» — это: 71. Женщина гетерозиготна по аутосомному гену A и гетерозиготна по
а) гетерозис; г) моносомия; гену В, сцепленному с половыми хромосомами. Определите, какая
б) аутбридинг; д) трисомия. доля яйцеклеток будет содержать только рецессивные аллели.
в) инбридинг; а) 10 %; г) 12,5 %;
65. Расхождение признаков организмов в ходе эволюции разных фи- б) 50 %; д) 6,25 %.
летических линий, возникших от общего предка, — это: в) 25 %;
72 Тестовые задания с одним правильным ответом Цитология. Эмбриология. Генетика. Экология. Молекулярная биология 73

72. Мужчина, страдающий наследственным заболеванием, женился 78. В каком из перечисленных продуктов питания наибольшее отно-
на здоровой женщине. У них родились дети: 4 мальчика и 4 девоч- сительное содержание ненасыщенных жирных кислот?
ки. Все девочки имели симптомы болезни отца, тогда как мальчики а) Масло сливочное; г) арахисовая паста;
были здоровы. Данное заболевание является: б) масло растительное; д) карамель.
а) аутосомно-рецессивным; в) маргарин;
б) аутосомно-доминантным;
в) сцепленным с Y-хромосомой; 79. На рибосомах шероховатой эндоплазматической сети синтезиру-
г) сцепленным с Х-хромосомой доминантным; ются:
д) сцепленным с Х-хромосомой рецессивным. а) Na+, K+-АТФаза, тиреотропный гормон, адреналин, альбумин;
б) Са2+-АТФаза, лизосомные протеазы, гормон роста, трансфер-
73. Большинство паразитов желудочно-кишечного тракта человека рин;
и животных получают энергию в результате протекания этого про- в) Н+-АТФаза, гемоглобин, альдостерон, актин, миозин;
цесса: г) гистоны, иммуноглобулины, стероиды;
а) аэробное дыхание; г) хемосинтез; д) только адреналин и альбумин.
б) анаэробное дыхание; д) фотосинтез.
в) фагоцитоз; 80. Определите, какая из представленных пирамид чисел отражает
соотношение ель — короед-типограф — дятел.
74. Что из перечисленных веществ является необходимым для ам-
плификации фрагментов ДНК посредством полимеразной цепной
а) Taq-полимераза; в) аминокислоты;
б) РНК-полимераза; г) АТФ.

75. К пластидам не относится: а) 1; в) 3;

а) протопласт; г) хлоропласт; б) 2; г) 4.
б) амилопласт; д) хромопласт.
в) олеопласт; 81. Раздел экологии, изучающий организованные сообщества живых
организмов, пути и условия их формирования, динамику и струк-
76. Найдите утверждение, верное для цикла Кребса: туру, взаимодействия биоценозов с компонентами неживой при-
а) проходит в межмембранном пространстве митохондрий; роды, — это:
б) является центральной частью молочнокислого брожения; а) синэкология; г) аутэкология;
в) прекращается при отсутствии НАД+; б) популяционная экология; д) учение о биосфере.
г) его результатом является образование 38 молекул АТФ; в) социальная экология;
д) проходит при участии кислорода, который окисляет ацетил-КоА.
82. Определите, какой кариотип будет у мужчины, если известно, что
77. Ацетил-КоА принимает участие в синтезе: у него обнаружено одно тельце Барра:
а) фенилаланина; г) нуклеотидов; а) XY; г) 0Y;
б) клетчатки; д) белков. б) XXY; д) X0Y0.
в) стероидов; в) XXXY;
74 Тестовые задания с одним правильным ответом Цитология. Эмбриология. Генетика. Экология. Молекулярная биология 75

83. У молочнокислых бактерий отсутствует электротранспортная 87. Гормон, который свободно переносится кровотоком, а не белками
цепь. Однако при определенных условиях до 50 % АТФ синтези- плазмы крови, — это:
руется мембраносвязанной Н+-АТФазой. Определите, при каких а) эстрадиол; г) гидрокортизон;
условиях это возможно. б) адреналин; д) нет правильного ответа.
1 — концентрация молочной кислоты в клетке выше, чем концен- в) тестостерон;
трация молочной кислоты в среде; 2 — концентрация молочной
кислоты в  клетке ниже, чем концентрация молочной кислоты 88. Типичным примером комменсализма можно считать:
в среде; 3 — унипорт молочной кислоты; 4 — симпорт молочной а) сожительство клубеньковых бактерий и бобовых растений;
кислоты с Н+ ; 5 — антипорт молочной кислоты с Н+. б) взаимоотношения льва и растительноядных копытных;
а) 1, 3; в) 1, 5; д) 2, 4. в) использование непаразитическими формами насекомых нор
б) 1, 4; г) 2, 3; грызунов в качестве убежищ;
г) отношения рака-отшельника и актинии.
84. Определите, в каком случае вероятность накопления тяжелых ме-
таллов в организме животного наибольшая: 89. Субстратом РуБисКо (РБФК) являются(-ется):
а) при выпасе вблизи маршрутов водного транспорта; 1  — фосфоенолпируват; 2  — рибулозобифосфат; 3  — рамноза;
б) при включении в рацион питания витаминов группы В; 4 — фосфоглицерид; 5 — CO2; 6 — фосфоглицериновая кислота;
в) при использовании в качестве корма травы, скошенной вблизи 7 — N2.
автомагистрали; а) 1, 2, 3; г) 2, 6, 7;
г) при строительстве животноводческого комплекса вблизи амми- б) 2, 5; д) 1.
ачного производства; в) 3, 5, 7;
д) во всех перечисленных случаях вероятность одинакова.
90. Аммонификация — это процесс превращения:
85. Определите, о  какой разновидности почвенной воды идет речь а) NO2– → NO–3 ;
в описании: «Она высвобождается только при температуре 105— б) N2 → NH4+;
110 °С; физиологически совершенно недоступна растениям; об- в) NH4+ → NO2–;
разует так называемый мертвый запас воды в почве». г) атомов азота в органических соединениях в NH3;
а) Пленочная; д) нет правильного ответа.
б) гравитационная;
в) капиллярная; 91. Промежуточные филаменты эпителиальных клеток представлены:
г) гигроскопическая; а) актином; г) тубулином;
д) нет правильного ответа. б) миозином; д) кератином.
в) флагеллином;
86. Конкурентные взаимоотношения могут возникнуть между:
а) цианобактерией и грибом в составе лишайника; 92. В какой структуре синтезируются белки?
б) хищником и жертвой; а) В митохондриях;
в) особями одного вида, обитающими на одной территории; б) на гладкой эндоплазматической сети;
г) животными и воздействующими на них абиотическими факто- в) в лизосомах;
рами; г) на плазмалемме;
д) нет правильного ответа. д) в ядре.
Задания с нестандартным обозначением правильного ответа 77

18 У веслоногого рачка циклопа есть только один простой глаз

19 Слуховые рецепторы у позвоночных возникают из того же за-
родышевого листка, что и эпидермис
20 Для вольвокса характерно половое размножение
21 Поджелудочная железа — железа смешанной секреции
22 В регуляции работы желез внутренней секреции принимает
участие только нервная система
1. Отметьте верное высказывание знаком «+», а ошибочное — знаком
23 Во время отдыха количество сахара в крови увеличивается
24 Тромбоциты крови человека обеспечивают транспорт гормонов
1 Радиолярии обитают в пресных водоемах
25 Нейтрофилы относятся к группе агранулоцитов
2 Острицы не имеют пищеварительной системы и  всасывают
готовую пищу всей поверхностью тела 26 Бесполое размножение хламидомонады происходит при насту-
плении неблагоприятных условий
3 Тело насекомых снаружи покрыто кутикулой
4 Все виды клещей ведут паразитический образ жизни 27 Молекула сахарозы состоит из двух остатков глюкозы

5 Ходильные конечности у паукообразных расположены на 28 Натрий по содержанию в организме животных относится к ми-
брюшке кроэлементам

6 Личинки чешуекрылых питаются нектаром цветов 29 Споры папоротника диплоидные и при прорастании делятся
мейотически, формируя гаплоидный заросток
7 Ноздри двоякодышащих рыб не сообщаются с ротоглоткой
30 Рибулоза — это шестиуглеродный моносахарид
8 Для многих видов костистых рыб характерна высокая плодо-
витость 31 Ферменты изомеразы осуществляют внутримолекулярные
9 У крокодилов четырехкамерное сердце перестройки веществ

10 Птицы — эндотермные животные 32 У бактерий синтез АТФ протекает на внешней мембране ми-
11 У однодольных растений между ксилемой и флоэмой находит-
ся камбий 33 Цитоскелет клетки образован микротрабекулярной системой,
микротрубочками и микрофиламентами
12 У сосны мужские половые клетки неподвижные
34 Скорость диффузии веществ через мембрану не зависит от раз-
13 Для первичной коры корня характерно отсутствие проводящих
мера их молекул
35 Экзоцитоз — это процесс проникновения веществ в клетку
14 У папоротника-орляка бесполое размножение осуществляется
с помощью спор 36 Первичная перетяжка отсутствует у палочковидных хромосом
15 Клетки насекомоядных растений не содержат хлоропласты 37 Элайопласты — это пластиды, в которых запасаются жиры.
16 У всех водных покрытосеменных растений устьица располо- 38 Чаще всего при фотосинтезе акцептором СО2 служит рибуло-
жены на нижней стороне листа зобифосфат
17 Заражение человека свиным солитером происходит при упо- 39 Железобактерии восстанавливают Fe3+ до Fe2+
треблении пищи, содержащей яйца паразита
78 Задания с нестандартным обозначением правильного ответа Задания с нестандартным обозначением правильного ответа 79

40 Первой реакцией цикла Кребса является образование ацетил- 60 Пантофаги — всеядные организмы, питающиеся животными,
КоА из пировиноградной кислоты и коферемента А растениями и грибами
41 Каротины — это углеводы, большую часть которых составляют 61 Аксолотль — неотеническая личинка амбистомы
62 Наиболее древним является дихотомический тип ветвления
42 В фотосистеме II реакционным центром является хлорофилл стебля
63 У личинок земноводных можно наблюдать орган боковой ли-
43 Автотрофные организмы в трофической цепи относятся к кон- нии
64 Гемолимфа насекомых выполняет дыхательную функцию
44 Газообмен у птиц осуществляется в легких и воздушных мешках
65 Спаданию легкого препятствуют сурфактант и серозная жид-
45 Гормон гастрин образуется в желудке кость полости плевры
46 Заболевание пеллагра развивается у человека при недостатке 66 Цветовое зрение связано с функционированием колбочек
в пище никотиновой кислоты
67 Центральная ямка  — это наиболее чувствительный участок
47 У людей с III группой крови в плазме крови содержатся аг- сетчатки, содержащий только колбочки
глютинины β
68 У птиц пища вначале попадает в жевательный отдел желудка,
48 Гиббереллины вызывают удлинение стеблей растений а потом в железистый
49 В среднем ухе млекопитающих непосредственно к барабанной 69 Лизоцим — антибактериальное вещество слюны
перепонке примыкает молоточек
70 При гиповитаминозе следует уменьшить прием витаминов
50 В цистернах комплекса Гольджи синтезируются олиго- и по-
лисахариды 71 Митральный клапан расположен между правым предсердием
и правым желудочком
51 В состав жгутика эукариотической клетки входит 9 перифери-
ческих дуплетов микротрубочек и 2 центральных 72 γ-глобулины играют важную роль в иммунологических реак-
циях организма
52 Единицей строения и функционирования миофибриллы яв-
ляется миоцит 73 Лейкоциты не способны к амебоидному движению
53 Плоский эпителий выстилает ротовую полость человека 74 Выделение пота обеспечивает охлаждение организма
54 Сухожилия образованы рыхлой волокнистой тканью 75 Локтевой сустав цилиндрический
55 Афферентные волокна проводят возбуждение от периферии 76 Акросома сперматозоида имеет сходное с митохондрией стро-
к центру ение
56 Пояски Каспари находятся в клетках ксилемы корня 77 Сперматиды преобразуются в сперматогонии
57 Червеобразный отросток (аппендикс) не имеет полости 78 Все виды сосальщиков являются гермафродитами
58 Гомологичные органы возникают в результате конвергенции 79 Семязачаток — это видоизмененный мегаспорангий
59 Строение парных плавников кистеперых рыб гомологично 80 Мезодерма у позвоночных формируется из энтодермы
строению конечностей у наземных позвоночных животных
81 Целом выполняет функцию гидроскелета
80 Задания с нестандартным обозначением правильного ответа Задания с нестандартным обозначением правильного ответа 81

82 Имплантация зародыша человека происходит на вторые-тре- 2. Сопоставьте два утверждения или показателя (обозначены бук-
тьи сутки после оплодотворения вами А и Б), приведенные в каждом пункте этого раздела, и дайте
ответ в форме: А > Б; А < Б; А = Б.
83 Постэмбриональный период  — период развития от момента
оплодотворения до выхода из яйца (рождения) Знак «>», «<» или «=» внесите в средний столбец таблицы.

84 Промотор — последовательность РНК длиной до 100 пар нукле- 1 А. Содержание эритроцитов Б. Содержание эритроцитов в кро-
отидов, которую узнает молекула фермента РНК-полимераза в крови костных рыб ви птиц
85 Автополиплоид может содержать набор хромосом, равный 6n 2 А. Оптимальная температу­ра Б. Оптимальная температура про-
прорастания семян моркови растания семян фасоли
86 Дефишенси — выпадение участка хромосом в средней ее части 3 А. Средний размер тела под- Б. Средний размер тела подвидов
87 Синдром Шерешевского  —  Тернера связан с  моносомией видов бурого медведя, оби- бурого медведя, обитающих
по Х-хромосоме тающих в северных райо- в южных районах
88 У молочно-белой планарии нервная система типа ортогон
4 А. Число шейных позвонков Б. Число шейных позвонков у бе-
89 Зачатки неопалиума появляются у амфибий у бурозубки обыкновенной гемота
5 А. Интенсивность протека­ния Б. Интенсивность протекания
90 Моторный центр речи расположен в лобной доле коры боль-
физиологических процес- физиологических процессов
ших полушарий
сов у живых организмов, у  живых организмов, находя-
91 Фотовосприятие у растений осуществляется с помощью фи- находящихся в анабиозе щихся в зимней спячке
тохромов 6 А. Концентрация сахара Б. Концентрация сахара в крови
92 Индолил-3-уксусная кислота стимулирует у растений деление в крови спящего человека бодрствующего человека
и растяжение клеток 7 А. Рост ребенка при избыточ- Б. Рост ребенка при недостаточ-
ном вырабатывании сома- ном вырабатывании сомато-
93 Сциофиты — растения, растущие в хорошо освещенных местах тотропного гормона тропного гормона
94 Опунция, агава, алоэ относятся к группе растений, называемых 8 А. Число нуклеотидов в пре- Б. Число нуклеотидов в мРНК эу-
склерофитами мРНК, транскрибирован- кариотического гена во время
ной с  эукариотического трансляции
95 Примером синойкии являются взаимоотношения между ры- гена
бой-прилипалой и акулой
9 А. Относительное содержание Б. Относительное содержание
96 Циркадный ритм длится около недели эластиновых волокон в рых- эластиновых волокон в плот-
лой соединительной ткани ной соединительной ткани
97 Планктон — совокупность активно плавающих животных, спо-
10 А. Количество хромосом Б. Количество хромосом в 22-й па­
собных преодолевать силу течения
в  22-й  паре при болезни ре у здорового человека
98 Наличие крючьев на вершине сколекса некоторых ленточных Дауна
червей является приспособлением к паразитизму 11 А. Число микротрубочек Б. Число микротрубочек в реснич-
99 Двустворчатые моллюски относятся к бентосу в жгутике эвглены зеленой ке инфузории туфельки
12 А. Содержание лигнина Б. Содержание лигнина в стенках
100 Некоторые цианобактерии способны обитать в горячих источ- в стенках сосудов ситовидных трубок
никах при температуре +80 °С
13 А. Количество максилл у реч- Б. Количество максилл у майского
ного рака жука
82 Задания с нестандартным обозначением правильного ответа Задания с нестандартным обозначением правильного ответа 83

14 А. Содержание генетического Б. Содержание генетического ма- 29 А. Содержание эозинофилов Б. Содержание моноцитов в крови
материала в дочерней клетке териала в материнской клетке в крови человека человека
во время телофазы митоза во время профазы митоза 30 А. Продолжительность систо- Б. Продолжительность систолы
15 А. Продолжительность гапло- Б. Продолжительность диплоид- лы предсердий желудочков
идной стадии в цикле раз- ной стадии в  цикле развития 31 А. Сродство гемоглобина Б. Сродство гемоглобина к кисло-
вития мхов мхов к окиси углерода (СО) роду
16 А. Количество клеток нейро- Б. Количество нейронов в нервной 32 А. Молекулярная масса Б. Молекулярная масса L-цепей
глии в нервной ткани ткани Н-цепей иммуноглобулина иммуноглобулина
17 А. Активность ферментов Б. Активность ферментов панкре- 33 А. Количество устьиц на 1 мм2 Б. Количество устьиц на 1 мм2
панкреатического сока при атического сока при рН = 5 в эпидермисе листа липы в  эпидермисе листа липы
рН = 8 в городе в сельской местности
18 А. Энергетическая ценность Б. Энергетическая ценность 100 г 34 А. Концентрация K+ в живой Б. Концентрация K+ в  мертвой
100 г картофеля фри (в вареного картофеля (в ккал) клетке клетке
ккал) 35 А. Число отделов головного Б. Число отделов головного мозга
19 А. Количество кислорода, Б. Количество кислорода, транс- мозга у сазана у белой цапли
транспортируемого кро- портируемого кровью кольча- 36 А. Число аминокислотных Б. Число аминокислотных остат-
вью кольчатых червей, со- тых червей, содержащей в плаз- остатков в молекуле гемо- ков в молекуле миоглобина
держащей в плазме хлоро- ме гемоглобин глобина
круанин 37 А. Концентрация аминокис- Б. Концентрация аминокислот во
20 А. Емкость легких человека Б. Жизненная емкость легких че- лот в первичной моче вторичной моче
ловека 38 А. Содержание палочек в сет­ Б. Содержание колбочек в сетчат-
21 А. 1 кал Б. 1 Дж чатке глаза человека ке глаза человека
22 А. Валовая первичная продук- Б. Чистая первичная продукция 39 А. Расстояние до источника Б. Расстояние до источника некта-
ция нектара в  случае, когда ра в случае, когда рабочая пчела
23 А. Относительное содержание Б. Относительное содержание рабочая пчела исполняет исполняет виляющий танец
токсических веществ в кон- токсических веществ в консу- круговой танец
сументах 1-го порядка ментах 3-го порядка 40 А. Количество осей движения Б. Количество осей движения
24 А. Содержание гумуса в  по- Б. Содержание гумуса в  почвах в блоковидном суставе в шаровидном суставе
чвах зоны тайги зоны широколиственных лесов 41 А. Количество взмахов крыла Б. Количество взмахов крыла за
25 А. Биологическое разнообразие Б. Биологическое разнообразие за 1 с у махаона 1 с у пчелы
в пионерных сообществах в климаксных сообществах 42 А. Сердечный ритм при бра- Б. Сердечный ритм при тахикар-
26 А. Отношение общей про- Б. Отношение общей продукции дикардии дии
дукции к дыханию (P/R) к  дыханию (P/R) на поздних 43 А. Количество опорных паль- Б. Количество опорных пальцев
на ранних стадиях вторич- стадиях вторичной сукцессии цев на конечностях у парно- на конечностях у непарноко-
ной сукцессии копытных млекопитающих пытных млекопитающих
27 А. Плодовитость трески Б. Плодовитость колючей акулы 44 А. Энергетический выход при Б. Энергетический выход при мо-
(катрана) спиртовом брожении лочнокислом брожении
28 А. Осмотическое давление Б. Осмотическое давление 0,1 М
0,05 М раствора сахарозы раствора сахарозы
Практические задания 85

1) Как называется такой контакт? 

2) Укажите названия элементов, обозначенных цифрами:
1 — 
3 — 
4 — 
1. Найдите соответствие между типами личинок и животными, для 5 — 
которых они характерны. Впишите номера, соответствующие на- 6 — 
званиям личинок, в ячейки таблицы.
3.* Найдите соответствие между группами бактерий и местом, где
1 — мирацидий; 2 — корацидий; 3 — планула; 4 — эфира; 5 — тро-
они обитают. Результаты впишите в таблицу ответов.
хофора; 6 — глохидий; 7 — велигер; 8 — онкосфера; 9 — нимфа;
10 — редий; 11 — спороциста; 12 — процеркоид. Группа бактерий Местообитание
Животное Личинка(-и) 1. Хламидии А. Открытые сульфидные месторождения
Аурелия (Aurelia aurita) 2. Метаногены Б. Поверхностный слой болотной воды с  рас-
Лентец широкий (Diphyllobothrium latum) тительностью

Эхинококк (Echinococcus granulosus) 3. Метанотрофы В. Клетки позвоночных

Ланцетовидный сосальщик (Dicrocoelium 4. Сульфатредукторы Г. Прибрежные морские отложения

5. Тионовые бактерии Д. Рубец жвачных, метантенк, установка для
Нереис (Nereis pelagic) получения биогаза
Перловица (Unio pictorum)
Таблица ответов
Таракан рыжий (Blatella germanica)
1 2 3 4 5
Дрейссена (Dreissena polymorpha)
Коралл красный (Corallium rubrum)

2. Рассмотрите изображенный на рисунке специализированный 4.* Установите соответствие. Результаты впишите в таблицу ответов.
функциональный контакт между возбудимыми клетками и дайте А. Лейкопласты 1. Цикл Кребса
ответы на вопросы.
6 5 Б. Шероховатый эндоплаз- 2. Внутрицитоплазматические мембран-
матический ретикулум ные структуры бактерий
1 В. Геном 3. Центр организации микротрубочек
Г. Митохондрии 4. Модификация и созревание белков
Д. Центриоль 5. Вся генетическая информа­ция организма
2 Е. Мезосомы 6. Запасание крахмала
86 Практические задания Практические задания 87

Ж. Лизосомы 7. Синтез и транспорт белков 6. На рисунке изображено внутреннее строение насекомого (самца).

З. Микрофиламенты 8. Синтез липидов

И. Гладкий эндоплазмати- 9. Содержат ферменты, близкие по дей-
ческий ретикулум ствию к пищеварительным
К. Комплекс Гольджи 10. Составляют основу цитоскелета

Таблица ответов

5. Определите, к каким классам относятся изображенные на рисунке

растения. Укажите номера в соответствующей строке.

Укажите названия элементов, обозначенных цифрами:

1 — 
2 — 
3 — 
4 — 
5 — 
6 — 
1 2 3 4 7 — 
8 — 
9 — 
10 — 
11 — 

7. Определите, какие цифры на рисунке соответствуют перечислен-

ным структурным составляющим нейрона.

5 6 7 8

Класс Однодольные: 
Класс Двудольные: 
88 Практические задания Практические задания 89

Ядро —       ; перехват Ранвье —            ; клет- 3) Как протекает постэмбриональное развитие у представленных
ка Шванна —        ; нервное окончание —        ; насекомых? (Укажите номера соответствующих имаго.)
дендриты —      ; начальный сегмент аксона —       . Без метаморфоза —        ; с неполным метаморфо-
зом —        ; с полным метаморфозом —        .
8. Рассмотрите внешнее строение представленных личинок (А—Г)
и взрослых насекомых (1—4), выполните задания и ответьте на 4) В какой среде (водной или наземной) обитают имаго и личинки
вопросы. данных видов? Результаты впишите в таблицы.
Личинка Среда обитания

А Б В Г Имаго Среда обитания


9. Найдите соответствие между видами организмов и заболевания-

1 2 3 4
ми, которые они вызывают. Результаты внесите в таблицу ответов.
1) Найдите соответствие между личинками и взрослыми насеко-
Организм Заболевание
мыми. Результаты впишите в таблицу.
1. Bacillus anthracis A. Африканская сонная болезнь
Личинка А Б В Г
2. Borrelia burgdorferi Б. Сибирская язва
Взрослая особь 3. Trichomonas vaginalis В. Холера

2) К каким отрядам относятся изображенные имаго? Результаты 4. Entamoeba histolytica Г. Амебиаз

впишите в таблицу. 5. Plasmodium vivax Д. Болезнь Лайма
Имаго Отряд 6. Leishmania tropica Е. Малярия
7. Treponema pallidum Ж. Балантидиоз
8. Trypanosoma gambiense З. Туберкулез
9. Vibrio cholerae И. Восточная язва (пендинка)
3 10. Balantidium coli К. Сифилис
4 11. Mycobacterium tuberculosis Л. Инфекция мочеполовых путей
90 Практические задания Практические задания 91

Таблица ответов 2) Определите, какой набор хромосом характерен для элементов

(стадий), обозначенных цифрами.
1 2 3 4 5 6 7 8 9 10 11
Гаплоидный — 
Диплоидный — 

10. Рассмотрите жизненный цикл папоротников и выполните зада- 11. Рассмотрите строение растительной клетки и выполните задания.



6 1) Укажите структуры, обозначенные цифрами:
1 — 
3 — 
1) Определите, какие элементы (стадии) обозначены цифрами: 8 — 
9 — 
1 —  14  — 
2 — 
2) Определите, какими цифрами обозначены:
3 — 
тонопласт — 
4 — 
ядерная оболочка — 
5 —  гиалоплазма — 
6 — 
7 —  12. Рассмотрите процесс деления клетки, выполните задания и ответь-
те на вопросы.
8 — 
9 —  1) Какой процесс деления клеток изображен на рисунке (с. 92)?
10 — 
92 Практические задания Практические задания 93



2) Какие стадии процесса деления клетки изображены на рисунке?
Ответ запишите в таблицу.
Стадия Название
Д 1) Назовите структуру, изображенную на рисунке.
Ж 2) Определите, какие структуры обозначены цифрами:
3) Назовите стадию процесса деления клетки, которая не изобра- 1 — 
жена на рисунке. 2 — 

3 — 
4) Определите, какое количество хромосом содержится в  ядре 4 — 
клетки на стадии:
5 — 
6 — 
5) Определите, какое количество хроматид содержится в  ядре 7 — 
клетки на стадии:
А Г 14. На рисунке (с. 94) схематично изображен развивающийся в яйце
организм. Известно, что его развитие протекает в наземных усло-
13. Рассмотрите строение структурно-функциональной единицы поч- виях и организм относится к группе амниот. Рассмотрите данный
ки человека (с. 93) и выполните задания. рисунок, выполните задания и ответьте на вопрос.
94 Практические задания Практические задания 95


1) Определите, какие структуры обозначены цифрами:

1 — 
2 —  1 2 3 4 5 6 7

3 —  1) Найдите соответствие между паразитическими червями и ста-

4 —  диями, которые встречаются в цикле их развития. Ответ запи-
5 —  шите в таблицу.
6 —  Взрослый
Стадия в цикле развития
7 —  паразитический червь
2) Назовите функцию, которую выполняет структура, обозначен-
ная на рисунке цифрой 6. Б

2) Определите, как называются стадии, обозначенные на рисунке
3) К каким(-ому) классам(-у) живых организмов может относить- цифрами:
ся развивающийся организм? 3 — 
 4 — 
5 — 

6 — 

 3) Запишите видовые названия паразитических червей.
А — 
15. Рассмотрите строение взрослых паразитических червей (А—Г) Б — 
и отдельные стадии, встречающиеся в цикле их развития (1—7) В — 
(с. 95). Выполните задания. Г — 
96 Практические задания Практические задания 97

16. Рассмотрите рисунок, на котором изображены схемы строения со- Вид растения Тип соцветия
цветий, и выполните задания.
Морковь посевная (Daucus sativus)
Подорожник большой (Plantago major)
Ромашка аптечная (Matricaria chamomilla)
Ландыш майский (Convallaria majalis)
Одуванчик лекарственный (Taraxacum officinale)
Черемуха обыкновенная (Padus avium)
Пшеница мягкая (Triticum aestivum)

17.* По одной из классификаций соцветия можно разделить на две

группы: цимозные и ботрические. Какие из предложенных соцве-
1 2 3 4
тий относятся к ботрическим, а какие — к цимозным? Внесите
в таблицу соответствующие цифры.
1  — кисть; 2  — монохазий; 3  — колос; 4  — початок; 5  — щиток;
6 — плейохазий; 7 — зонтик; 8 — дихазий; 9 — головка; 10 — корзинка.

18. Рассмотрите схематическое изображение бактериальной клетки

и выполните задания.
5 6 7 8 9

1) Определите, какими цифрами обозначены на рисунке следую-

щие типы соцветий:
колос — 
корзинка — 
кисть — 
сложная кисть — 
сложный зонтик — 
2) Определите, какие типы соцветий характерны для представлен-
ных в таблице видов растений. В таблице укажите цифру из
рисунка, которой соответствует искомый тип соцветия.
Вид растения Тип соцветия
Пастушья сумка (Capsella bursa-pastoris)
Вишня обыкновенная (Prunus cerasus)
Пырей ползучий (Elytrigia repens)
98 Практические задания Практические задания 99

1) Укажите структуры, обозначенные цифрами: 1) Укажите структуры, обозначенные цифрами:

8 —  1 — 
9 —  3 — 
13 —  8 — 
15 —  9 — 
16 —  15 — 

2) Строение какой структуры позволяет разделить бактерии на две 2) Определите, какими цифрами на рисунке обозначены следую-
группы — грамположительные и грамотрицательные? Укажите щие структуры:
цифру и напишите название структуры. атриовентрикулярный двустворчатый клапан (митраль-
 ный)  —    ; атриовентрикулярный трехстворчатый кла-
пан —    ; полулунные клапаны —    .

 20. Рассмотрите животных, изображенных на рисунке. Назовите их
3) В состав какой структуры входит белок флагеллин? Укажите и укажите особенности их внешнего, внутреннего строения и рас-
цифру и напишите название структуры. пространения.

4) Какая структура выполняет одинаковые функции в  клетках 1
эукариот и прокариот, но у одних она имеет более высокий ко- 2 3
эффициент седиментации, чем у других? Укажите цифру и на-
пишите название структуры.

4 5
19. Рассмотрите схематическое изображение сердца человека.

100 Практические задания Практические задания 101

2) Укажите в таблице, на каких континентах или в каких частях

света обитают животные, изображенные на рисунке.
Континент, часть света (№

Северная Америка
Южная Америка (включая Центральную)
9 Австралия (включая Новую Зеландию)
Азия (включая Индонезию)

12 13
3) Найдите соответствие между особенностями строения отдель-
ных органов и структур и животными, изображенными на ри-
1) Внесите в таблицу названия отрядов, к которым относятся изо- сунке.
браженные на рисунке животные.
Животное Отряд Особенности строения (№
1 рисунка)

2 Мезонефрические почки
3 Шейный отдел позвоночника состоит из семи по-
4 звонков

5 Сложно устроенный четырехкамерный желудок

6 Мочевая кислота как основной продукт выделения

7 Пара мощных резцов, которые растут в  течение

всей жизни (их наружная поверхность образована
8 твердой эмалью, а остальная часть — дентином)
10 21. В больницу скорой помощи поступил человек, у которого наблю-
дались следующие симптомы заболевания: перемежающаяся ли-
хорадка (лихорадочные приступы при температуре 40 °С чередо-
12 вались с периодами нормальной температуры), печень и селезенка
13 увеличены. Анализ крови показал анемию.
14 Фотографии мазков крови этого больного приведены на с. 102.
102 Практические задания Практические задания 103

22. Рассмотрите изображенных на рисунке животных. Установите

соответствие между конечными продуктами азотистого обмена
веществ и животными, которые эти продукты преимущественно
выделяют. (Укажите соответствующий № рисунка в таблице.)

а б 3
1 4
1) Какой возбудитель явился причиной заболевания?

2) В каких клетках проходит развитие стадий паразита на данных
5 7
мазках крови больного? 

3) Как называется процесс бесполого размножения, который при-
водит к увеличению числа паразитов (фотография б)?

11 12
4) Как называются стадии, которые образуются в результате бес-
полого размножения паразита?

Конечный продукт Животное
 азотистого обмена веществ (№ рисунка)
5) Каким образом произошло заражение данного человека? Аммиак

6) Как называется стадия развития паразита, на которой проис- Мочевая кислота

ходит заражение человека?  Гуанин

23. Синтез белков осуществляется как на рибосомах цитоплазмы,
7) Укажите органоиды, которые обеспечивают проникновение па- так и на рибосомах, расположенных на эндоплазматической сети
разита в клетки хозяина. (ЭС). Укажите, какие белки синтезируются на рибосомах цито-
 плазмы, а какие — на рибосомах ЭС.
1  — антитела; 2  — ДНК-полимераза; 3  — казеин; 4  — гистоны;
8) Какие мероприятия проводят для борьбы с данным заболева- 5  —  рецептор инсулина; 6  — гликогенсинтетаза; 7  — глобин;
нием? 8  —  лактатдегидрогеназа; 9  — гормон роста; 10  — пепсиноген;
 11 — фибриноген; 12 — актин.
104 Практические задания Практические задания 105

Рибосомы цитоплазмы 5. Дрейф Д. Снижение приспособленности как результат скрещи-

Рибосомы ЭС генов ваний между генетически различными организ­мами
6. Мутация Е. Наблюдаются снижение степени различий между
24. Ознакомьтесь с морфологическими описаниями трех видов жест- субпопуляциями и увеличение внутри субпопуляций
кокрылых. На основании этих описаний составьте определитель-
ную таблицу подобно тому, как это сделано в определителях на- Таблица ответов
секомых. 1 2 3 4 5 6
Навозник весенний (Geotrupes vernalis) — длина тела 14—20 мм.
Окраска верха тела разнообразная, от зеленой до черно-синей.
Надкрылья без бороздок (продольные углубления, часто с ряда- 26.* Растения получают из почвы различные физиологически важные
ми точек). Задние голени с двумя поперечными килями. Передние элементы минерального питания. Установите соответствие между
конечности копательные. элементами минерального питания и выполняемыми ими функ-
Навозник лесной (Geotrupes stercorosus) — длина тела 13—20 мм. Окра- циями.
ска верха тела черно-синяя, со слабым блеском. Надкрылья с борозд-
Элемент ми-
ками (продольные углубления, часто с рядами точек). Задние голени нерального
Функция, которую выполняет
с двумя поперечными килями. Передние конечности копательные. в растительном организме
Навозник обыкновенный (Geotrupes stercorarius)  — длина тела
1. Кальций А. Катион, необходимый для изменения тургора в за-
16—27 мм. Окраска верха тела черно-синяя или черно-зеленая. Над-
мыкающих клетках устьиц
крылья с бороздками (продольные углубления, часто с рядами то-
чек). Задние голени с тремя поперечными килями. Передние конеч- 2. Азот Б. Форма азота, обычно доступная для усвоения рас-
ности копательные. тением в естественных экосистемах
3. Нитрат В. Необходим для биосинтеза боковых цепей амино-
25.* Найдите соответствие между терминами и утверждениями. Ре- кислот цистеина и метионина
зультаты внесите в таблицу ответов. 4. Иод Г. Компонент всех аминокислот, нуклеотидов и хло-
1. Инбредная А. Закрепляются благоприятствующие аллели и элими-
депрессия нируются не благоприятствующие 5. Фосфат Д. «Центральный» атом в молекуле хлорофилла

2. Поток ге- Б. Такое событие происходит редко и приводит к воз- 6. Магний Е. Позволяет клеточным стенкам слипаться при по-
нов растанию генетического разнообразия внутри суб- мощи пектиновых веществ
популяций и между ними 7. Калий Ж. Важный компонент ДНК и РНК, но не пуриновых
3. Отбор В. Степень различий возрастает между субпопуляция- или пиримидиновых оснований
ми и уменьшается внутри субпопуляций 8. Сульфат З. Наиболее распространенный ион металла в белках,
4. Аутбред- Г. Наблюдается снижение жизнеспособности в резуль- транспортирующих электроны
ная де- тате возрастания гомозиготности, возрастает степень 9. Mарганец И. Его главная функция в фотосинтезе — расщепление
прессия экспрессии вредных аллелей как следствие скрещи- воды
ваний между близкородственными организмами
10. Железо К. Не является существенным для роста растений
106 Практические задания Практические задания 107

Таблица ответов Укажите в таблице, в какой доле коры расположен каждый из от-
1 2 3 4 5 6 7 8 9 10
меченных на рисунке участков; как называется зона коры, в ко-
торой расположен этот участок; какую функцию выполняет эта
зона коры.
27. Установите соответствие между зародышевыми листками и орга-
нами (системами органов), которые из них образуются. № Доля коры Зона коры Функция зоны

I — эктодерма; II — мезодерма; III — энтодерма. 1

Эпителиальная выстилка носа и ротовой полости  2
Сердце  3
Эпителиальная выстилка кишечника 
Поджелудочная железа 
Половые железы 
Скелетные мышцы 
Мозжечок  29. На рисунке показаны этапы реализации генетической информа-
ции. Рассмотрите рисунок и дайте ответы на вопросы.
Кровь и лимфа 
Печень  Плазматическая мембрана

28. На рисунке изображена поверхность коры одного из больших по-

1 2 Цитоплазма
3 4
А В 5
1 2 Б Г

Ядерная оболочка
1) Укажите название процессов, обозначенных на рисунке буквами

2) Укажите название соединений, обозначенных на рисунке циф-

рами 1—5.
1 2 3 4 5

108 Практические задания Практические задания 109

30. Укажите признаки, верные (да) или неверные (нет) в отношении Однодольные растения
бактерий. Двудольные растения
Признак Да/Нет
Ядро отсутствует 32. На рисунке изображено строение скелета млекопитающего.
Имеются рибосомы 3
Одноклеточный одноядерный организм
1 11
Митохондрии отсутствуют 4
Размножаются спорами 6 20
Характерно простое бинарное деление 8
7 21 13 14 12
Имеют жгутики 10
9 22
Некоторые являются фотосинтезирующими 15 23 24
Могут вступать в симбиоз с грибами 19
У цианобактерий отсутствует клеточная оболочка 16 26
В цитоплазме расположены плазмиды 18

31. Рассмотрите рисунок и укажите, под какими номерами изобра- Укажите названия элементов, обозначенных цифрами:
жены структуры, характерные большинству видов однодольных 1 — 
и двудольных растений соответственно. Результаты внесите в та- 3 — 
блицу, указав номера этих структур. 8 — 
11 — 
15 — 
16 — 
20 — 
1 2 3 22 — 
24 — 
25 — 
26 — 
4 5
33. Укажите клетки, входящие в состав наружного и внутреннего сло-
ев тела гидры. Ответ запишите в таблицу.
1 — кожно-мускульные клетки со жгутиками; 2 — кожно-мускуль-
6 7 ные клетки без жгутиков; 3 — стрекательные клетки; 4 — желези-
стые пищеварительные клетки; 5 — резервные клетки; 6 — половые
клетки; 7 — нервные клетки.
Наружный слой клеток (эпидермис)
8 9 10 Внутренний слой клеток (гастродермис)
110 Практические задания Практические задания 111

34. Используя рисунок, дайте ответы на вопросы, касающиеся пище-

варительной системы, указав номер соответствующей структуры. 1

1 3

4 5

Элемент рефлекторной дуги № элемента на схеме

Рабочий орган
5 4
Центробежный нейрон
6 8
7 9 Центростремительный нейрон
10 Вставочный нейрон
11 12 Рецептор

36. Рассмотрите рисунок, на котором изображены органеллы клетки,

и ответьте на поставленные вопросы.

№ структуры
на рисунке
1. В каком отделе пищеварительной системы вы-
деляется пепсин?
2. Крупная непарная железа смешанной секреции?
3. Отдел кишечника, в который впадают желчные
4. Отдел кишечника, в котором преимущественно
происходит всасывание пищи? 1) На рисунке изображены:
5. Воспаление какого органа приводит к заболева- А—
нию, называемому холецистит? Б—
6. Отдел кишечника, в котором происходит пре-
имущественное всасывание воды? 2) Какие основные функции выполняют в клетках данные орга-
35. Рассмотрите схему строения рефлекторной дуги и заполните та- Органелла А
Органелла Б
112 Практические задания

37. Рассмотрите схему расположения же-

лез внутренней секреции и органов че- 1
ловека. Найдите соответствие между
этими структурами и утверждениями,
2 3
характеризующими действие гормонов,
которые они выделяют. Ответ запишите 4
в таблицу, указав номер соответствую-
щей струк­туры. 6

Утверждение Железа
Выделяет гормон, увеличивающий всасывание Na
в кровь
Секреция гормона увеличивается при снижении Ca2+
ниже нормы
При снижении секреции гормона скорость основного ме-
таболизма снижается
Продукты секреции необходимы для формирования кле-
точного иммунитета
Выделяет гормон, стимулирующий образование эритро-
цитов в костном мозге
При отсутствии ее гормона организм теряет чрезмерное
количество воды
Секрецию гормона этой железы стимулирует еда, богатая
Выделяемый гормон необходим для химического рас-
щепления белков
11 класс 115

Районная олимпиада, г. Минск. г) доминирование;

д) ни одно из перечисленных взаимодействий не является аллель-
2006/2007 учебный год ным.
11 класс 6. Для представителей каких отрядов насекомых характерно разви-
тие с полным метаморфозом?
1 — жесткокрылые; 2 — бабочки; 3 — прямокрылые; 4 — клопы;
Часть А 5 — перепончатокрылые; 6 — стрекозы.
1. Выберите признаки, характерные для плесневых грибов. а) 1, 4, 5; в) 1, 2, 5; д) 1, 5, 6.
1 — продукт выделения мочевина; 2 — в состав клеточной стенки б) 2, 4, 6; г) 2, 3, 6;
входит муреин; 3 — фотосинтезирующие организмы; 4 — размно- 7. В лесах Южной и Центральной Америки встречаются случаи опы-
жаются спорами; 5 — мицелий отсутствует; 6 — вызывают фито­
ления цветковых растений летучими мышами. Как  называется
фтороз томатов.
данное явление?
а) 1, 4, 5; в) 1, 3, 4; д) 1, 4.
б) 2, 4, 6; г) 1, 2, 6; а) Энтомофилия; г) хироптерофилия;
б) орнитофилия; д) малакофилия.
2. Сальвиния плавающая относится к отделу растений: в) мирмекофилия;
а) Голосеменные; г) Папоротниковидные;
б) Моховидные; д) Хвощевидные. 8. Какой организм является промежуточным хозяином в цикле раз-
в) Покрытосеменные; вития эхинококка?
а) Моллюск; г) человек;
3. Какие из перечисленных клеток листа двудольного растения вы- б) рыба; д) собака.
полняют основную ассимилирующую роль на свету?
в) муравей;
а) Клетки верхнего эпидермиса;
б) клетки столбчатой паренхимы; 9. У посевной фасоли с генотипом С-D- пурпурные цветки. Растения
в) клетки нижнего эпидермиса; с остальными возможными вариантами генотипов имеют белые
г) клетки губчатой паренхимы; цветки. Скрестили растения с генотипами CCdd и ccDD (гены
д) сосуды ксилемы. находятся в разных парах гомологичных хромосом). Какое рас-
щепление по фенотипу будет у гибридов второго поколения?
4. Какое ядро у инфузории туфельки является всегда диплоидным?
а) 1 белые : 1 пурпурные; г) 9 пурпурные : 7 белые;
а) Макронуклеус; г) мегануклеус;
б) 3 пурпурные : 1 белые; д) 13 пурпурные : 3 белые.
б) пронуклеус; д) нет правильного ответа.
в) микронуклеус; в) 1 пурпурные : 3 белые;

5. К аллельному взаимодействию генов относится: 10. Для борьбы с насекомыми — вредителями сельского хозяйства
наиболее целесообразно и экологически безопасно использовать:
а) эпистаз;
б) полимерия; а) гербициды; г) животных-энтомофагов;
в) комплементарность; б) инсектициды; д) животных-ихтиофагов.
в) животных-орнитофагов;
116 Районная олимпиада, г. Минск. 2006/2007 учебный год 11 класс 117

11. Гомологичными органами являются: г) I — 1, 2; II — 3, 8; III — 5, 7; IV — 4, 6;

а) лапа кошки и нога медведки; д) I — 4; II — 1, 3, 2, 8; III — 5, 7; IV — 6.
б) глаз человека и глаз паука;
16. К двумембранным структурам клетки относятся:
в) чешуя рептилий и перья птиц;
г) крыло бабочки и крыло летучей мыши; 1 — рибосомы; 2 — митохондрии; 3 — комплекс Гольджи; 4 — эндо-
д) верхняя челюсть собаки и мандибулы жука-носорога. плазматичекий ретикулум; 5 — ядро; 6 — пластиды; 7 — цен­триоли.
а) 2, 5, 6; г) 2, 3, 5;
12. Известно, что растение имеет генотип AaBbccDd. Какого расще-
пления по фенотипу можно ожидать в потомстве этого растения б) 1, 2, 6; д) 3, 5, 6, 7.
при самоопылении при условии полного доминирования по всем в) 3, 4, 7;
парам аллелей? 17. Потенциал покоя аксона характеризуется следующими призна­
а) 3 : 1; ками:
б) 9 : 3 : 3 : 1; 1 — высокая концентрация ионов K+ внутри аксона и низкая сна-
в) 9 : 7; ружи; 2 — низкая концентрация ионов K+ внутри аксона и высо-
г) 27 : 9 : 9 : 9 : 3 : 3 : 3 : 1; кая снаружи; 3 — высокая концентрация ионов Na+ внутри аксона
д) 81 : 27 : 27 : 27 : 27 : 9 : 9 : 9 : 9 : 9 : 9 : 3 : 3 : 3 : 3 : 1. и низкая снаружи; 4 — низкая концентрация ионов Na+ внутри
13. Определите жизненную емкость легких человека, если известно, аксона и высокая снаружи.
что дыхательный объем равен 450 мл, дополнительный объем — а) 1, 4; в) 1, 3;
1500 мл, резервный — 1500 мл, а общий объем легких составляет б) 2, 3; г) 2, 4.
5000 мл.
а) 1550 мл; в) 3450 мл; д) 4550 мл. 18. Пятая пара черепно-мозговых нервов человека (тройничный нерв)
б) 3050 мл; г) 1950 мл; иннервирует:
а) глотку; г) кишечник;
14. Какие из перечисленных фитогормонов оказывают тормозящее
б) сетчатку; д) мышцы челюстей.
действие на рост растений?
в) полукружные каналы;
1 — ауксины; 2 — гибберилины; 3 — цитокинины; 4 — абсцизовая
кислота; 5 — этилен. 19. Выберите признаки, характерные для шероховатого эндоплазма-
а) 1, 2, 5; в) 4, 5; д) 3, 5. тического ретикулума (ШЭР) и гладкого эндоплазматического
б) 2, 3, 4; г) 2, 4; ретикулума (ГЭР).
1 — состоит из мембранных мешочков (цистерн); 2 — обеспечивает
15. Найдите соответствие между белками и выполняемыми ими функ-
синтез липидов; 3 — участвует в транспорте белков; 4 — покрыт
рибосомами; 5 — обильно представлен в клетках, секретирующих
I — структурные белки; II — ферменты; III — транспортные белки; стероидные гормоны; 6 — обильно представлен в клетках, секре-
IV — защитные белки. тирующих ферменты.
1 — коллаген; 2 — трипсин; 3 — эластин; 4 — тромбин; 5 — мио- а) ШЭР — 1, 2, 4; ГЭР — 1, 3, 5;
глобин; 6 — фибриноген; 7 — гемоцианин; 8 — глутаминсинтетаза. б) ШЭР — 2, 3, 4; ГЭР — 1, 2, 6;
а) I — 1, 5; II — 2, 4; III — 7, 8; IV — 3, 6; в) ШЭР — 4, 6; ГЭР — 1, 4, 5;
б) I — 3; II — 2, 8; III — 1, 4, 5; IV — 6, 7; г) ШЭР — 1, 3, 4, 6; ГЭР — 1, 2, 5;
в) I — 1, 3; II — 2, 8; III — 5, 7; IV — 4, 6; д) ШЭР — 4; ГЭР — 1, 5, 6.
118 Районная олимпиада, г. Минск. 2006/2007 учебный год 11 класс 119

20. Найдите соответствие между эндокринными железами и гормона- 25. В  процессе сперматогенеза первое деление мейоза происходит
ми, которые они выделяют. на стадии:
I — передняя доля гипофиза; II — задняя доля гипофиза; III — кора а) сперматид;
надпочечников; IV — щитовидная железа. б) спермиев;
1 — вазопрессин; 2 — пролактин; 3 — альдостерон; 4 — тиреокаль- в) сперматоцитов I порядка;
цитонин. г) сперматогониев;
а) I — 1, II — 3; III — 2; IV — 4 г) I — 3, II — 4; III — 1; IV — 2; д) сперматоцитов II порядка.
б) I — 2, II — 3; III — 4; IV — 1 д) I — 4, II — 1; III — 2; IV — 3.
в) I — 2, II — 1; III — 3; IV — 4. 26. Что  определяет количество нейромедиатора, выделяющегося
из пресинаптического окончания?
21. В молочных железах млекопитающих происходит секреция:
а) Отсутствие приходящих потенциалов действия;
а) мерокринная; б) частота приходящих потенциалов действия;
б) апокринная; в) длительность приходящих потенциалов действия;
в) мерокринная и апокринная; г) верны все приведенные ответы.
г) голокринная;
д) голокринная и апокринная. 27. Определите, какое количество нуклеотидов в составе иРНК будет
соответствовать 24 аминокислотным остаткам в полипептиде?
22. Активный фермент представляет собой сочетание кофактора и:
а) 12; г) 72;
а) апофермента; г) гема;
б) кофермента; д) активного центра. б) 24;    д) 144.
в) голофермента; в) 48;      

23. Из предложенных видов животных выберите гермафродитов. 28. Укажите антикодоны тРНК если известно, что нетранскрибируе-
мая цепь ДНК имеет нуклеотидную последовательность
1 — махаон; 2 — медицинская пиявка; 3 — эхинококк; 4 — песко-
жил; 5 — черноморский морской конек; 6 — янтарка обыкновенная. 5'-ATAГГГЦАТЦТА-3':
а) 1, 3, 6; г) 3, 5; а) УАУ, ЦЦЦ, ГУА, ГАУ; г) УАУ, ГГГ, ЦАУ, ГАУ;
б) 2, 3, 6; д) 3, 4, 5. б) АУА, ЦЦЦ, ГАУ, ГУА; д) АУУ, ГГГ, ГАУ, ГУА.
в) 2, 4, 6; в) ТАТ, ЦЦЦ, ГТА, ГАТ;
24. Для гликолиза характерно: 29. Пять видов «горных индеек»  — уларов, обитающих в  высоко­
1 — реакции проходят на кристах митохондрий; 2 — чистый выход горьях Азии (кавказский, каспийский, гималайский, тибетский,
АТФ равен двум молекулам; 3 — реакции протекают в цитоплазме; алтайский), возникли в результате изоляции:
4 — требуется обязательное наличие кислорода; 5 — из одной мо- а) экологической; в) этологической;
лекулы глюкозы образуется две молекулы пировиноградной кис- б) географической; г) хронологической.
лоты; 6 — образуется ацетилкофермент А; 7 — чистый выход АТФ
равен четырем молекулам; 8 — в итоге образуются CO2 и H2O. 30. Диплоидный набор хромосом имеет:
а) 1, 3, 5; г) 2, 4, 8; а) оогоний; г) сперматида;
б) 1, 2, 6, 7; д) 2, 3, 4, 7. б) сперматоцит II порядка; д) сперматозоид.
в) 2, 3, 5; в) ооцит II порядка;
120 Районная олимпиада, г. Минск. 2006/2007 учебный год 11 класс 121

31. Гормон из группы катехоламинов, который синтезируется у по- 36. Имеется фрагмент ДНК известной последовательности. Какой
звоночных в хромафиных клетках и выделяется при стрессе, — это: метод можно использовать для многократного увеличения коли-
а) инсулин; чества этой последовательности ДНК?
б) паратгормон; а) Нозерн-блоттинг;
в) адреналин; б) полимеразная цепная реакция;
г) окситоцин; в) секвенирование;
д) кальцитонин. г) электрофорез в агарозном геле.
32. Расположите этапы онтогенеза хордовых во временном порядке 37. У человека лимбическая система располагается в мозге:
(начиная с первого).
а) заднем; г) переднем;
1 — бластула, 2 — гаструляция; 3 — зигота; 4 — оплодотворение; б) продолговатом; д) спинном.
5 — нейруляция. в) среднем;
а) 1 → 2 → 3 → 4 → 5; г) 4 → 1 → 3 → 2 → 5;
б) 2 → 3 → 1 → 4 → 5; д) 3 → 4 → 1 → 5 → 2. 38. Во время мейоза кроссинговер происходит на стадии:
в) 4 → 3 → 1 → 2 → 5; а) профазы I; г) метафазы II;
б) профазы II; д) анафазы I.
33. Гликокаликсу присущи функции: в) метафазы I;
1 — защита поверхности клетки; 2 — движение органелл внутри
клетки; 3 — обмен липидов и углеводов; 4 — межклеточное узна- 39. Регенерация у кишечнополостных возможна благодаря наличию
вание; 5 — объединение клеток. клеток:
а) 1, 2; г) 2, 3, 4; а) эпителиально-мускульных; г) интерстициальных;
б) 1, 2, 3; д) 1, 4, 5. б) нервных; д) железистых.
в) 1, 3; в) половых;
34. Укажите правильное утверждение, касающееся лимфы: 40. Экспериментально блокировать репликацию ДНК можно:
а) формируется из тканевой жидкости; а) митомицином; в) пуромицином;
б) содержит эритроциты и лейкоциты; б) актиномицином; г) циклогексимидом.
в) омывает все клетки;
г) точно соответствует по составу плазме крови; 41. Пресноводная рыба горчак откладывает икринки в мантийную по-
д) содержит большое количество стволовых клеток. лость двустворчатых моллюсков, где из них выводятся личинки.
Это является примером:
35. Частота индивидов с наследуемым аутосомным рецессивным на- а) паразитизма; в) комменсализма;
рушением равна 25 %. Популяция, пораженная этой болезнью, б) протокооперации; г) гиперпаразитизма.
находится в состоянии равновесия в соответствии с законом Хар-
ди — Вайнберга. Определите долю носителей данного нарушения 42. Растение повилика клеверная является:
в этой популяции: а) продуцентом;
а) 12,5 %; г) 75 %; б) консументом I порядка;
б) 25 %; д) 100 %. в) консументом II порядка;
в) 50 %; г) редуцентом.
122 Районная олимпиада, г. Минск. 2006/2007 учебный год 11 класс 123

43. Какой из видов жесткокрылых является некрофагом? 9. Экологическая группа активно плавающих животных, способных
а) Божья коровка; противостоять течению и  преодолевать значительные расстоя-
б) жужелица золотоямчатая; ния, —  .
в) мертвоед некрофорус; 10. Внутриклеточная пластинка, зачаток клеточной стенки, возника-
г) мягкотелка бурая. ющая в делящихся клетках большинства растений на стадии те-
лофазы митоза, —  .
44. Сплайсинг — это процесс:
а) транскрипции эукариотного гена;
Задачи по генетике
б) присоединения интронов к экзонам;
в) вырезания копий экзонов из РНК и сшивание копий интронов; 1. У человека праворукость доминирует над леворукостью, а карий
г) вырезания копий интронов из РНК и сшивание копий экзонов. цвет глаз — над голубым. В брак вступают кареглазый мужчина-
правша, мать которого была голубоглазой левшой, и голубоглазая
45. Какой из  организмов нельзя включить в  единую трофическую
женщина-правша, отец которой был левшой. Какова вероятность
цепь, составленную из других перечисленных видов?
того, что у этой пары родится ребенок-левша? (Выразите в %.)
а) Лемминг; в) осока;
б) песец; г) афалина. 2. У кур ореховидная форма гребня определяется взаимодействием
локализованных в разных парах хромосом доминантных генов,
каждый из которых имеет самостоятельное фенотипическое про-
Часть В
явление — розовидную или гороховидную форму соответственно.
1. Связанные с ДНК хромосомные белки, содержащиеся в ядрах кле- Рецессивные по обеим парам указанных генов особи имеют листо-
ток растений и животных, —  . видную форму гребня. Курицу с листовидным гребнем скрестили
с гетерозиготным петухом, имеющим ореховидную форму гребня.
2. Паразитическая личинка пресноводных двустворчатых моллю-
Какова вероятность появления в потомстве цыплят, имеющих ро-
сков семейства Перловицы —  .
зовидную и гороховидную форму гребня? (Выразите в %.)
3. Разновидность костной ткани, входящая в  состав плакоидной
чешуи рыб и  составляющая основную массу зуба млекопитаю- 3. В одном из селений проживают 5000 человек, 3200 из которых
щих, —  . способны свертывать язык трубочкой (доминантный признак,
детерминирован геном R), 1800 человек такой способностью
4. Канал, соединяющий полость среднего уха с носоглоткой у чело- не обладают (рецессивный ген r). Определите частоту встреча-
века, —  . емости  в  данной популяции людей, имеющих гетерозиготный
5. Взрослая (дефинитивная) стадия развития насекомых —  генотип Rr (выразите в %).
6. Близкородственное скрещивание —  .
7. Полая белковая структура, в полости которой находится вирусный
геном, —  .
8. Отряд вторичноводных млекопитающих, лишенных волосяного
покрова и кожных желез, —  .
11 класс 125

Районная олимпиада, г. Минск. 4. Выберите верное утверждение, характеризующее одну из стадий

конъюгации у инфузорий:
2007/2008 учебный год а) макронуклеус делится и образует 2 ядра;
б) первое деление микронуклеуса не приводит к редукции числа
11 класс хромосом;
в) микронуклеус делится несколько раз и образует 8 ядер;
г) деление микронуклеуса приводит к редукции числа хромосом;
Часть А д) последовательно делятся макро- и микронуклеус, образуется
4 ядра.
1. Укажите, к какой морфологической группе относятся изображен-
5. При обследовании заплесневевших продуктов ученый сфотогра-
ные на рисунке бактерии: фировал организм, который вызвал повреждения (cм. рисунок).
а) стафилококки; Что это за организм?
б) стрептококки; а) Мукор;
в) бациллы; б) пеницилл;
г) вибрионы; в) аспергилл;
д) спириллы. г) мужоция;
д) спорынья.

2. В пастеризованное молоко добавили одну бактериальную клетку.

Через какое время численность бактериальных клеток достигнет
1024? (Условия для размножения оптимальные.)
а) 3 ч 20 мин; 6. Какие образования участвуют в вегетативном размножении ли-
б) 2 ч 30 мин; шайников, а также позволяют лишайникам увеличивать ассими-
в) 60 мин; ляционную поверхность слоевища?
г) 24 ч; а) Изидии;
д) 10 ч 15 мин. б) соредии;
в) гаплоидные споры;
3. Укажите, какие организмы характеризуются следующим набором г) диплоидные споры.
приз­наков: одиночные или колониальные; хлоропласты содержат 7. Для  современных представителей какого отдела растительного
хлорофиллы a и c и фукоксантин; имеется твердая кремнеземная царства характерно образование гаметофитов длиной до 2 см, пи-
оболочка; запасные вещества волютин и хризоламинарин. тающихся микотрофно?
а) Бурые водоросли; а) Pinophyta;
б) цианобактерии; б) Bryophyta;
в) зеленые водоросли; в) Magnoliophyta;
г) диатомовые водоросли; г) Lycopodiophyta;
д) красные водоросли. д) Equisetophyta.
126 Районная олимпиада, г. Минск. 2007/2008 учебный год 11 класс 127

8. В результате транскрипции фрагмента ДНК получена пре-иРНК 13. Определите, какое количество молекул АТФ может получить
3'-АУГГГГГЦГАУАЦЦЦ-5'. Какой будет последовательность зре- в качестве полезного энергетического выхода клетка в результате
лой иРНК после сплайсинга, если известно, что интронами в этой гликолиза 2,5 моль глюкозы.
ДНК являются участки ЦЦЦЦГЦ и ГГГ? а) 5; г) 3,01 ⋅ 1024;
а) 3'-АУГГЦГЦЦЦ-5'; б) 15; д) 2,05 ⋅ 1023.
б) 3'-АУГГГГГЦГАУАЦЦЦ-5'; в) 5 ⋅ 10 ;

в) 3'-АУГАУА-5';
г) 3'-АУГЦЦЦ-5'; 14. С4-фотосинтез характеризуется следующими особенностями:
д) 3'-ГЦГАУАЦЦЦ-5'. 1 — акцептором CO2 служит фосфоенолпируват; 2 — акцептором
CO2 служит рибулозобифосфат; 3 — характерен для сорго и сахар-
9. Центриоли состоят из белка: ного тростника; 4 — характерен для сельдерея и картофеля; 5 —
а) актина; г) виментина; промежуточным продуктом является щавелевоуксусная кислота;
б) миозина; д) кератина. 6 — промежуточным продуктом являются две молекулы фосфо-
в) тубулина; глицериновой кислоты.
10. Если из  нуклеотидной последовательности структурной части а) 1, 4; г) 1, 3, 5;
гена будет удален один из нуклеотидов, то: б) 2, 4, 6; д) 1, 6.
в) 2, 3, 5;
а) в этом месте всегда возникает стоп-кодон;
б) это вызовет сдвиг рамки считывания; 15. Найдите соответствие между стадиями мейоза и протекающими
в) аминокислотная последовательность кодируемого этим геном процессами.
белка не изменится; 1 — профаза I; 2 — метафаза II; 3 — анафаза I; 4 — телофаза II.
г) произойдет изменение антикодона тРНК, соответствующей a — спирализация хромосом; б — образование бивалентов; в — нити
триплету, в котором произошла делеция; веретена деления прикрепляются к центромерам бивалентов; г —
д) процесс биосинтеза белка будет осуществляться без  участия нити веретена деления прикрепляются к центромерам отдельных
малой субъединицы рибосом. хромосом; д — гомологичные двухроматидные хромосомы расхо-
11. У людей с болезнью Дауна трисомия по: дятся к полюсам клеток; е — дочерние хромосомы расходятся к по-
люсам клетки; ж — образуются две клетки с гаплоидным набором
а) половым X-хромосомам;
хромосом; з — образуются четыре клетки с гаплоидным набором
б) половым Y-хромосомам;
в) 21-й паре аутосом;
г) 23-й паре аутосом; а) 1аб, 2г, 3д, 4з; г) 1б, 2аг, 3д, 4ж;
д) 4-й паре аутосом. б) 1аб, 2в, 3е, 4з; д) 1в, 2б, 3д, 4з.
в) 1а, 2в, 3б, 4ж;
12. У человека отсутствие потовых желез является рецессивным при-
знаком, сцепленным с Х-хромосомой. В семье отец и сын имеют 16. Немембранным органоидом клетки являются(-ется):
данную аномалию, а мать здорова. Какова вероятность появления а) митохондрии;
в семье дочери с данной аномалией? б) комплекс Гольджи;
а) 0; г) 50 %; в) гладкая эндоплазматическая сеть;
б) 10 %; д) 100 %. г) лизосомы;
в) 25 %; д) микротрубочки.
128 Районная олимпиада, г. Минск. 2007/2008 учебный год 11 класс 129

17. Паратгормон активизирует перемещение ионов кальция из кишеч- 22. Найдите соответствие между животными и личинками, которые
ника в кровь при условии достаточного поступления в организм для них характерны.
человека витамина: 1 — актиния; 2 — пескожил; 3 — печеночный сосальщик; 4 — вино-
а) D2; г) E; градная улитка; 5 — беззубка обыкновенная; 6 — эхинококк.
б) C; д) B1. а — глохидий; б — трохофора; в — мирацидий; г — планула.
в) A;
а) 1б, 2г, 3в, 4а, 5а;
18. Какие вещества необходимы для образования протромбиназы — од- б) 1г, 2б, 3в, 5а;
ного из ферментов, участвующих в процессе свертывания крови? в) 2б, 4а, 5а, 6в;
г) 1г, 3б, 4а, 5а, 6в;
1 — ионы Ca2+; 2 — ионы K+; 3 — тромбин; 4 — тромбопластин;
д) 2а, 3в, 5б, 6в.
5 — плазменные факторы V, VII, X; 6 — фибриноген; 7 — инсулин.
а) 1, 3, 5; г) 1, 3, 6, 7; 23. Цевка птиц образована сросшимися костями:
б) 1, 4, 5; д) 2, 4, 7. а) голени (малой и большой берцовыми);
в) 2, 4, 5, 7; б) ступни (кости плюсны и предплюсны);
в) предплечья (лучевая и локтевая кости);
19. Из перечисленных незаменимыми для человека являются амино- г) фаланг пальцев;
кислоты: д) бедра.
1 — лейцин; 2 — серин; 3 — пролин; 4 — изолейцин; 5 — треонин;
24. Определите состав воздуха.
6 — глутамин; 7 — аспарагин.
I — альвеолярный; II — вдыхаемый; III — выдыхаемый.
а) 1, 4, 5; г) 2, 5, 6, 7;
1 — O2 — 20,94 %; CO2 — 0,03 %; N2 — 79,03 %;
б) 1, 2, 4, 5; д) 1, 3, 6.
2 — O2 — 14,44 %; CO2 — 5,56 %; N2 — 80,00 %;
в) 2, 3, 4, 6;
3 — O2 — 16,30 %; CO2 — 4,00 %; N2 — 79,07 %;
20. Какие структуры формируются из эктодермы в процессе органо- 4 — O2 — 25,01 %; CO2 — 1,38 %; N2 — 60,02 %;
генеза? 5 — O2 — 1,87 %; CO2 — 3,14 %; N2 — 79,03 %.
1 — печень; 2 — протоки половых желез; 3 — хрящевая ткань; 4 — а) I — 1, II — 2, III — 5;
спинной мозг; 5 — хорда; 6 — волосы; 7 — ногти; 8 — глаза; 9 — щи- б) I — 2, II — 1, III — 3;
товидная железа; 10 — тела позвонков. в) I — 2, II — 3, III — 1;
а) 3, 4, 5, 8, 10; г) 4, 5, 6, 8, 10; г) I — 1, II — 2, III — 4;
б) 1, 2, 4, 5, 9; д) 3, 5, 6, 8. д) I — 1, II — 4, III — 5.
в) 4, 6, 7, 8;
25. При  составлении формул цветков, для  обозначения отдельных
21. Центры защитных рефлексов — кашля, чихания, рвоты — находят- элементов, используют латинские буквы: Ca  — чашечка, Cо  —
ся в: венчик, A — андроцей (тычинки), G — гинецей (пестики), а также
скобки ( ), которые обозначают срастание частей цветка. Укажите
а) мозжечке;
формулу, соответствующую цветку дикой редьки (представитель
б) спинном мозге;
семейства Крестоцветные):
в) таламусе;
г) продолговатом мозге; а) Ca (5)Co(5)A4G(2); в) Ca4Co4A6G(2);
д) затылочной области коры больших полушарий. б) Ca0Co(5)A5G(2); г) Ca(5)Co5A10G1.
130 Районная олимпиада, г. Минск. 2007/2008 учебный год 11 класс 131

26. Установите соответствие между организмами и  особенностями 30. Какое расщепление по фенотипу будет у потомков первого поко-
их жизненных циклов. ления, если известно, что скрестили две дигетерозиготные роди-
I — стадия гаметофита доминирует над стадией спорофита; тельские формы? (Признаки наследуются независимо.)
II — стадия спорофита доминирует над стадией гаметофита. а) 1 : 1 : 1 : 1; г) 9 : 3 : 4;
б) 3 : 1; д) 12 : 3 : 1.
1 — маршанция многообразная; 2 — тисс ягодный; 3 — фунария
в) 9 : 3 : 3 : 1;
гигрометрическая; 4 — азолла мелколистная; 5 — сфагнум бурый;
6 — гинкго двулопастный. 31. Мегаспорангием покрытосеменных является(-ются):
а) I — 4, 5; II — 1, 2, 3, 6; а) семязачаток; г) клетки-антиподы;
б) I — 1, 3, 5; II — 2, 4, 6; б) пыльцевое зерно; д) зрелая яйцеклетка.
в) клетки-синергиды;
в) I — 1, 5; II — 2, 3, 4, 6;
г) I — 1, 5, 6; II — 2, 3, 4. 32. Укажите, какие углеводы относятся к:
I — моносахаридам пентозам; II — дисахаридам; III — полисаха-
27. Клетки губчатой паренхимы листа в отличие от столбчатой парен-
химы: 1 — глюкоза; 2 — фруктоза; 3 — рибулоза; 4 — мальтоза; 5 — лактоза;
а) содержат хлоропласты; 6 — гликоген; 7 — рибоза; 8 — инулин.
б) более интенсивно участвуют в процессе транспирации; а) I — 1, 2; II — 4; III — 8;
в) более интенсивно участвуют в процессе фотосинтеза; б) I — 3, 7; II — 4, 5; III — 6, 8;
г) прилегают к верхнему эпидермису; в) I — 1; II — 2, 3, 4, 5; III — 8;
д) плотно прилегают друг к другу. г) I — 7; II — 1, 2; III — 8;
28. Выберите признаки, характеризующие ландыш майский. д) I — 3, 4; II — 1, 2, 7; III — 5, 8.
1 — жилкование листьев дуговое; 2 — корневая система стержне- 33. Какие из кодонов не соответствуют аминокислотам в полипептид-
вая; 3 — проводящие пучки без камбия; 4 — в проводящих пучках ной цепи?
есть камбий; 5 — плод ягода; 6 — плод стручок; 7 — семена с эндо- 1 — АУГ; 2 — УГА; 3 — ГГГ; 4 — УУУ; 5 — УАГ; 6 — УАУ; 7 — УАА;
спермом; 8 — насекомоопыляемое; 9 — ветроопыляемое. 8 — ААА.
а) 2, 4, 5, 7, 8; г) 1, 3, 5, 7, 8; а) 1, 2, 5, 7, 8; г) 2, 3, 4, 6, 8;
б) 1, 4, 5, 9; д) 3, 5, 7, 9. б) 1, 2, 7; д) 2, 5, 7.
в) 1, 3, 6, 8; в) 1, 3, 8;
29. Антидиуретический гормон (АДГ): 34. У грамположительных бактерий в отличие от грамотрицательных:
а) усиливает выход кальция из костей в кровь; а) имеется оболочка, состоящая из муреина;
б) увеличивает секрецию соматотропина; б) всегда присутствует жгутик;
в) усиливает реабсорбцию ионов Na+; в) отсутствует дополнительный слой клеточной стенки — наруж-
г) увеличивает поглощение воды стенками дистального извитого ная мембрана;
канальца нефрона; г) отсутствует нуклеоид;
д) сужает выносящие сосуды клубочка нефрона. д) плазмиды не участвуют в размножении.
132 Районная олимпиада, г. Минск. 2007/2008 учебный год 11 класс 133

35. Известно, что колорадский жук питается только на видах расте- 40. Какие организмы являются продуцен­тами?
ний семейства Пасленовые. К какой трофической группе он отно­ 1 — анабена спиралевидная; 2 — петров крест; 3 — повилика по-
сится? левая; 4 — клевер пашенный; 5 — рододендрон золотистый; 6 —
а) Монофаги; в) полифаги; можжевельник обыкновенный; 7 — пырей ползучий; 8 — секвойя
б) олигофаги; г) пантофаги. гигантская.
36. Выберите утверждение, верное в отношении планктонных орга- а) 1, 4, 5, 6, 7, 8;
низмов: б) 2, 4, 5, 6, 7, 8;
а) активно плавают в воде и способны противостоять течению; в) 3, 4, 5, 6, 7, 8;
б) имеют специализированные органы прикрепления; г) 3, 4, 7;
в) имеют многочисленные выросты или щетинки, которые увели- д) 1, 2, 3, 4, 5, 6, 7, 8.
чивают поверхность их тела;
г) имеют хорошо развитые органы движения — плавники; 41. Одной из причин борьбы за существование в природе является:
д) включают только животных, обладающих альвеолярными лег- а) стремление организмов к эволюционному совершенству;
кими. б) способность живых организмов размножаться в геометрической
37. Из предложенных организмов составьте пастбищную пищевую
в) необходимость постоянно образовывать новые виды для заме-
цепь, которая возможна в условиях Беларуси.
ны вымерших;
1 — листовой опад; 2 — черемуха; 3 — сурикат; 4 — тля; 5 — садовая г) свободное скрещивание разных видов между собой и появление
славка; 6 — дождевой червь; 7 — хищный клоп (антокорис); 8 — большого числа гибридных форм.
секвойя; 9 — крот; 10 — ястреб-тетеревятник.
а) 2 → 4 → 3 → 10; г) 8 → 7 → 3 → 10; 42. Бактериофаги являются:
б) 1 → 6 → 9 → 10; д) 2 → 4 → 3 → 5 → 10. а) фототрофами;
в) 2 → 4 → 7 → 5 → 10; б) свободноживущими гетеротрофами;
в) паразитами;
38. Многие растения-склерофиты обладают:
г) хемотрофами;
а) хорошо развитой аэренхимой;
б) жесткими мелкими листьями и жесткими побегами; 43. В докембрийский период произошли следующие ароморфозы:
в) способностью накапливать воду в тканях мясистых листьев; а) фотосинтез и многоклеточность;
г) тонкими, слабо развитыми корнями; б) цветы и семена;
д) слабо развитой ксилемой.
в) теплокровность;
39. Какие показатели необходимо знать экологу, чтобы определить г) внутренний костный скелет;
видовое богатство биоценоза? д) легочное дыхание.
а) Сухую массу организмов биоценоза и площадь, которую зани-
44. Явление гетерозиса, как правило, наблюдается при:
мает биоценоз;
б) количество особей каждого вида и площадь, которую занимает а) скрещивании разных пород животных и сортов растений;
биоценоз; б) инбридинге;
в) процентное отношение числа проб, взятых в биоценозе; в) создании генетически чистых линий;
г) биомассу продуцентов, консументов и редуцентов; г) полиэмбрионии;
д) видовой состав организмов, населяющих биоценоз. д) партеногенезе.
134 Районная олимпиада, г. Минск. 2007/2008 учебный год 11 класс 135

45. В результате альтернативного сплайсинга: 10. Бесполое поколение растений, жизненный цикл которых прохо-
а) происходят хромосомные перестройки; дит с  ритмическим чередованием половых и  бесполых поколе-
б) возникают индуцированные мутации; ний, —  .
в) после транскрипции одного и того же гена могут образовывать-
ся разные белки;
г) происходит сшивание двух иРНК, являющихся результатом Задачи по генетике
транскрипции двух разных генов.
1. При скрещивании рыжих тараканов (прусаков), имеющих узкое
Часть В тело коричневого цвета (дикий фенотип), с особями оранжевой
окраски, но с нормальной шириной тела, в первом поколении было
1. Один из типов взаимодействия генов, при котором аллели одного получено 5330 особей дикого фенотипа. Во втором поколении на-
гена подавляют проявление аллелей другого гена, —  блюдалось следующее расщепление: 3242 особи дикого фенотипа,
 . 1085 особей с нормальным коричневым телом, 1137 особей с узким
2. Гибкая хитиноидная пластинка, несущая ряды зубцов в  глотке оранжевым телом и 360 особей с нормальным оранжевым телом.
у брюхоногих моллюсков, —  . Как наследуются форма и окраска тела у тараканов? Какое коли-
чество тараканов будет иметь дикий фенотип, если провести ана-
3. Группа ферментов, катализирующих внутримолекулярные реак- лизирующее скрещивание особей первого поколения? (Вырази-
ции перестройки органических соединений, в т. ч. взаимопревра- те в %.)
щения изомеров, —  .
2. У  человека ген раннего облысения (s) рецесcивен и  сцеплен
4. Третий отдел многокамерного желудка жвачных животных, со­
с X-хромосомой, а аниридия (тип слепоты) определяется ауто­
единяющий сетку с сычугом, —  .
сомным доминантным геном N. Женщина c густыми волосами,
5. Опорная (механическая) ткань растений, клетки которой содер- страдающая аниридией, выходит замуж за лысого мужчину с нор-
жат протопласты со всеми органоидами, —  . мальным зрением. Отец женщины был лысым и имел нормаль-
ное зрение. Какова вероятность появления у них в семье детей,
6. Физиологически активные вещества, посредством которых в нерв-
не страдающих ни ранним облысением, ни аниридией? (Вырази-
ной системе осуществляются контактные межклеточные взаимо-
те в %.)
действия, —  .
7. Твердые образования (чаще состоящие из  минерального веще- 3. Дефект ногтей (ломкость) и дефект коленной чашечки опреде-
ства), расположенные в органах равновесия ряда беспозвоночных ляются доминантными аутосомными генами, которые находятся
и всех позвоночных, —  . на  расстоянии 10 морганид. Женщина, страдающая ломкостью
ногтей и дефектом коленной чашечки, вышла замуж за мужчину
8. Прочный соединительнотканный мешок, окружающий сердце по-
с нормальными ногтями и коленными чашечками. Какова вероят-
звоночных животных, — 
ность рождения в семье детей, не страдающих ломкостью ногтей
 . и имеющих нормально развитые коленные чашечки, если извест-
но, что отец женщины имел нормальные ногти и дефект коленной
9. Внехромосомные факторы наследственности, генетические эле-
чашечки, а мать — ломкость ногтей и нормально развитые колен-
менты, способные стабильно существовать в клетке в автономном,
ные чашечки? (Выразите в %.)
не связанном с хромосомами, состоянии, — 
11 класс 137

Районная олимпиада, г. Минск. 4. На рисунке изображены вирусы, повреждающие клетки живот-

ных, растений и бактерий. Укажите, какие из них являются фа­гами.
2008/2009 учебный год
11 класс

3 4
Часть А

1. Самка тутового шелкопряда выделяет особое вещество, называе-

мое бомбикол, которое привлекает самцов данного вида. К какой 1 2 5 6
группе веществ относится бомбикол?
а) 2, 3, 6; г) 2, 4, 6;
а) Инсектициды; г) феромоны; б) 1, 5; д) 2, 3, 5, 6.
б) репелленты; д) эстрогены. в) 1, 2, 5;
в) фунгициды;
5. Найдите неправильное утверждение о  генетическом материале
2. В пределах ареала кавказской агамы встречаются только самки, организмов:
самцы не обнаружены. Каким образом осуществляется размноже-
ние в популяции кавказской агамы? а) имеются вирусы, геном которых представлен РНК;
б) некоторые клеточные органеллы эукариот имеют свои соб-
а) Путем фрагментации тела отдельных самок; ственные геномы из РНК;
б) партеногенетически; в) генетический материал в клетках бактерий может существовать
в) самок оплодотворяют самцы других видов ящериц; вo внехромосомном состоянии;
г) часть самок в период размножения меняет пол и оплодотворяет г) генетический материал эукариот состоит из ДНК;
половозрелых самок в популяции; д) вхождение чужеродной ДНК в  клетку не  всегда летально
д) путем почкования самок-основательниц. для клетки, особенно для эукариотической.
3. Установите соответствие между ферментами и функциями, кото- 6. Укажите признаки, характеризующие антитела.
рые они выполняют в организме.
1 — относятся к нуклеиновым кислотам; 2 — молекула антитела
1 — трансферазы; 2 — лигазы; 3 — протеазы; 4 — липазы; 5 — ами- состоит из нуклеотидной последовательности; 3 — относятся к ли-
лазы. пидам; 4 — относятся к белкам; 5 — молекула антитела состоит
а — расщепление углеводов; б — расщепление белков; в — расще- из двух тяжелых цепей (H-цепи) и двух легких цепей (L-цепи);
пление жиров; г — соединяют две молекулы при гидролизе вы- 6  — в  функциональном отношении молекула антитела подраз-
сокоэнергетических связей; в — являются переносчиками функ- деляется на константные и вариабельные участки; 7 — молекула
циональных групп и молекулярных остатков от одной молекулы антитела включает участки, несущие железосодержащие просте-
к другой. тические группы, называемые гемом.
а) 1г, 2д, 3а, 4в, 5б; г) 1д, 2г, 3б, 4в, 5а; а) 1, 2; г) 4, 6, 7;
б) 1а, 2г, 3б, 4в, 5д; д) 1а, 2в, 3б, 4г, 5д. б) 2, 4, 6, 7; д) 3, 5, 7.
в) 1в, 2г, 3б, 4в, 5а; в) 4, 5, 6;
138 Районная олимпиада, г. Минск. 2008/2009 учебный год 11 класс 139

7. В одном из прудов рыбхоза «Птичь» методом случайного отбора 12. Аллель b, сцепленный с  полом (локализован в  X-хромосоме),
было выловлено 100 карпов. Все особи были помечены без по- рецессивен и  летален. Летальный ген вызывает гибель зиготы
вреждений и отпущены в пруд. На следующий день было вылов- или эмбриона. Мужчина вступил в брак с женщиной, гетерози-
лено 150 карпов, из которых 50 оказались мечеными. Принимая готной по этому гену. Какова вероятность (в %) рождения в данной
во внимание, что популяция карпа в пруду не изменилась, опре- семье детей — носителей летального гена?
делите численность популяции карпа в этом пруду: а) 50 %; г) ≈ 67 %;
а) 100;    б) 50;    в) 150;    г) 300;    д) 250. б) ≈ 33 %; д) 0.
в) 25 %;
8. Сколько сперматозоидов и яйцеклеток соответственно образуется
из 1280 сперматоцитов II порядка и 1280 ооцитов II порядка? 13. Часть хроматина, которая в интерфазе остается плотно спирали-
а) 2560 и 1280; г) 1280 и 1280; зованной и обычно расположена ближе к ядерной мембране, на-
б) 5120 и 2560; д) 640 и 340. зывается:
в) 1280 и 640; а) гетерохроматин;
б) эухроматин;
9. Развитие иксодовых клещей протекает: в) центромера;
а) с метаморфозом, личинка трохофора; г) ядрышковый организатор;
б) с метаморфозом, личинка пилидий; д) нуклеоплазма.
в) без метаморфоза, личиночных стадий нет;
г) с неполным метаморфозом, личинка наяда; 14. О филогенетическом родстве между моллюсками и аннелидами
д) с метаморфозом, личинка нимфа. свидетельствуют:
1 — наличие радулы у моллюсков и челюстей у полихет; 2 — спи-
10. В геноме бактерий некоторые гены организованы в оперон. Какое ральное дробление зиготы моллюсков и  аннелид; 3  — наличие
из утверждений об опероне верно? у двустворчатых моллюсков личинки — глохидии, а у аннелид —
а) Гены оперона являются мозаичными структурами, представлен- трохофоры; 4 — сходные местообитания моллюсков и аннелид;
ными интронами и экзонами, без наличия промотора; 5 — наличие у моллюсков перикардия, а у олигохет — тифлозоля.
б) транскрипция всех генов одного оперона начинается в одном а) 1, 2, 4; г) 2, 4;
и том же кодоне инициации; б) 2, 3, 5; д) 2, 3, 4.
в) все гены одного оперона не  экспрессируются одновременно, в) 1, 2;
так как содержат от 5 до 7 терминаторов;
г) всегда сразу за промотором следуют структурные гены, содер- 15. Какой дыхательный пигмент животных при соединении с кисло-
жащие информацию о первичной структуре белка; родом приобретает зеленую окраску?
д) трансляция иРНК всех генов одного и того же оперона терми- а) Йодопсин; г) гемэритрин;
нируется общим стоп-кодоном. б) гемоглобин; д) гемоцианин.
в) хлорокруорин;
11. Возвращение лосося в родную реку на нерест связано c:
а) инсайтом; 16. У малярийного комара процесс спорогонии малярийного плазмо-
б) химическим импринтингом (запечатлением); дия протекает в системе органов:
в) привыканием; а) выделительной; г) половой;
г) инструментальными условными рефлексами; б) пищеварительной; д) нервной.
д) положительным таксисом. в) дыхательной;
140 Районная олимпиада, г. Минск. 2008/2009 учебный год 11 класс 141

17. Выберите признаки, сближающие первозверей с пресмыкающи- 21. Укажите утверждения, верные относительно мышц, участвующих
мися. во вдохе и выдохе у человека.
1 — наличие млечных желез; 2 — плечевой пояс с хорошо выражен- 1 — во время вдоха наружные межреберные мышцы сокращаются,
ными коракоидами; 3 — наличие клоаки; 4 — отсутствие волосяно- а диафрагма опускается вниз; 2 — внутренние и наружные межре-
го покрова; 5 — откладывают яйца; 6 — эндотермность. берные мышцы сокращаются только во время вдоха, а диафраг-
ма — только во время выдоха; 3 — во время вдоха сокращаются
а) 2, 4, 5; г) 1, 2, 3, 6;
только внутренние межреберные мышцы, а диафрагма опускается
б) 3, 4, 5, 6; д) 1, 4, 6.
вниз; 4 — во время выдоха расслабляются внутренние межребер-
в) 2, 3, 5;
ные мышцы, а диафрагма опускается вниз; 5 — во время спокой-
18. Студент во время лабораторных занятий обнаружил постоянный ного выдоха наружные межреберные мышцы и диафрагма рассла-
микропрепарат, на котором отсутствовала этикетка. На микропре- бляются; 6 — при вдохе сокращаются только наружные межребер-
парате был неизвестный организм. Студент его описал: отдель- ные мышцы, а диафрагма расслаблена.
ные клетки с  одним ядром и  клеточной стенкой, в  цитоплазме а) 1, 3, 4; г) 3, 5, 6;
значительное количество кристаллов мочевины, форма клеток б) 1, 5; д) 2, 4.
овальная, размеры клеток 2–10 мкм. Какой организм на  пре- в) 4, 6;
22. В состав межклеточного вещества костной ткани человека входит
а) Амеба; г) мукор;
б) стрептококк; д) носток.
в) дрожжи; а) кератин;
б) оссеин;
19. Расположите структуры анатомического строения трехлетнего в) фибрин;
стебля липы, начиная с центрального. г) актин;
1 — перидерма; 2 — паренхима первичной коры; 3 — вторичная д) миозин.
флоэма; 4 — остатки первичной флоэмы; 5 — камбий; 6 — древе-
23. Какие из перечисленных лейкоцитов относятся к группе аграну-
сина; 7 — сердцевина.
а) 7 → 6 → 4 → 5 → 3 → 2 → 1; а) Нейтрофилы;
б) 7 → 3 → 5 → 4 → 6 → 2 → 1; б) базофилы;
в) 5 → 7 → 6 → 5 → 3 → 1 → 2; в) моноциты;
г) 6 → 7 → 5 → 4 → 1 → 3 → 2; г) эозинофилы;
д) 7 → 6 → 5 → 3 → 4 → 2 → 1. д) нет правильного ответа.
20. Укажите неверное соответствие клетки — ткань: 24. Растением — индикатором высокой влажности почвы является:
а) корневой волосок — покровная ткань; а) верблюжья колючка;
б) палисадная паренхима — основная ткань; б) очиток едкий;
в) замыкающая клетка — покровная ткань; в) полынь горькая;
г) клетки-спутницы — меристематическая ткань; г) сусак зонтичный;
д) трахеида — проводящая ткань. д) ковыль перистый.
142 Районная олимпиада, г. Минск. 2008/2009 учебный год 11 класс 143

25. От кишечника в основном не кровью, а лимфой транспортируются г) обработку семян раствором формалина;
(-ется): д) скарификацию семян.
а) моносахариды; г) глюкоза; 30. Примером межвидовой конкуренции являются взаимоотношения
б) аминокислоты; д) триглицериды. между:
в) нуклеотиды;
а) серыми и черными крысами;
26. Укажите признаки, характеризующие антоцианы. б) божьей коровкой и тлей;
1 — имеют красную, синюю, пурпурную окраску; 2 — содержатся в) актинией и рыбой-клоуном (амфиприоном);
в мембранах тилакоидов; 3 — определяют окраску венчика цвет- г) белым медведем и песцом;
ков; 4 — присутствуют в вакуолярном соке; 5 — относятся к груп- д) самцами благородного оленя в период полового размножения.
пе фотосинтетических пигментов; 6  — имеют только зеленую 31. К растениям «короткого дня» можно отнести:
окраску. а) клевер ползучий;
а) 1, 2, 5; г) 1, 3, 4; б) тысячелистник обыкновенный;
б) 2, 3, 6; д) 1, 5. в) василек шероховатый;
в) 4, 5, 6; г) розу плетистую;
д) хризантему увенчанную.
27. В случае разрыва блуждающего нерва дыхание у человека:
32. Ген у прокариот — это участок:
а) останавливается;
б) не изменяется; а) ДНК; г) иРНК;
в) становится поверхностным и частым; б) рРНК; д) мезосомы.
г) становится редким и глубоким; в) тРНК;
д) глубокое дыхание чередуется и поверхностным с интервалом 33. Определите, какую стадию мейоза характеризует следующее
10 с. описание: «Гомологичные хромосомы, составляющие бивалент,
соединены между собой в нескольких точках (хиазмах), в кото-
28. Выберите утверждение, верное в отношении цикла Кальвина:
рых может происходить обмен участками хромосом, что приводит
а) протекает только ночью; к возникновению новых генных комбинаций».
б) конечным продуктом является фосфоглицероальдегид;
в) не требует энергетических затрат АТФ; а) Профаза II; г) метафаза II;
г) приводит к образованию CO2; б) метафаза I; д) анафаза I.
д) включает этап фотолиза воды. в) профаза I;
34. У представителей типа Хордовые из эктодермы формируются:
29. Представьте, что вам предстоит задержать прорастание семян ку-
курузы непосредственно перед посадкой, но уже после замачива- 1 — симпатические и парасимпатические ганглии; 2 — гладкая му-
ния семян в растворе фунгицида, так как стало известно о надви- скулатура; 3 — почечные канальцы; 4 — зубная эмаль; 5 — межпоз-
гающемся резком похолодании. Для решения проблемы вы будете воночные диски; 6 — сетчатка глаза; 7 — поджелудочная железа;
использовать: 8 — хорда.
а) закаливание семян в холодильной установке; а) 1, 2, 3, 6; г) 3, 6, 7;
б) закаливание семян попеременным нагреванием и охлаждением; б) 1, 4, 6; д) 1, 3, 7.
в) обработку семян раствором абсцизовой кислоты; в) 2, 5, 8;
144 Районная олимпиада, г. Минск. 2008/2009 учебный год 11 класс 145

35. На графике отображена зависимость между весом тела новорож- 38. Какие из организмов являются урикотелическими?
денных (ось X) и их выживанием (ось Y). 1 — крот европейский; 2 — лягушка травяная; 3 — уж обыкновен-
Y, % ный; 4 — майский жук; 5 — короед сосновый; 6 — карась золотой;
100 7 — страус африканский; 8 — рысь европейская.
а) 1, 2, 8; г) 1, 3, 4, 6;
б) 3, 4, 5, 7; д) 1, 7, 8.
в) 6;

39. Выберите признаки, характеризующие желчь человека.

50 1 — состоит более чем на 90 % из воды; 2 — относится к фермен-
там группы липаз; 3 — активирует работу ферментов; 4 — влия-
1,4 1,8 2,3 2,7 3,2 3,6 4,1 4,5 5,0 5,4 X,кг ет на процесс всасывания жиров; 5 — создает кислую реакцию;
6 — замедляет перистальтические движения кишечника; 7 — со-
График может служить примером отбора:
держит соли желчных кислот (гликохолат натрия и таурохолат
а) движущего; г) искусственного; натрия).
б) дизруптивного; д) полового. а) 2, 3, 7; г) 1, 3, 4, 7;
в) стабилизирующего; б) 3, 4, 5, 6; д) 1, 6, 7.
в) 7;
36. Какой будет последовательность иРНК, если известно, что в транс-
крибируемой ДНК произошла мутация (одновременно делеция 40. Сера содержится в:
4-го, 5-го нуклеотидов и дупликация 8-го нуклеотида)? До му- а) белках; г) жирах;
тации транскрибируемый участок ДНК имел следующий вид: б) углеводах; д) нуклеиновых кислотах.
3'-AATГГЦATГГГГЦЦАЦ-5'. в) алканах;
а) 5'-УУАЦУААГЦЦЦГЦУА-3'; 41. Примером анализирующего скрещивания является:
а) АА × АА;
б) Аа × Аа;
в) АА × Аа;
г) Аа × аа;
37. В результате скрещивания двух видов Spartina (S. maritime (2n = 60) д) нельзя отобразить графически.
и S. arterniflora (2n = 62)) получен плодовитый гибрид Spartina 42. Одной из функций организма, реализуемой с участием блуждаю-
anglica (2n = 122). Это является примером: щего нерва (X-черепно-мозговой нерв), является:
а) аллополиплоидии; а) слюноотделение;
б) автополиплоидии; б) глотание;
в) анеуплоидии; в) движение головы;
г) хромосомной мутации; г) движение глаз;
д) генной мутации. д) восприятие сладкого, кислого и соленого.
146 Районная олимпиада, г. Минск. 2008/2009 учебный год 11 класс 147

43. Определите концентрацию растворов, в которые помещены эри- 4. Расхождение признаков организмов в ходе эволюции разных фи-
троциты. летических линий, возникших от общего предка, — 
H2O H2O H2O H2O 5. Сложные белки (гликопротеиды), которые специфически связы-
ваются с чужеродными веществами — антигенами, — 
6. Участок гена эукариот, который, как правило, не несет генетиче-
ской информации о первичной структуре белка, кодируемого дан-
№ 1 № 2 №3 ным геном, —  .
а) 1 — гипотонический; 2 — изотонический; 3 — гипертонический; 7. Фибриллярный белок, составляющий основу волокон соедини-
б) 1— гипертонический; 2 — изотонический; 3 — гипотонический; тельной ткани в таких органах, как кость, сухожилие и т. д., и обе-
в) 1 — изотонический; 2 — гипертонический; 3 — гипотонический; спечивающий ее прочность, —  .
г) 1 — изотонический; 2 — гипотонический; 3 — гипертонический;
8. Метамерно расположенные парные выделительные органы дожде-
д) 1 — гипертонический; 2 — гипотонический; 3 — изотонический.
вых червей — 
44. Какие из перечисленных пар гормонов явятся противоположными 9. Древние ископаемые люди, относящиеся к палеоантропам, — 
по действию (повышают — снижают и т. п.) в отношении концен-
трации одного и того же вещества в плазме крови?  .
а) Окситоцин — пролактин; г) глюкагон — инсулин; 10. Специфические белки, присутствующие во всех живых клетках
б) паратгормон — адреналин; д) соматотропин — адреналин. и играющие роль биологических катализаторов, — 
в) ренин — прогестерон;  .

45. Для синтеза белка не требуется обязательное наличие:

Задачи по генетике
а) аминокислот; г) иРНК;
б) эндоплазматической сети; д) рибосом. 1. При скрещивании растений пшеницы, имеющих остистый плот-
в) тРНК; ный колос, с растением, имеющим безостый рыхлый колос, в пер-
вом поколении все растения имели безостые колосья средней
Часть В плотности. При самоопылении растений первого поколения были
получены семена, из которых вырастили: 58 растений безостых
1. Внутриклеточная структура эукариот, лежащая в основании рес- с плотным колосом, 121 растение без­остое с колосом средней плот-
ничек и жгутиков и служащая для них опорой, —  ности, 59 растений безостых с рыхлым колосом, 22 растения ости-
 . стых с плотным колосом, 39 растений остистых с колосом средней
плотности и 21 растение остистое с рыхлым колосом.
2. Процесс обособления двух первичных зародышевых листков (на-
Как наследуются изучаемые признаки? Какие типы взаимодей-
ружного — эктодермы и внутреннего — энтодермы) у зародышей
ствия генов можно наблюдать в данном случае? Сколько растений
всех многоклеточных животных —  .
пшеницы будут иметь остистый колос средней плотности, если
3. Превосходство гибридов по ряду признаков и свойств над роди- провести анализирующее скрещивание особей первого поколе-
тельскими формами, «гибридная сила» —  . ния? (Выразите в %.)
148 Районная олимпиада, г. Минск. 2008/2009 учебный год

2. Известно, что  цвет меха норок определяется двумя генами. Районная олимпиада, г. Минск.
При скрещивании двух платиновых норок в F1 все потомство име-
ло коричневый мех. При скрещивании коричневых норок из F1 2009/2010 учебный год
между собой было получено 36 коричневых и 28 платиновых но-
рок. Какой тип взаимодействия генов наблюдается в данном слу- 11 класс
чае? Сколько потомков будут иметь коричневую окраску меха,
если скрестить самца из родительского поколения с самкой из F1?
(Выразите в %.) Часть А
3. При  скрещивании дигомозиготного черного самца дрозофилы
1. В аквариуме обнаружили рыбку, которая медленно плавала и пло-
с зачаточными крыльями с дигомозиготной светлой самкой с нор-
хо потребляла корм. Когда эту рыбку поместили в отдельный со-
мально развитыми крыльями получено потомство, все особи ко-
суд, обнаружили на поверхности ее тела белый налет в виде пушка.
торого имели светлую окраску и  нормально развитые крылья.
Изучив налет под микроскопом, выяснили, что это мицелий гри-
Дальнейшее скрещивание самки из F1 с самцом из родительско-
бов. Какие грибы поразили рыбку?
го поколения дало следующее расщепление: 322 особи с черным
телом и  зачаточными крыльями, 308 особей со  светлым телом а) Мучнисторосяные; г) фитофторовые;
и  нормально развитыми крыльями, 62 особи со  светлым телом б) ржавчинные; д) головневые.
и зачаточными крыльями и 58 особей с черным телом и нормаль- в) сапролегниевые;
но развитыми крыльями. 2. Какой из видов бактерий вызывает опасное заболевание — столб-
Какой вывод можно сделать о наследовании признаков цвета тела няк?
и формы крыльев у дрозофил? На каком расстоянии (в моргани- а) Клостридиум тетани;
дах) расположены гены в хромосоме? б) палочка Коха;
в) бациллюс субтилис;
г) кишечная палочка;
д) золотистый стафилококк.

3. Определите группу организмов по описанию: «Многоклеточные,

в клетках содержится хлорофилл а, c и b, фукоксантин, пирено­иды
мелкие, запасное вещество маннит, в клеточной стенке альгиновая
а) Бурые водоросли; г) пирофитовые водоросли;
б) красные водоросли; д) гимнокарповые лишайники.
в) харовые водоросли;

4. Суберин откладывается в  оболочках клеток внутреннего слоя

коры корня, называемого:
а) перидерма; г) ритидом;
б) эндодерма; д) осевой цилиндр.
в) ризодерма;
150 Районная олимпиада, г. Минск. 2009/2010 учебный год 11 класс 151

5. Укажите структуры, расположенные на спорофите мха сфагнума.

1 — листья; 2 — архегонии; 3 — антеридии; 4 — коробочка; 5 — спо- Основной хозяин
ры; 6 — ризоиды.
а) 1, 2, 3, 6; в) 1, 4, 6; д) 4, 5.
б) 1, 4, 5; г) 2, 3; Взрослая
6. Какие из перечисленных членистоногих относятся к группе кро-
вососущих насекомых?
а) Оводы; г) клещи;
б) мокрецы; д) щитовки.
в) цикадки;
7. Найдите соответствие между типами птенцов (I, II) и видами птиц,
для которых характерен такой тип.

Промежуточные хозяева
а) Бычий цепень; г) ланцетовидный сосальщик;
б) свиной солитер; д) эхинококк.
в) широкий лентец;

10. Фермент желудочного сока человека, створаживающий молоко,

1 — глухарь; 2 — соловей обыкновенный; 3 — кряква; 4 — грач; а) амилаза; г) пепсин;
5 — куропатка серая; 6 — синица большая; 7 — черный дятел; 8 — б) липаза; д) соляная кислота.
рябчик. в) химазин;
а) I — 1, 4, 5, 7; II — 2, 3, 6, 8; 11. На рисунке представлены положения голосовых связок при вдохе
б) I — 2, 4, 6, 7; II — 1, 3, 5, 8; и выдохе, пении низких нот, пении высоких нот (фальцет), шепоте.
в) I — 2, 6, 8; II — 1, 3, 4, 5, 7; Укажите, какое положение голосовых связок наблюдается при пе-
г) I — 1, 2, 7; II — 3, 4, 5, 6, 8; нии низких нот.
д) I — 1, 3, 5, 7, 8; II — 2, 4, 6.
8. В костной ткани имеются клетки, содержащие много лизосом. Это:
а) хондробласты; г) остеобласты;
б) остеокласты; д) фибробласты.
в) остеоциты; 1 2 3 4
9. На рисунке (с. 151) изображен цикл развития одного из паразити- а) 1; в) 3; д) 3, 4.
ческих червей. Укажите какого. б) 2; г) 4;
152 Районная олимпиада, г. Минск. 2009/2010 учебный год 11 класс 153

12. В тимусе происходят(-ит): 15. Найдите соответствие между компонентами плазмы крови и их
а) созревание и дифференциация Т-лимфоцитов; функциями.
б) образование гормона адреналина; 1 — α-глобулин; 2 — фибриноген; 3 — минеральные ионы (Na+,
в) взаимодействие В- и Т-лимфоцитов с антигенами; Ca2+, Mg2+, Cl– и др.); 4 — вода; 5 — сывороточный альбумин.
г) образование плазмоцитов; а — поддержание определенного объема крови; б — связывание
д) образование макрофагов. тироксина и билирубина; в — связывание ионов кальция плазмы;
г — поддержание изотоничности и стабильности рН; д — превра-
13. Укажите признаки, характерные для дикранума метловидного.
щение в белок, являющийся основой сгустка при свертывании,
1 — имеются антеридии; 2 — имеются сперматозоиды; 3 — в жиз- участвует в свертывании крови.
ненном цикле доминирует спорофит; 4  — имеются архегонии;
5 — образуется первичный эндосперм; 6 — имеются только при- а) 1а, 2д, 3б, 4г, 5в; г) 1б, 2д, 3г, 4а, 5в;
даточные корни. б) 1г, 2д, 3а, 4б, 5в; д) 1а, 2б, 3г, 4д, 5в.
а) 1, 2, 4; г) 1, 4, 6; в) 1д, 2б, 3г, 4а, 5в;
б) 2, 3, 5; д) 1, 2, 4, 6.
в) 1, 3, 4; 16. Какие клеточные органеллы изображены на рисунках?

14. На рисунке изображены механизмы осморегуляции у рыб, оби-

тающих в соленой и пресной воде. Какая рыба обитает в пресных
водоемах, а какая — в морских?
Соли Вода

1 2 3
1. Соли а) 1 — митохондрия; 2 — хлоропласт; 3 — лизосома;
б) 1 — комплекс Гольджи; 2 — лизосома; 3 — ядро;
Обильная гипотоническая моча в) 1 — эндоплазматический ретикулум; 2 — митохондрия; 3 — хло-
Соли Вода
г) 1 — комплекс Гольджи; 2 — хлоропласт; 3 — митохондрия;
2 Соли д) 1 — диктиосома; 2 — ядро; 3 — митохондрия.
17. Для растений, использующих САМ-фотосинтез, характерно:
Слегка гипотоническая
а) отсутствует цикл Кальвина;
и малообильная моча
б) темновая стадия фотосинтеза протекает только в ночное время
а) 1 — морская; 2 — пресноводная; суток;
б) 1 — пресноводная; 2 — морская; в) фотосинтез проходит даже при закрытых устьицах;
в) 1 — морская и пресноводная; 2 — пресноводная; г) световая фаза фотосинтеза протекает в строме хлоропластов;
г) 1 — пресноводная; 2 — пресноводная и морская. д) фотосистемы воспринимают только ультрафиолетовый свет.
154 Районная олимпиада, г. Минск. 2009/2010 учебный год 11 класс 155

18. Выберите утверждение, верное для кислородного этапа дыхания: 23. Укажите, в каком неравенстве правильно отражено содержание
а) О2 является акцептором электронов; иРНК, тРНК и рРНК в клетке:
б) конечным продуктом является малат; а) рРНК > иРНК > тРНК;
в) происходит восстановление НАДФ+; б) иРНК > рРНК > тРНК;
г) СО2 является окислителем; в) рРНК > тРНК > иРНК;
д) конечным продуктом является ацетил-КоА. г) тРНК > рРНК > иРНК;
д) тРНК > иРНК > рРНК.
19. Составной частью каких молекул (из числа приведенных) явля-
ется аденин? 24. Какие клетки вырабатывают иммуноглобулины?
а) Всех стероидных гормонов; а) Эозинофилы;
б) рибулозодифосфата и коэнзима А; б) плазмоциты;
в) НАДФ, НАД и коэнзима А; в) макрофаги;
г) дезоксирибозы и НАД; г) все клетки иммунной системы;
д) тироксина и трийодтиранина. д) Т-лимфоциты.

20. Какую функцию в клетке выполняют микротрубочки? 25. Естественный приобретенный пассивный иммунитет человека
а) Являются элементом комплекса Гольджи; формируется в результате:
б) участвуют в образовании веретена деления; а) инъекции живых антигенов;
в) входят в состав ядерной оболочки; б) инъекции мертвых антигенов;
г) входят в состав хромосом; в) введения сыворотки;
д) участвуют в процессе транскрипции. г) проникновения антител матери через плаценту.

21. Определите длину участка спирали ДНК, если известно, что поли- 26. ДНК содержится в:
пептид, синтезированный на иРНК, которая была транскрибиро- 1 — ядре; 2 — эндоплазматической сети; 3 — митохондриях; 4 —
вана на данном участке спирали ДНК, состоит из 1000 аминокис- лизосомах; 5 — пластидах; 6 — комплексе Гольджи.
лот. Один виток спирали ДНК состоит из 10 нуклеотидов и имеет
а) 1, 3, 5; г) 1, 2, 3, 4, 6;
длину 3,4 нм.
б) 1, 2, 5; д) 1.
а) 340 нм; г) 1020 нм; в) 2, 3, 4, 6;
б) 680 нм; д) 2400 нм.
в) 940 нм; 27. Укажите последовательность иРНК, синтезированной на матрице
ДНК, имеющей следующий вид:
22. Какое число моль АТФ может быть получено из АДФ и фосфор-
ной кислоты, если известно, что при окислении органических ве-
ществ выделилось 480 кДж энергии? а) УЦААЦЦУААГГЦУГУ;
а) 6 моль; г) 16 моль; б) УЦЦГАУУААГГЦУГУ;
б) 10 моль; д) 24 моль. в) УГЦГАУАУАГГЦУГУ;
в) 12 моль; г) УЦЦГАУУААГГЦААА;
156 Районная олимпиада, г. Минск. 2009/2010 учебный год 11 класс 157

28. Укажите, на каком рисунке правильно показано направление дви- 33. К полисахаридам относится:
жения воды в теле губок (Spongia). а) гликоген; г) креатинин;
б) гемоглобин; д) глюкоза.
в) альбумин;

34. Электрическая стимуляция нервов симпатической нервной систе-

мы может привести к:
1 — расширению зрачков; 2 — сужению зрачков; 3 — повышенному
потоотделению; 4 — пониженному потоотделению; 5 — учащению
а б в г
дыхания и пульса; 6 — частота пульса и дыхание не изменятся.
29. Какой химический процесс лежит в  основе получения кумыса, а) 2, 4, 6; г) 2, 3, 5;
айрана, йогурта? б) 1, 3, 5; д) 1, 6.
а) 6CO2 + 6H2O → C6H12O6 + 6O2 ↑; в) 1, 4, 6;
б) C6H12O6 + 2АДФ + 2H3PO4 → 2C3H6O3 + 2АТФ;
35. На какой стадии мейоза образуются тетрады?
в) C6H12O6 + 2АДФ + 2H3PO4 → 2C2H5OH + 2АТФ + 2CO2;
г) C6H12O6 + 2АДФ + 2H3PO4 + О2 → 2СН3СООН + 2АТФ + а) Интерфазы; г) метафазы I;
+ 2CO2. б) профазы I; д) телофазы I.
в) профазы II;
30. Плод стручок отличается от плода боба тем, что:
36. Согласно синтетической теории эволюции (СТЭ) элементарной
а) стручок сухой, а боб сочный;
единицей эволюционного процесса является:
б) боб раскрывается, а стручок нет;
в) стручок со срединной пластинкой, а боб нет; а) особь;
г) стручок только у редьки дикой, а боб у всех остальных кресто­ б) популяция;
цветных. в) вид;
г) сообщество организмов разных видов.
31. Укажите последовательность расположения слуховых косточек
от барабанной перепонки вовнутрь: 37. В эксперименте скрещивали две линии плодовых мушек Droso­
phila. Одна линия  — гетерозиготы, имеющие серый цвет тела
а) молоточек → наковальня → стремечко;
и нормально развитые крылья (доминантный фенотип), вторая —
б) стремечко → наковальня → молоточек;
черный цвет тела и зачаточные крылья (рецессивный фенотип).
в) стремечко → молоточек → наковальня;
Было получено потомство:
г) наковальня → молоточек → стремечко;
д) молоточек → стремечко → наковальня. доминантный фенотип: 985
рецессивный фенотип: 965
32. К отряду Грызуны относятся: серые с зачаточными крыльями: 234
1 — бурозубка; 2 — крот; 3 — белка; 4 — ондатра; 5 — выдра; 6 — черные с нормальными крыльями: 216
выхухоль. Определите частоту кроссинговера.
а) 1, 3, 6; г) 1, 3, 5; а) 0,2051; г) 0,1064;
б) 3, 5, 6; д) 3, 4. б) 0,90; д) 0,0170.
в) 2, 4, 6; в) 0,1875;
158 Районная олимпиада, г. Минск. 2009/2010 учебный год 11 класс 159

38. Мужчина, страдающий наследственным заболеванием, женил- 44. Какой из  перечисленных структурных элементов экосистемы
ся на  здоровой женщине. У  них родились 8 детей (4 мальчика не является частью биоценоза?
и 4 девочки). Все девочки имели симптомы болезни отца, тогда а) Зооценоз; г) фитоценоз;
как мальчики были здоровыми. Данное заболевание является: б) микоценоз; д) микробоценоз.
а) аутосомно-рецессивным; в) климатоп;
б) аутосомно-доминантным;
в) сцепленным с Y-хромосомой; 45. Благодаря деятельности нитрифицирующих бактерий:
г) сцепленным с Х-хромосомой доминантным; а) аммонийный азот преобразуется в нитратный;
д) сцепленным с Х-хромосомой рецессивным. б) молекулярный азот преобразуется в аммонийный;
39. Рестриктазы узнают в ДНК симметричную последовательность в) нитратный азот восстанавливается до молекулярного;
(палиндром). Сколько разных рестриктаз, узнающих последова- г) молекулярный азот преобразуется в амины.
тельность из шести нуклеотидов, может существовать?
а) 32; г) 256; Часть B
б) 64; д) 512.
в) 128; 1. Совокупность химических реакций, протекающих в живом орга-
низме, обеспечивающих его рост, жизнедеятельность, воспроизве-
40. Форма биотических взаимоотношений, называемая форезией, яв- дение и т. п., —
ляется разновидностью:  .
а) мутуализма; г) паразитизма;
б) комменсализма; д) конкуренции. 2. Подтип хордовых животных, представители которого характери-
в) протокооперации; зуются незамкнутой кровеносной системой, малоподвижным об-
разом жизни, гермафродитизмом, — 
41. Какой из перечисленных организмов относится к гидробионтам?  .
а) Навозник лесной; г) улитка виноградная; 3. Связанные с ДНК хромосомные белки, содержащиеся в ядрах кле-
б) клоп ягодный; д) пяденица зимняя. ток растений и животных, — 
в) перловица обыкновенная;
42. Синтез АТФ не происходит при: 4. Одна из форм полового размножения организма, при которой ор-
а) молочнокислом брожении; г) цикле Кальвина; ганизм развивается из неоплодотворенной женской половой клет-
б) спиртовом брожении; д) световой фазе фотосинтеза. ки, — 
в) цикле Кребса;  .
43. В популяции растений розовый цвет венчика определяется рецес- 5. Моносахарид с пятью атомами углерода в молекуле — 
сивными генами, а красный — доминантными. Определите частоту  .
гетерозиготных генотипов (в %), если известно, что 9 % популяции
составляют растения, имеющие розовые цветки: 6. Пиримидиновое основание, входящее в состав РНК и отсутству-
ющее в ДНК, —  .
а) 12 %; г) 42 %;
б) 25 %; д) 50 %. 7. Белок, образующийся из фибриногена плазмы крови под воздей-
в) 32 %; ствием фермента тромбина, —  .
160 Районная олимпиада, г. Минск. 2009/2010 учебный год

8. Восстановление организмом утраченных или поврежденных ор-

ганов и тканей —  .
9. Кожные трубчатые железы млекопитающих, обеспечивающие тер-
морегуляторную, выделительную и другие функции, — 
10. Синтез полипептидных цепей белков на матрице иРНК — 

Задачи по генетике
1. При скрещивании между собой растения красноплодной земляни-
ки всегда дают потомство с красными ягодами, а растения бело-
плодной земляники — с белыми. От скрещивания обоих сортов
получают гибриды F1 с розовыми ягодами. Признаки наследуются
независимо. Какова вероятность появления в потомстве растений,
имеющих красные плоды, если провели анализирующее скрещи-
вание гибридов F1? (Выразите в %.)

2. Черная и  короткая шерсть  — доминантные признаки морской

свинки. Гены, определяющие данные при­знаки, наследуются не-
зависимо. Черного коротко­шерстного гетерозиготного самца скре-
щивают с го­мозиготной белой длинношерстной самкой. Какова
вероятность появления в потомстве белых короткошерстных осо-
бей? (Выразите в %.)

3. У человека наличие в эритроцитах антигена резус-фактора опре-

деляется доминантным геном Rh. Его аллель rh обусловливает от-
сутствие этого антигена. Муж имеет вторую группу крови и резус-
положительный фактор (известно, что его отец имел резус-отрица-
тельный фактор); жена имеет третью группу крови и резус-поло-
жительный фактор (известно, что у нее в роду нет родственников
с резус-отрицательным фактором). Какова вероятность рождения
в семье ребенка, имеющего резус-положительный фактор и чет-
вертую группу крови? (Выразите в %.)
11 класс 163

Областная олимпиада. 5. Промысловыми видами моллюсков являются:

1 — устрицы; 2 — мидии; 3 — омары; 4 — крабы; 5 — кальмары;
2005/2006 учебный год 6 — голотурии.

11 класс а) 2, 3, 4; г) 4, 5, 6;
б) 1, 2, 5; д) 3, 4;
в) 2, 3, 6; е) 1, 2, 3, 4, 5, 6.
Часть А  6. Гормон, который контролирует процесс линьки у насекомых:
1. Каково отношение длины кишечника к длине тела у хищных жи­ а) экдизон; г) бомбикол;
вотных (I), травоядных животных (II) и животных, питающих- б) ювенильный гормон; д) альдостерон.
ся экскре­ментами (III) (животные имеют одинаковую длину в) окситоцин;
7. В  кишечнике некоторых насекомых, питающихся древесиной
а) I — 2/1, II — 10/1, III — 20/1; (термиты, тараканы), обитают одноклеточные жгутиконосцы.
б) I — 10/1, II — 20/1, III — 2/1; Экспериментально доказано: если жгутиконосцы погибают, через
в) I — 20/1, II — 10/1, III — 2/1; некоторое время погибают и насекомые. Какой из перечисленных
г) I — 10/1, II — 2/1, III — 20/1. процессов обеспечивают простейшие?
2. Какую функцию выполняет пузырек воздуха, накапливающийся а) Снабжают насекомых незаменимыми аминокислотами;
под надкрыльями у жуков-плавунцов и жуков-водолюбов, когда б) участвуют в доставке кислорода к тканям и органам;
они всплывают к поверхности воды? в) обеспечивают расщепление клетчатки;
г) синтезируют полиненасыщенные карбоновые кислоты;
а) Физической жабры; д) участвуют в процессе выделения мочевой кислоты.
б) позволяет парить в толще воды;
в) обеспечивает развивающиеся под надкрыльями яйца кислоро- 8. Укажите, представителям какого класса животных соответству-
дом; ет следую­щая характеристика: «Гомойотермные амниоты, хоро-
г) обеспечивает удаление мочевой кислоты; шо развиты потовые и  сальные железы, гетеродонтная зубная
д) служит приманкой для жертв. система».
а) Amphibia; г) Mammalia;
3. Какой дыхательный пигмент животных при соединении с кисло­ б) Insecta; д) Aves.
родом приобретает зеленую окраску? в) Reptilia;
а) Йодопсин; г) гемэритрин; 9. Какой орган позволяет рыбам ориентироваться в токах воды, дер-
б) гемоглобин; д) гемоцианин. жаться в стае, избегать столкновения с подводными предметами?
в) хлорокруорин;
а) Орган зрения; г) орган обоняния;
4. Все двустворчатые моллюски являются фильтраторами. Какое б) вестибулярный аппарат; д) орган слуха.
эволюционное изменение способствовало этому? в) боковая линия;
а) Редукция головного отдела; 10. Разви­тие малярийного плазмодия протекает в системе органов
б) срастание желудочков сердца; малярийного комара:
в) появление в цикле развития личинки-глохидии; а) выделительной; г) половой;
г) редукция раковины; б) пищеварительной; д) нервной.
д) развитие радулы. в) дыхательной;
164 Областная олимпиада. 2005/2006 учебный год 11 класс 165

11. Метанефридии кольчатых червей и моллюсков функционально б) cкелетная мышца имеет определенную длину в покое, гладкая —
сходны с почками позвоночных. При образовании мочи происхо- нет;
дит фильтрация, реабсорбция и секреция. У двустворчатых мол- в) после растяжения гладкая мышца сократится сильнее, чем ске-
люсков фильтрация происходит на: летная;
г) при одинаковой степени сокращения скелетная мышца исполь-
а) участке нефростома метанефридия;
зует в 10 раз меньше энергии, чем гладкая;
б) стенках сердца и перикардиальных желез;
д) скелетная мышца не может функционировать без участия нер­
в) трубочках, связанных с нефростомом; вов, а гладкая — может.
г) стенке кишечника;
д) капиллярах жабр. 16. Укажите верные утверждения.
1 — сила импульса зависит от величины возбуждения; 2 — с уве-
12. Что из перечисленного не характерно для типа Mollusca?
личением силы возбуждения растет число возбужденных волокон;
а) Мантия; г) спиральное дробление; 3 — с увеличением силы возбуждения растет скорость передачи
б) радула; д) мюллеровская личинка. импульса; 4 — скорость передачи импульса зависит от наличия
в) личинка трохофора; миелиновой оболочки у нервов; 5 — скорость передачи импульса
прямо пропорциональна диаметру аксона.
13. При изменении каких перечисленных условий будет обеспечена
наиболее эффективная диссоциация оксигемоглобина? а) 1, 4, 5; в) 2, 4, 5; д) 4, 5.
б) 1, 2, 3; г) 2, 3, 5;
1 — парциальное давление кислорода; 2 — рН среды; 3 — концен-
трация 2,3-дифосфоглицерата; 4  — парциальное давление СО2; 17. Какая комбинация клеток обеспечивает эффективный иммун­ный
5 — температура тела. ответ?
а) При увеличении 1 и 4, уменьшении 3; а) Т-лимфоциты — В-лимфоциты — макрофаги;
б) при увеличении 2 и 3, уменьшении 5; б) Т-лимфоциты — макрофаги — эритроциты;
в) при уменьшении 1, увеличении 3 и 4; в) В-лимфоциты — клетки Купфера — липоциты;
г) при увеличении 1 и 5, уменьшении 4; г) дендритные клетки — нейтрофилы — фибробласты;
д) при уменьшении 2, 3 и 5. д) дендритные клетки — макрофаги — микроглия.
18. Какое гормональное состояние справед­ливо для женщины на позд-
14. Что произойдет, если скелетную мышцу поместить в бескальци-
них сроках беременности?
евую среду (сохраняющую ее жизнеспособность) и подвергнуть
од­нократной электростимуляции? а) Эстроген повышен, прогестерон повышен;
б) эстроген снижен, прогестерон снижен;
а) Мышца не стимулируется; в) эстроген повышен, прогестерон снижен;
б) мышца стимулируется, но не сократится; г) эстроген снижен, прогестерон повышен;
в) мышца стимулируется и сократится; д) лютеинизирующий гормон повышен, гонадотропин хориона че­
г) мышца может стимулироваться, сокращаться, но не расслаб­ ло­века повышен.
19. Риск возникнове­ния гемолитической болезни при беременности
15. Укажите принципиальные физиологические отличия между ске­ существует в том случае, если:
летными и гладкими мышцами у позвоночных животных: а) кровь матери Rh+, кровь плода Rh—;
а) скелетная мышца более чувствительна к электрическому раз­ б) кровь матери Rh+, кровь плода Rh+;
дражи­телю, в то время как гладкая — к химическому раздражи- в) кровь матери Rh—, кровь плода Rh—;
телю; г) кровь матери Rh—, кровь плода Rh+.
166 Областная олимпиада. 2005/2006 учебный год 11 класс 167

20. У ребенка III группа крови. Определите возможные группы крови 25. В результате какой операции кошка лишится способности опре-
его родителей. делять положение тела относительно вектора гравитации?
1 — отец — IV, мать — IV; 2 — отец — III, мать — III; 3 — отец — III, а) Разрушение улитки;
мать — IV; 4 — отец — I, мать — III; 5 — отец — I, мать — IV. б) разрушение полукружных каналов;
а) 2; в) 2, 3, 4; в) удаление отолитов;
б) 2, 4; г) 1, 2, 3, 4, 5. г) удаление текториальной мембраны.
21. Вторая сигнальная система характерна для: 26. Сколько в глазу человека преломляющих поверхностей?
1 — млекопитающих; 2 — высших приматов; 3 — собак; 4 — чело- а) 1; б) 2; в) 3; г) 4.
а) 1, 2, 3, 4; в) 2, 4; 27. При  возбуждении поперечно-полосатого мышечного волокна
б) 2, 3, 4; г) 4. ионы Са2+ движутся из:
а) внеклеточного пространства в саркоплазму;
22. Отрицательный азотистый баланс у человека наблюдается:
б) внеклеточного пространства в саркоплазматичеcкий ретикулум;
а) при значительном снижении содержания белков в пище; в) саркоплазматического ретикулума в саркоплазму;
б) при беременности; г) саркоплазмы в саркоплазматический ретикулум.
в) в период роста;
г) при значительном увеличении содержания белков в пище. 28. В постабортивный период:
23. На  рисунке представлена лока- а) снижается инсулин-глюкагоновый индекс, увеличивается вну­
лизация центральных частей слу­ трикле­точная концентрация циклического АМФ (цАМФ),
хового, зрительного и тактильно- ускоряется распад глико­гена;
го анализаторов в коре больших б) увеличивается инсулин-глюкагоновый индекс (отношение инсу-
полу­шарий у человека. В каком лин / глюкагон в периферической крови), уменьшается внутри-
пункте (а—г) представлены пра- клеточная кон­центрация цАМФ, ускоряется распад гликогена;
вильные подписи к рисунку? в) снижается инсулин-глюкагоновый индекс, ингибируется фос-
3 фодиэстераза, ускоряется глюконеогенез;
а) 1 — тактильный, 2 — слуховой, 2
3 — зрительный; г) увеличивается инсулин-глюкагоновый индекс, увеличивается
б) 1 — слуховой, 2 — зрительный, 3 — тактильный; внутри­клеточная концентрация цАМФ, стимулируется глюко-
в) 1 — зрительный, 2 — тактильный, 3 — слуховой; неогенез.
г) 1 — слуховой, 2 — тактильный, 3 — зрительный.
29. Во время физической нагрузки в крови человека повышается уро-
24. Укажите, в какой последовательности при действии звука вовле- вень СО2. Что при этом происходит?
каются в колебательный про­цесс структуры органа слуха. 1 — снижается сродство гемоглобина к кислороду; 2 — снижает-
1 — барабанная перепонка; 2 — перепонка круглого окна улитки; ся отдача СО2 через легкие; 3 — возрастает потеря минеральных
3 — основная мембрана улитки; 4 — молоточек; 5 — стремечко; солей через выдыхаемый воздух; 4 — мозг страдает от недостатка
6 — перилимфа. кислорода; 5 — повышается температура тела.
а) 1 → 5 → 4 → 6 → 3; в) 1 → 4 → 5 → 6 → 3; а) 1; в) 1, 5; д) 2, 4.
б) 1 → 5 → 4 → 3 → 6; г) 1 → 4 → 5 → 2 → 6 → 3. б) 4; г) 2, 3;
168 Областная олимпиада. 2005/2006 учебный год 11 класс 169

30. Расположите в  правильной последовательности события, свя­ Вес плодов  Родительские 

занные с сокращением мышц. тыквы в F2 формы (Р)
1 — миозин активируется; 2 — деполяризуется Т-система; 3 — вы- 4 кг 3,5 кг 3 кг 2,5 кг 2 кг 2 кг 4 кг
свобождается ацетилхолин; 4 — тропонин движется; 5 — филамен- а 1 2 6 2 1 Аавв ААВВ
ты скользят; 6 — мышечные волокна укорачиваются. б 1 4 6 4 1 АаВв ааВВ
а) 2 → 3 → 1 → 4 → 5 → 6; в 1 4 6 4 1 ААвв ааВВ
б) 3 → 2 → 4 → 1 → 5 → 6; г 1 6 2 6 1 ААВв ААВВ
в) 4 → 5 → 3 → 1 → 2 → 6; д 1 4 6 4 1 аавв ААВВ
г) 3 → 6 → 2 → 1 → 4 → 5;
д) 5 → 4 → 6 → 2 → 1 → 3. 34. Аллели локуса AB0 обозначены соответственно IA, IB, i0. Час­тоты
аллелей в  популяции обозначены соответственно p(IA), q(IB)
31. Два организма-альбиноса скрещивают и получают потомство F1 и r(i0). Какова будет ожидаемая частота людей с группой крови В
с  одинаковым фенотипом. Затем F1 скрещивают между собой в популяции?
и получа­ют в F2 9 окрашенных и 7 альбиносов. Найдите правиль-
а) 2qr3; г) q + r ;
ную комбинацию генотипов родителей и потомства F2.
б) q2 + 2qr ; д) p + q + r.
Родители Потомство F2 в) 2qr;
а ААвв; ааВВ 9А-В- 3ааВ- 3А-вв 1аавв 35. Муж и жена имеют группу крови В. У них родились двое де­тей —
б аавв; Аавв 9А-В- 3ааВв 3Аавв 1аавв Ольга и  Борис. Какова вероятность того, что  у  Ольги группа
в АаВв; АаВв 9А-В- 3ааВв 3Аавв 1аавв кро­ви 0? (Для буквенного обозначения частоты воспользуйтесь
информа­цией предыдущего задания.)
г ааВв; Аавв 9А-В- 3ааВ- 3А-вв 1аавв
а) r2; г) (2qr/(q2 + 2qr))2 ⋅ 1/4;
д ААВВ; аавв 9А-В- 3ааВ- 3Аавв 1аавв
б) 2qr3; д) 1 – 2qr.
32. Определите правильное соотношение частот аллелей, ответст­ в) (2qr)2 ⋅ 1/4;
венных за группы крови А, В, 0, если в популяции встречается 36. Гетерозиготность, т. е. частота особей, гетерозиготных по опреде­
25 % лю­дей с группой 0, 24 % — с группой А, 39 % — с группой В ленному локусу, отражает генетическую изменчивость в популя-
и 12 % — с груп­пой АВ. ции. До­пустим, популяция определенного вида однолетнего рас-
А В 0 тения состоит из 50 особей. Пусть частота аллелей в популяции
а 0,3 0,2 0,5
соответствует р(А) = 0,9 и q(a) = 0,1. Какой фактор может вызвать
возрастание гетерозиготности в следующем поколении?
б 0,2 0,5 0,3
а) Дрейф генов;
в 0,2 0,3 0,5
б) инбридинг;
г 0,5 0,2 0,3 в) отбор против аа-растений;
д 0,3 0,5 0,2 г) миграция особей из популяции, где р(А) = 0,99 и q(a) = 0,01.

33. При анализе собранного в F2 урожая тыквы было установлено, 37. Клетки с триплоидным на­бором хромосом имеют представители
что вес отдельных плодов варьирует от 2 до 4 кг. В таблице при- отдела:
ведены генотипы и их частота в потомстве F2, а также генотипы а) Бурые водоросли; в) Голосеменные;
исходных роди­тельских форм (Р). Найдите правильный ответ. б) Папоротникообразные; г) Покрытосеменные.
170 Областная олимпиада. 2005/2006 учебный год 11 класс 171

38. Парк был разбит в месте, где ранее росло много деревьев вида А, 42. Происходит ли эволюция хищных животных, которые живут в на-
но  впоследствии они были вырублены (не  осталось ни  одного стоящее время?
дерева вида А). Садовник вновь посадил деревья вида А и, кро- а) Происходит эволюция всех видов;
ме того, деревья видов В и С, которые никогда раньше не росли
б) происходит эволюция только видов, ведущих древесный образ
на этом месте. Никто не ухаживал за этим садом. Через сто лет
выросло много деревьев видов А и В, но не было молодых деревьев
вида С. Какие процессы происходили с деревьями видов А, В и С в) происходит эволюция только мелких видов животных;
в этом парке? г) эволюция не происходит.
43. В лаборатории были выведены мутантные мыши, у которых от­
сутствует киназа фосфорилазы. В обычных условиях они не от-
а интродукция акклиматизация реакклиматизация
личаются по  двигательной активности от  мышей контрольной
б акклиматизация интродукция реакклиматизация
группы, так же долго плавают, но при этом гликоген в их мышцах
в интродукция реакклиматизация акклиматизация
расходуется. Охарак­теризуйте особенности метаболизма и пове-
г реакклиматизация акклиматизация интродукция дения данных мышей.
д акклиматизация реакклиматизация интродукция
1 — если такую мышь напугать (например, кошкой), то вместо
39. Укажите положение, которое не  объясняет взаимосвязь между стреми­тельного бега у  нее начнутся судороги в  результате не-
потен­ци­альными возможностями среды обитания и высокой плот- возможности срочной и  интенсивной мобилизации гликогена;
ностью по­пуляций: 2 — если такую мышь напутать (например, кошкой), то ее двига-
а) растет конкуренция; тельная реакция не будет отличаться от мышей контрольной груп-
б) снижается скорость рождения; пы; 3 — если такую мышь напугать (например, кошкой), то вместо
в) включается механизм отрицательной обратной регуляции; стреми­тельного бега у нее начнутся судороги в результате сердеч-
г) снижается влияние окружающей среды; ной недос­таточности; 4 — при умеренных нагрузках нефосфори-
д) растет скорость смертности. лированная фосфорилаза может активироваться аллостерически
без фосфорилирования; 5 — при умеренных нагрузках возможно
40. Какие условия могут способствовать расширению ареала популя- фосфорилирование гликоген-фосфорилазы без участия киназы
фосфорилазы — с помощью киназы С.
а) Высокая смертность и как следствие — появление незаселенных а) 1, 3, 4; в) 1, 4; д) 5.
мест обитания; б) 2, 3, 5; г) 1, 3, 4, 5;
б) высокая плотность популяции и отсутствие достаточного коли-
чества кормов; 44. Реакция агрессии у животных может встречаться в различных слу-
в) отсутствие подходящих мест обитания в  непосредственной чаях и может быть вызвана различными причинами, в том числе
близости; внешними раздражителями (стимулами). Что из перечисленного
г) низкий уровень рождаемости при  высокой плотности попу­ не яв­ляется агрессивным поведением животного?
ляции; а) Поведение жертвы под страхом быть убитой;
д) нарушение цепей питания.
б) поведение в отношении чужаков с целью защитить свою терри-
41. Половое размножение считают ароморфозом, потому что оно: торию;
а) повышает генетическое разнообразие; в) поведение по отношению к другим животным, которые стара-
б) переводит большинство генов в гомозиготное состояние; ются похитить пищу;
в) не увеличивает долю гетерозиготных особей. г) поведение хищника по отношению к жертве.
172 Областная олимпиада. 2005/2006 учебный год 11 класс 173

45. В состоянии биологического прогресса находится вид: 50. Вирус СПИДа поражает:
а) зубр; в) черный журавль; а) Т-лимфоциты; г) базофилы;
б) гинкго; г) домовой воробей. б) нейтрофилы; д) моноциты.
в) В-лимфоциты;
46. β-адренэргический рецептор человека и бактериородопсин объе­
диняет то, что они: 51. Полиплоиды у покрытосеменных растений:
а) являются продуктами альтернативного сплайсинга одного 1 — часто имеют более широкий ареал распространения, чем их ди-
и того же гена; плоидные предки; 2 — часто распространены в более неблагопри-
б) чувствительны к повышению концентрации адреналина во вне- ятных для данного вида клима­тических условиях; 3 — эволюци-
клеточной среде; онно более молодая группа; 4 — более мощные, чем  диплоиды;
в) относятся к суперсемейству белков, пронизывающих плазмати- 5 — встречаются преимущественно у многолетних растений.
ческую мембрану ровно семь раз; а) 1, 3, 5; в) 1, 2, 3, 4, 5; д) 4.
г) нет правильного ответа. б) 2, 4, 5; г) 3;

47. Гены эукариотической хромо­сомы практически не экспрессиру- 52. На рисунке схематично изображен мембранный транспорт меж-
ются в фазе клеточного цикла: ду внутриклеточными вакуолями и плазматической мембраной.
а) профазе; г) телофазе; Определи­те, как называются процессы, обозначенные цифрами I,
б) метафазе; д) интерфазе. II и III.
в) анафазе; I II III

48. Какие из перечисленных клеточных органелл участвуют в про-

цессе трансляции?
1 — ядро; 2 — митохондрии; 3 — шероховатая эндоплазматическая
сеть; 4 — ядрышки; 5 — рибосомы; 6 — мезосомы; 7 — хлоропласты; 4
8 — тРНК; 9 — иРНК; 10 — белковые факторы трансляции.
3 7
а) 1, 5, 8, 9; г) 2, 3, 5, 7, 8, 9, 10;
б) 2, 6, 7, 10; д) 1, 3, 5, 7.
в) 2, 3, 5, 7; 8
49. Обычный способ иммунизации против бактериальных инфекций
включает использование живых вакцин. Живые вакцины — это:
а) низкая доза инфекционных бактерий, принимаемых для про-
б) доза модифицированного штамма бактерий, сохраняющих им- 1
муногенность, но не патогенных; а) I — эндоцитоз; II — фагоцитоз; III — экзоцитоз;
в) низкая доза токсина, продуцируемого бактерией; б) I — экзоцитоз; II — эндоцитоз; III — фагоцитоз;
г) образец клеток человека, который ранее был вылечен от этой в) I и II — эндоцитоз; III — экзоцитоз;
болезни. г) I — экзоцитоз; II и III — фагоцитоз.
174 Областная олимпиада. 2005/2006 учебный год 11 класс 175

53. Определите, какие структуры обозначены цифрами 1—8 (зада- б) это связано с  тем, что  спектры поглощения пигментов зеле-
ние 52). ного и красного восприятия цветов перекрываются (кривые 2
и 3 на рисунке). Поэтому дефект пигмента восприятия крас-
а б в г д
ного цвета автоматически влечет за собой нарушение воспри-
Эндоплазматический ретикулум 2 1 1 4 7 ятия зеленого цвета и  наоборот. За  счет этого частота даль­
Комплекс Гольджи 1 4 2 5 6 тоников с  дефектом «зеленого» и  «красного» зрения резко
Секреторная везикула 3 6 3 6 5 возрастает;
Окаймленная везикула 7 5 4 8 3
в) это связано с тем, что гены, кодирующие синтез пигментов вос-
приятия зелено­го и красного цветов, могут мутировать в десят-
Эндосома 6 7 5 7 1
ки тысяч раз чаще, чем ген синтеза пигмента восприятия синего
Лизосома 5 8 6 1 2
Фагосома 8 2 7 2 4 г) это связано с тем, что ген, кодирующий синтез пигмента вос-
Фаголизосома 4 3 8 3 8 приятия синего цве­та, вообще не мутирует.

54. Какая(-ие) ткань(-и) растения выполняет(-ют) опорную функцию? 56. При нагревании ДНК денатурируется. Во время охлаждения це­
а) Паренхима; почки объединяются снова в зависимости от степени комплемен-
б) ксилема, флоэма, паренхима; тарности последовательностей. Какой тип ДНК будет ренатури-
в) паренхима, колленхима; роваться в пер­вую очередь?
г) колленхима, склеренхима; а) ДНК с большим количеством повторов;
д) флоэма, склеренхима, паренхима. б) ДНК со средним числом повторов;
55. Примерно 1—3 % (в  некоторых странах до  5 %) людей страдают в) ДНК с уникальными последовательностями;
дальтонизмом с дефектом восприятия зеленого или красного цвета. г) метилированная ДНК;
Де­фект восприятия синего цвета встречается очень редко. Почему? д) псевдогены.
1 — синий цвет; 57. Охарактеризуйте особенности трахеид.
Нормализованное поглощение

2 — зеленый цвет; 1 — живые клетки; 2 — конечные стенки скошены; 3 — поры рас-
1 2 3 3 — красный цвет.
положены на вертикальных стенках; 4 — клеточная оболочка вто-
ричная; 5 — клеточная оболочка первичная; 6 — горизонтальные
перегородки между трахеидами отсутствуют; 7 — клетки мертвые;
8 — выполняют водопроводящую функцию; 9 — проводят про-
дукты ассимиляции; 10 — клеточная оболочка одревесневшая;
11 — клеточная оболочка опробковевшая; 12 — клетки прозенхим-
ного типа.
а) 2, 3, 4, 7, 8, 10, 12;
500 550 600 650 Длина волны, λ б) 1, 3, 5, 6, 9, 11, 12;
в) 3, 5, 6, 8, 9, 11, 12.
а) Это связано с тем, что гены, контролирующие синтез пигмен-
та зеле­ного и красного восприятия цветов, находятся в Х-хро­ 58. Определите признаки цветка, свойственные для наиболее высо­ко
мосоме, а ген восприятия синего цвета — в аутосоме; организованных таксонов:
176 Областная олимпиада. 2005/2006 учебный год 11 класс 177

1а — спироциклическое расположение частей цветка; 1б — цикли- а) гидры и сенной палочки;
ческое; 1в — спиральное; б) инфузории и дафнии;
2а — цветки без околоцветника; 2б — цветки с двойным около­ в) элодеи и эвглены;
цветником; 2в — безлепестные цветки; г) планарии и циклопа;
3а — завязь нижняя; 3б — завязь полунижняя, 3в — завязь верхняя; д) любого из них.
4а — апокарпный гинецей; 4б — ценокарпный гинецей;
5а — асимметричные цветки; 5б — зигоморфные цветки; 5в — ак- 62. Укажите правильное соответствие гормонов (1—4) и органов-ми-
тиноморфные цветки; шеней (а—г).
6а — обоеполые цветки; 6б — однополые цветки; 1 — кальцитонин; 2 — альдостерон; 3 — паратгормон; 4 — глюкагон.
7а — сростнолепестный венчик; 7б — свободнолепестный венчик. а — почки; б — костная ткань; в — кишечник; г — печень.
а) 1а, 2б, 3а, 4б, 5в, 6а, 7б; а) 1 — в; 2 — г; 3 — г; 4 — г;
б) 1в, 2а, 3б, 4б, 5б, 6а, 7а; б) 1 — б; 2 — а; 3 — а, б, в; 4 — г;
в) 1б, 2в, 3в, 4а, 5а, 6а, 7а; в) 1 — б; 2 — в; 3 — а, в; 4 — в, г;
г) 1б, 2а, 3а, 4б, 5а, 6б, 7а; г) 1 — а; 2 — в; 3 — а; 4 — б, г.
д) 1в, 2б, 3а, 4б, 5б, 6а, 7б.
63. К рецепторным белкам относится:
59. Укажите утверждение, не характеризующее нарушение цикла мо- а) инсулин; в) родопсин;
чевины у человека: б) коллаген; г) интерферон.
а) в организме происходит усиленный синтез заменимых амино-
кислот; 64. Субстратная специфичность фермента обусловлена:
б) нарушение координации движений; а) комплементарностью активного центра субстрату;
в) отвращение к богатым белками продуктам; б) размерами молекулы фермента;
г) резкое повышение аммиака в крови; в) наличием кофермента.
д) наибольшая интоксикация аммиаком при нарушении синтеза
карбамоилфосфата. 65. В  растениях с  САМ-типом фотосинтеза движение воды вверх
по  ксилеме часто наблюдается днем, хотя устьица днем закры-
60. К планктону нельзя отнести: ты. Выберите наиболее разумное объяснение этого наблюдения
а) элодею и гидру; из предложенных:
б) циклопа и дафнию; а) осуществляется транспорт сахаров, образовавшихся в  фо­то­
в) сенную палочку; синтети­ческих тканях, к участкам их потребления, для чего не-
г) инфузорию; обходима вода;
д) эвглену зеленую. б) РуБисКо в САМ-растениях намного менее подвержена ингиби-
рованию кислородом;
61. В небольшом водоеме обитают следующие организмы: в) днем САМ-растения перемещают 4-углеродные соединения
1 — элодея; 2 — сенная палочка; 3 — эвглена зеленая; 4 — инфузо- из корней в листья по ксилеме;
рия; 5 — дафния; 6 — планария; 7 — циклоп; 8 — гидра. г) клетки обкладки пучка САМ-растений содержат хлоропласты;
Определите, снижение численности каких организмов может д) ксилемный транспорт в САМ-растениях высотой 10 м обеспе-
стать причиной гибели остальных. чивается исключительно кор­нями.
178 Областная олимпиада. 2005/2006 учебный год 11 класс 179

66. К  врачу обратился пациент с  по- 5

4 дня метка пе­реходит в сахара, образуемые в хлоропластах. Био-
ниженным уровнем альбумина 3 химик сделал вывод:
в  плазме крови (потеря связана а) растение фиксирует углерод по типу САМ;
с  нарушением функции почек).
б) образец является растением типа С4;
Элемент почки, дефект кото­рого
в) реакции фиксации углерода происходят в разных клетках;
вызывает этот симптом, обозначен 1
на рисунке цифрой: г) растение использует митохондрии вместо хлоропластов.
а) 1; д) 5; 70. В какой части хлоропласта на свету самое низкое значение рН?
б) 2; е) 6;
в) 3; ж) 7. 2 а) Между внешней и внутренней мембранами;
г) 4; б) в пространстве между тилакоидными мембранами;
в) в строме;
67. Основная функция альбумина  — 7
г) в цитозоле.
поддержка онкотического давле-
ния кро­ви. У  пациента со сниже- 71. Бактерии E. coli используют глюкозу в первую очередь, даже в при-
нием содержания альбумина в крови наблюдается отек ног, что сутствии других cахаров. Если бактерии находятся в среде, содер­
ведет к: жащей глюкозу, арабинозу, мальтозу и лактозу в ка­честве источ-
а) повышению кровяного давления; ников энергии, присутствие глюкозы препятствует метабо­лизму
б) потере тканевой жидкости; остальных сахаров. На какой из процессов глюкоза не будет ока-
в) повышению кровоснабжения ног; зывать влияния?
г) расширению сосудов;
а) Образование комплекса цАМФ — БАК (белок, активирующий
д) уменьшению объема крови.
68. Известно, что по химической природе гормоны делят на три груп- б) связывание РНК полимеразы с lac промотором;
пы: пептидные, производные аминокислот и стероидные. Найдите в) связывание белка БАК с lac промотором;
стероидные гормоны среди перечисленных. г) синтез белка БАК;
1 — андреналин; 2 — тироксин; 3 — эстроген; 4 — инсулин; 5 — д) синтез цАМФ.
трииодтиронин; 6 — прогестерон; 7 — соматотропин; 8 — фолли-
кулостимулирующий гормон; 9  — кортизон; 10 — вазопрессин; 72. Клонированная в бактериях кДНК, кодирующая синтез β-субъ­
11 — андроген; 12 — глюкагон. единицы гемоглобина, может осуществлять синтез нормального
а) 1, 3, 7, 8; полипетида, тогда как хромосомный ген, клонированный в этой же
б) 2, 4, 6, 10; систе­ме, не может, потому что:
в) 3, 5, 7, 12; а) бактериальные полимеразы не  могут транскрибировать ин­
г) 3, 6, 9, 11. троны;
69. Биохимик получил образец растения от коллеги, который заме­тил, б) интроны содержат кодоны, которые не могут узнаваться тРНК;
что у данного растения устьица днем закрыты. Биохимик устано­ в) бактерии не могут осуществить сплайсинг мРНК предшествен-
вил, что радиактивная двуокись углерода, поглощенная ночью, ников эукариотической мРНК;
сначала находится в органических кислотах вакуоли, а в течение г) интроны содержат петли, блокирующие функцию рибосом.
180 Областная олимпиада. 2005/2006 учебный год 11 класс 181

73. Гербицид Roundup (глифосат), нарушающий продукцию лигни­на а — пространственное расположение полипептидного остова,
у растений, используется для уничтожения сорняков. Какая ткань, в формировании которого участвуют водородные связи; б — ко-
скорее всего, будет повреждена этим гербицидом? личество и порядок чередования аминокислот в полипептиде; в —
пространственное расположение пептидных цепей в олигомерном
а) Колленхима;
белке; г — пространственная укладка полипептидной цепи, стаби-
б) паренхима;
лизированная меж­радикальными связями.
в) склеренхима;
г) эпидермис; Укажите верные утверждения.
д) камбий. а) 1 — б; 2 — а; 3 — г; 4 — в;
б) 1 — б; 2 — г; 3 — а; 4 — в;
74. Канцероген 1-го класса, один из видов рода Helicobacter (патоген в) 1 — в; 2 — а; 3 — г; 4 — б;
человека), находится в: г) 1 — б; 2 — в; 3 — г; 4 — а.
а) кишечнике; 78. В анаэроб­ном дыхании участвуют:
б) желудке; 1 — NO3–; 2 — сукцинат; 3 — S; 4 — SO42–; 5 — NH3; 6 — CO2; 7 — CH4;
в) мочеполовой системе; 8 — глюкоза.
г) коже. а) 1, 2, 5, 8; в) 2, 5, 7, 8;
75. Пищевая ценность белков определяется: б) 1, 3, 4, 6; г) 2, 3, 5, 8.

1 — аминокислотным составом; 2 — наличием заряда белковых 79. В одном из лесов Англии ученым было выловлено 100 березовых
молекул; 3 — возможностью расщепления в желудочно-кишеч- пядениц (Biston betularia). При осмотре выборки было обнаруже-
ном тракте; 4 — порядком чередования аминокислот в молекуле; но, что 87 из них представители меланистической формы, а осталь-
ные — нормальной. Укажите верное утверждение:
5 — молекулярной массой.
а) на  свет ловушки ученого слетаются преимущественно особи
а) 1, 2, 5; в) 3, 4;
мелани­стической формы;
б) 1, 3; г) 1, 2, 3, 4, 5.
б) в ночное время, когда проводился вылов, более активны особи
76. Что происходит при денатурации белка? мела­нистической формы;
а) Потеря биологической активности белка в результате его гид­ в) вылов проводился в  лесу, рядом с  которым расположено
промыш­ленное предприятие.
б) изменение конформации белка, сопровождающееся потерей его 80. Энтомолог (см. задание 79) пометил пядениц и выпустил, а че-
био­логической активности; рез сутки вновь вы­ловил. Во  втором вылове оказалось 4 мече-
в) уменьшение растворимости при добавлении солей щелочных ные особи нормальной формы и 27 — меланистической. Рас-
и ще­лочноземельных металлов; считайте число пя­дениц в популяции, если миграции и смерти
г) конформационные изменения белка в результате взаимодей- не было:
ствия с природными лигандами. а) 270; в) 425;
77. Подберите к каждому уровню структурной организации белка со- б) 323; г) 507.
ответствующее определение.
1 — первичная структура; 2 — вторичная структура; 3 — третичная
структура; 4 — четвертичная структура.
182 Областная олимпиада. 2005/2006 учебный год 11 класс 183

Часть В 3. Линейный фрагмент ДНК обработали рестриктазами ЕсоRI

и  HinDIII, продукты рестрикции разделили с  помощью элек­
1. В ходе исследований был обнаружен участок, содержащий полимор-
трофореза в агарозном геле. Результаты разрезания ДНК одной
физм длины рестрикционных фрагментов (ПДРФ), сце­пленный или двумя рестриктазами показаны ниже (размер фрагментов дан
с геном, дефект которого приводит к мышечной дистрофии Дюшена в тысячах пар нуклеотидов, т. п. н.).
(МДД). МДД представляет собой Х-сцепленный рецессивный при-
знак. Уча­сток с ПДРФ расположен на расстоянии 2 см от гена МДД. ЕсоRI HinDIII ЕсоRI + HinDIII
Рассмотрите следующее расщепление и Саузерн-блот с использо- 7,5 5,5 4,5
ванием про­бы, гибридизующейся с исследуемыми фрагментами.
2 5 3
1 2
1 2
3 4
5 6 7 8 9 1

1) Каков размер всей молекулы ДНК?

2) Сколько сайтов для ЕсоRI находится в этой молекуле?
10 kb
8 kb 4. Используя указанную последовательность антисмысловой цепи
ДНК, покажите соответствующую последовательность мРНК и ее
2 kb 5'- и 3'- концы.
1 2 3 4 5 6 7 8 9
5'-TTATГTTГЦ-3' антисмысловая цепь.
Женщины 8 и 9 вышли замуж за мужчин без МДД и вскоре обе 5. Ниже представлена смысловая цепь ДНК.
1) Если бы вы не имели информации о ПДРФ, какова была бы Учитывая, что каких-либо посттранскрипционных модификаций
вероятность того, что ребенок индивида 8 может иметь МДД? не происходит, укажи­те аминокислотную последовательность по-
2) С  учетом информации о  ПДРФ, какова вероятность того, липептида, кодируемого данной ДНК.
что ребенок индивида 9 заболеет МДД?
6. Вы выделили из  грибов редкий октапептид, кото­рый предот-
2. В некоторой популяции древесных лягушек особи по цвету рас- вращает облысение. Аминокислотный состав этого пептида, оп­
пределены следующим образом: 120 — зеленые, 60 — коричневато- ределенный с помощью хроматографии:
зеленые и 20 — коричневые. Цвет ля­гушки определяется аллелями 2 Lys : 1 Asp : 1 Туr : 1 Phe : 1 Gly : 1 Ser : 1 Ala.
одного генетического локуса G. Аллель ко­ричневого цвета — GB,
Известно, что  реакция интактного пептида с  флуородинитро-
зеленого — GG. Эти аллели проявляют неполное доми­нирование
бензолом дает динитрофенил-аланин и  ε-динитрофенил-лизин
по отношению друг к другу. в соотношении 1 : 2. Для исследования структуры пептида вы ис-
Каковы наблюдаемые частоты гомозигот GBGB, GGGG и гетерози- пользовали трипсин (специфичен к основным аминокислотам)
гот GBGG в этой популяции? и химотрипсин (к ароматическим).
184 Областная олимпиада. 2005/2006 учебный год 11 класс 185

Трипсин дал при расщеплении два трипептида состава Lys, Ala, Ser 1 2 3 4

и Gly, Phe, Lys, а также дипептид Asp, Туr.
Химотрипсин дал следующие продукты: Lys, Ser, Phe, Ala + Gly,
Lys, Туr и аспарагиновую кислоту.
Установите состав аминокислот в пептиде. 8. Расположите водопроводящие элементы ксилемы семенных рас-
тений, изображенные на  рисунках 1—5, в  соответствии с  про­
7. На рисунках 1–4 показаны типы завязи, харак­терные для цветков
цессом их эволюции:  .
покрытосеменных растений.

1 2 3 4

1) Как называются изображенные типы завязей?

2 3 4 5
1 2 3 4
9. Впишите соответствующий номер из колонки Б в свободную клет-
ку перед утверждением из колонки А.
2) Для каких семейств флоры Беларуси они характерны? Около
Ответ А Б
цифр 1—4 укажите соответствующие буквы, используя список се-
Содержат палисадную паренхиму 1. Корни
мейств, при­веденный ниже.
А — Маковые — Papaveraceae; Имеют четко выраженную кутикулу 2. Стебли
Б — Розовые — Rosaceae; Содержат четко выраженную перидерму 3. Листья
В — Бобовые — Fabaceae; Содержат X-образный центральный цилиндр
Г — Зонтичные (Сельдерейные) — Umbelliferae (Apiaceae); кси­лемы
Д — Крестоцветные (Капустные) — Cruciferae (Brassicaceae); Являются составной частью клубня
Е — Губоцветные (Яснотковые) — Labiatae (Lamiaceae); Содержат пояски Каспари
Ж — Пасленовые — Solanaceae; Видоизменены в корнеплоды
З — Сложноцветные (Астровые) — Compositae (Asteraceae);
Содержат сосудистые пучки
И — Лилейные — Liliaceae;
Содержат годичные кольца
К — Касатиковые (Ирисовые) — Iridaceae;
Л — Орхидные (Ятрышниковые) — Orchidaceae; Видоизменены в  клубнелуковицы (как у  гла­-
М — Злаки (Мятликовые) — Gramineae (Роасеае).
186 Областная олимпиада. 2005/2006 учебный год

10. Рассмотрите схемы строения различных типов растительных кле- ОБЛАСТНАЯ ОЛИМПИАДА.
ток (А—Е). Определите, какой тип клетки изображен на каждой
схеме, укажите название в соответст­вующей ячейке таб­лицы. 2006/2007 учебный год
11 класс

Часть А
Неравномерно утощенная
целлюлозная стенка
1. Пазушные почки обычно возникают в результате:
Вакуоль а) деления клеток апикальной меристемы;
Г Д Полость б) дедифференциации клеток основной паренхимы;
в) деления клеток интеркалярных меристем;
Целлюлозная г) появления раневых меристем.
Лигнифицированная 2. Проводящий пучок, в центре которого находится флоэма, окру-
клеточная стенка женная кси­лемой, называется:
Пора а) коллатеральный; в) биколлатеральный;
б) радиальный; г) концентрический.

3. Для злаков характерны соцветия:

а) простая кисть, простой колос; в) метелка, султан;
б) зонтик, метелка; г) колос, тирс.
4. Плод огурца:
а) верхний, сочный, односемянный;
б) нижний, сочный, односемянный;
в) верхний, сочный, многосемянный;
г) нижний, сочный, многосемянный.

5. Ястребинка — это растение:

а) семейства Сложноцветные, имеющее соцветие корзинка и плод
б) семейства Бобовые, имеющее соцветие корзинка и плод семянка;
в) семейства Бобовые, имеющее соцветие головка и плод боб;
г) семейства Сложноцветные, имеющее соцветие головка и плод
6. Аэренхима — разновидность основной паренхимы, которую обыч-
но можно обнаружить в вегетативных органах:
188 Областная олимпиада. 2006/2007 учебный год 11 класс 189

1 — мезофитов; 2 — ксерофитов; 3 — гидрофитов; 4  — гигрофитов; 13. Конечная почка побега липы:
5  — суккулентов. а) верхушечная; в) сериальная;
а) 2, 3, 4; в) 3, 4; д) 2, 5. б) боковая; г) спящая.
б) 1, 2, 3; г) 4, 5;
14. Большинство клеток зародышевого мешка цветковых растений
7. Растения-эпифиты по отношению к дереву, на котором поселяют- имеет:
ся, являются: а) гаплоидный набор хромосом;
а) паразитами, так как полностью питаются за счет хозяина; б) диплоидный набор хромосом;
б) симбионтами, так как снабжают дерево дополнительным коли- в) триплоидный набор хромосом;
чеством минеральных веществ; г) тетраплоидный набор хромосом.
в) полупаразитами, так как сами создают органические вещества,
15. Среди перечисленных червей раздельнополым является:
а минеральные вещества поглощают за счет хозяина;
г) независимыми организмами, способными самостоятельно до- а) планария; в) печеночный сосальщик;
бывать мине­ральные вещества и синтезировать органические б) пиявка; г) аскарида.
вещества. 16. Наличие у кишечнополостных в цикле развития полипа и медузы
8. Одностороннее закручивание усиков у  цепляющихся растений является следствием:
вызвано действием: а) морфофизиологического прогресса;
а) ауксинов; в) гиббереллинов; б) морфофизиологического регресса;
б) цитокининов; г) антезина. в) биологического регресса;
г) идиоадаптации.
9. Стержневая корневая система наиболее четко выражена у:
17. На сокращение численности и исчезновение млекопитающих в со-
а) взрослых многолетних двудольных; временных условиях не оказывают(-ет) влияния:
б) молодых многолетних двудольных;
в) папоротников; a) различные виды охоты; в) ухудшение кормовой базы;
г) однодольных. б) завоз хищников; г) потепление климата Земли.
18. Млекопитающим помогает(-ют) переживать холодный период
10. Основные эпидермальные клетки кожицы листа: года:
а) никогда не имеют зеленых хлоропластов;
1 — накопление жира; 2 — впадение в спячку; 3 — миграции; 4 —
б) всегда имеют зеленые хлоропласты;
линька и развитие подшерстка; 5 — зимовка на отличной от взрос-
в) имеют зеленые хлоропласты у теневыносливых растений;
лого состояния стадии.
г) имеют зеленые хлоропласты у светолюбивых растений.
а) 1, 2, 3, 4, 5; г) 1, 3;
11. Заболевания, причиной которых являются паразитические гриб- б) 1, 2, 3, 4; д) 1.
ки, назы­ваются: в) 1, 2, 4, 5;
а) гельминтозы; в) лейкозы; 19. К отряду Бескилевые птицы относятся:
б) диартрозы; г) микозы.
1 — куры; 2 — нанду; 3 — киви; 4 — пингвины; 5 — эму.
12. Эндодермальное происхождение характерно для: а) 2, 3, 5; г) 3, 4;
а) листьев; в) кроющих волосков; б) 1, 2, 3, 4, 5; д) 4, 5.
б) пазушных почек; г) боковых корней. в) 1, 2;
190 Областная олимпиада. 2006/2007 учебный год 11 класс 191

20. В процессе эволюции сердце как функциональный орган впервые а) 1, 4; в) 1, 2, 3; д) 4.

появ­илось у представителей: б) 1, 2, 3, 4; г) 3;
а) типа Круглые черви; в) типа Скребни;
27. Укажите элементы синовиального влагалища сухожилий мышц.
б) типа Кольчатые черви; г) типа Членистоногие.
1 — париетальная пластинка; 2 — брыжейка сухожилия; 3 — сухо-
21. Морские змеи способны много часов находиться под водой, благо- жилие; 4 — висцеральная пластинка.
даря: а) 2, 3, 4; в) 2, 3; д) 1, 2, 4.
а) большому запасу воздуха в легких и замедленному обмену ве- б) 1, 4; г) 1, 2, 3, 4;
б) кожному дыханию; 28. Какие виды соединений относятся к фиброзным?
в) дыханию с помощью наружных жабр; 1 — швы; 2 — вколачивания; 3 — симфизы; 4 — межкостные пере-
г) дыханию через слизистую оболочку глотки. понки.
22. Функцию яйцевода у птиц и рептилий выполняет: а) 3; в) 2, 3; д) 1, 2, 4.
а) мюллеров канал; в) гаверсов проток; б) 1; г) 1, 2, 3, 4;
б) вольфов канал; г) евстахиева труба. 29. Атлантозатылочный сустав относится к:
23. Одноосным является сустав: а) одноосным; в) комплексным;
а) цилиндрический; в) шаровидный; б) сложным; г) комбинированным.
б) эллипсовидный; г) седловидный.
30. Наибольшей преломляющей способностью обладает:
24. Укажите артерии, образующие большой артериальный круг а) роговица;
мозга. б) стекловидное тело;
1 — передняя соединительная артерия; 2 — передние мозговые ар- в) хрусталик;
терии; 3 — задние мозговые артерии; 4 — передние ворсинчатые г) сетчатка.
31. Примером непрерывных соединительнотканных соединений ко-
а) 1, 2, 3; г) 4; стей яв­ляется(-ются):
б) 2, 4; д) нет верного ответа.
а) соединение между локтевой и лучевой костями;
в) 1, 2, 3, 4;
б) соединение зубов с зубными альвеолами верхней и нижней че-
25. Укажите части тела и органы, от которых лимфа течет в грудной люстей;
проток. в) соединения позвонков друг с другом;
1 — левая половина грудной полости; 2 — правая половина груд- г) соединение ребер с грудиной.
ной полости; 3 — органы таза; 4 — нижние конечности.
32. В онтогенезе человека костная ткань приходит на смену соедини-
а) 1, 2, 3, 4; в) 2; д) 1, 3, 4. тельной или хрящевой ткани. Возникновение костной ткани после
б) 1; г) 1, 2, 3. соединительной харак­терно для:
26. Укажите анатомические образования, характерные для  прямой а) плоских костей черепа;
кишки. б) плоских костей туловища;
1 — поперечные складки; 2 — кишечные ворсинки; 3 — групповые в) трубчатых костей конечностей;
лимфоидные узелки; 4 — продольные складки. г) плоских костей конечностей.
192 Областная олимпиада. 2006/2007 учебный год 11 класс 193

33. Первоочередную роль в  создании определенного гомеостаза 40. К длиннодневным растениям относятся(-ится):
играет: 1 — земляника; 2 — соя; 3 — горчица; 4  — яровая пшеница; 5  —
а) эндокринная система; хризантема.
б) иммунная система; а) 1, 2, 5; в) 2, 4;
в) высшая нервная деятельность; б) 4; г) 1, 3, 4.
г) наследственность.
41. Синтез АТФ не происходит при:
34. Укажите анатомическую структуру, которая проходит через от- а) гликолизе;
верстия в сухожильном центре диафрагмы: б) цикле Кребса;
а) грудной лимфатический проток; в) нижняя полая вена; в) световой стадии фотосинтеза;
б) аорта; г) пищевод. г) темновой стадии фотосинтеза.

35. Проток поднижнечелюстной слюнной железы открывается в: 42. Тонкостенные клетки с живым зернистым протопластом, слабо
развиты­ми вакуолями характерны для ткани:
а) уздечке языка;
б) уздечке нижней губы; а) покровной; в) механической;
в) подъязычном сосочке; б) образовательной; г) проводящей.
г) подъязычной складке. 43. Транспирация и газообмен активно осуществляются через:
а) устьица эпидермиса; в) трещины коры;
36. Сперматозоиды образуются в:
б) чечевички перидермы; г) все упомянутые структуры.
а) выносящих канальцах яичка;
б) извитых семенных канальцах яичка; 44. Для политенных хромосом характерно следующее:
в) прямых семенных канальцах яичка; 1 — не претерпевают митотической конденсации; 2 — не отличают-
г) канальцах сети яичка. ся от митотических хромосом по длине и отличаются по толщине;
3 — имеют диски и участки деконденсированного хроматина; 4 —
37. Отдел головного мозга, к которому относятся ножки мозга: встречаются только у животных.
а) средний мозг; в) конечный мозг; а) 1, 2, 3, 4; в) 1, 3;
б) промежуточный мозг; г) задний мозг. б) 1, 2, 3; г) 2, 4.
38. Разделение трахеи на бронхи находится на уровне: 45. Rec8 — это белок плечей и центромер дрожжевых хромосом. Из-
вестно, что он присутствует во время мейоза I, но разрушается
а) IV—VI шейных позвонков;
к наступлению анафа­зы II. При удалении гена, кодирующего Rec8,
б) IV—VII грудных позвонков;
сестринские хроматиды раз­деляются уже в анафазе I. Во время
в) IV—VII шейных позвонков;
каких стадий митоза будет присутст­вовать Rec8?
г) IV—V грудных позвонков.
1 — профаза; 2 — прометафаза; 3 — метафаза; 4  — анафаза; 5 —
39. В мозговое вещество почки входит часть нефрона, которая назы- телофаза.
вается: а) При митотическом делении этого белка нет;
а) капсула; б) 4, 5;
б) почечный клубочек; в) 1, 2, 3;
в) петля Генле; г) 1;
г) проксимальный извитой каналец. д) нет верного ответа.
194 Областная олимпиада. 2006/2007 учебный год 11 класс 195

46. В стебельке сувойки расположена специализированная структура 51. Что  представляет собой третичная оболочка клеточной стенки
цитоскелета — сарконема, обеспечивающая сокращение стебелька расти­тельной клетки?
при механи­ческом раздражении клетки. Сарконему можно выде- а) Структурированный комплекс гемицеллюлоз и пектиновых ве-
лить из клетки и изучить ее свойства in vitro (в физиологическом
растворе). При этом со­кращение можно вызвать добавлением Са2+,
б) структурированный комплекс кутина и суберина;
а  расслабление  — добавлением хелаторов кальция (например,
этилендиаминтетрауксусная кислота). Цикл сокращение-рассла- в) засохший остаток дегенерировавшего слоя цитоплазмы;
бление можно повторять многократно, даже при отсутствии АТФ г) фибриллы целлюлозы с  немногочисленным количеством
и ГТФ. Какая система обеспечивает движения сарконемы? гемицеллю­лоз.
а) Полимеризация-деполимеризация актина; 52. Что представляет собой тигроид в нейронах?
б) актин-миозин;
в) тубулин-динеин; а) Гладкий эндоплазматический ретикулум;
г) нет правильного ответа. б) шероховатый эндоплазматический ретикулум;
в) хондриом;
47. Для всех эпителиальных тканей животных характерны(-а): г) комплекс Гольджи.
1 — плазмодесмы; 2 — десмосомы; 3 — базальная мембрана; 4 —
микроворсинки; 5 — жгутики или реснички. 53. Примером факультативного гетерохроматина в клетках человека
а) 2, 3; в) 1, 4; можно считать:
б) 2, 3, 4; г) 4, 5. а) Х-хромосому в клетках мужского организма;
б) одну из Х-хромосом в клетках женского организма;
48. Укажите верное утверждение: в) обе Х-хромосомы в клетках женского организма;
а) все хлоропласты имеют только одну мембрану; г) нельзя привести такой пример.
б) существуют только двухмембранные хлоропласты;
в) у  некоторых высших растительных организмов могут встре- 54. В молекулярно-биологической лаборатории была частично уста-
чаться кроме двухмембранных также трех- и четырехмембран- новлена аминокислотная последовательность одного из белков
ные хлоропласты; кишечника гадю­ки. Молекулы тРНК, используемые в  синтезе,
г) у высших растений двухмембранные хлоропласты, а у некото- имеют следующие антикодоны:
рых групп низших — трех- и четырехмембранные.
3' UAC 5' 3'CGA 5' 3' GGA 5'
49. Цитохалазины — группа природных алкалоидов, ингибирующих 3' GCU5' 3' UUU 5' 3' GGA 5'
полиме­ризацию актина. Что произойдет с делящимися клетками Выберите последовательность нуклеотидов цепи молекулы ДНК,
млекопитаю­щих при добавлении цитохалазина? которая является комплементарной к кодирующей.
а) Деление клетки остановится в метафазе; а) 5'-ATG-GCT-GGT-CGA-AAA-CCT-3';
б) это приведет к образованию многоядерных клеток; б) 5'-ATG-GCT-CCT-CGA-AAA-CCT-3';
в) это приведет к образованию анеуплоидных клеток; в) 5'-ATG-GCT-GCT-CGA-AAA-GCT-3';
г) деление клетки остановится в анафазе.
50. Межмембранное пространство митохондрий:
55. Если амебу и эритроцит поместить в дистиллированную воду, то:
а) содержит ферменты цикла Кребса;
б) характеризуется высоким рН; а) обе клетки разрушатся;
в) является местом синтеза АТФ и восстановления молекулярного б) амеба погибнет, а эритроцит сохранится;
ки­слорода; в) амеба сохранится, а эритроцит погибнет;
г) характеризуется низким рН. г) обе клетки сохранятся.
196 Областная олимпиада. 2006/2007 учебный год 11 класс 197

56. Женский пол у дрозофилы определяется кариотипом (набором 61. Известные красители ДНК — бромистый этидий, акридиновый
хромосом): оранже­вый, профлавин — сильнейшие канцерогены. Они взаимо-
1 — XX; 2 — XY; 3 — соотношением числа Х-хромосом к аутосомам действуют с мо­лекулой ДНК по принципу интеркаляции (встра-
1 : 1; 4 — соотношением числа Х-хромосом к аутосомам 1 : 2; 5 — ивания молекулы между плоскостями азотистых оснований). Ка-
соотношением числа Y-хромосом к аутосомам 1 : 2. кой вид повреж­дений ДНК они могут вызывать?
а) 1; в) 1, 3; а) Поперечные сшивки ДНК, в  результате которых молекулы
б) 1, 5; г) 1, 4. не могут распле­таться при репликации;
б) выпадения и  вставки различного количества нуклеотидов
57. Признаки могут передаваться по наследству посредством: при репликации ДНК;
1 — РНК; 2 — ДНК; 3 — белков; 4 — полисахаридов; 5 — липидов. в) разрушают водородные связи между комплементарными осно-
а) 2; г) 1, 2, 4, 5; ваниями, в ре­зультате чего происходит плавление ДНК;
г) увеличение массы ДНК, а, следовательно, и увеличение ломко-
б) 1, 2; д) 1, 2, 3, 4, 5.
сти двуспиральной молекулы.
в) 1, 2, 3;
62. Сколько сайтов связывания антигена имеет молекула иммуногло-
58. Вам необходимо выделить из мышцы мыши суммарную мРНК
булина IgM?
(отделить ее от всех остальных типов клеточной РНК). Исходя
из знания строения мРНК млекопитающих, какой способ выде- а) 2; в) 10;
ления РНК вы предпочтете? б) 1; г) нет правильного ответа.
а) Выделение в жестких щелочных условиях; 63. В анафазе митоза число хроматид (n) и количество ДНК (с) равны
б) разделение в агарозном геле методом электрофореза; соответствен­но:
в) разделение в режиме гель-фильтрации; а) 2n, 2с; в) 4n,  4с;
г) разделение на аффинной колонке с пришитым к ней поли(А)- б) 2n, 4с; г) 4n,  2с.
связывающим белком. 64. У лошади 64 хромосомы, а у осла — 62. Потомство кобылы и осла
59. Найдите неверное утверждение о генетическом материале орга- (мулы) обычно стерильно. Сколько хромосом у мула?
низмов: а) 126; в) 63;
а) имеются вирусы, геном которых представлен РНК; б) 64; г) 62.
б) некоторые клеточные органеллы имеют свои собственные гено-
65. Фенилкетонурия — аутосомное заболевание, связанное с рецес-
мы из РНК;
сивным аллелем. У двух нормальных родителей родился ребенок
в) генетический материал в клетках бактерий может существовать
с фенилкетонурией. Какова вероятность того, что следующий ре-
во внехромосомном состоянии; бенок тоже будет болен?
г) вхождение чужеродной ДНК в  клетку не  всегда летально
для клетки, осо­бенно если это происходит у эукариотических а) 100 %; в) 25 %;
б) 50 %; г) 6,25 %.
60. Какой из компонентов не нужен для репарации ДНК in vivo? 66. При репликации ДНК «дочерняя» цепь синтезируется на матрице
а) Матрица одноцепочечной ДНК; «мате­ринской» цепи. Этот процесс происходит:
б) дезоксирибонуклеозид-монофосфаты (дАМФ, дЦМФ, дГМФ, а) консервативно. Образуется дуплекс (двойная спираль) из до-
дТМФ); черних цепей и дуплекс из материнских;
в) РНК полимераза — праймаза; б) полуконсервативно. Образуется два дуплекса, каждый состоит
г) ДНК полимераза. из дочерней и материнской цепей;
198 Областная олимпиада. 2006/2007 учебный год 11 класс 199

в) консервативный и полуконсервативный способы чередуются; АТР-зависимое карбоксилирование (перенос молекулы СО2) с об-

г) мозаично  — образуются два дуплекса, цепи которых состоят разованием оксалоацетата, который через несколько промежуточ-
из чередующих­ся материнских и дочерних участков. ных стадий теряет СО2, GTP-зависимо превращаясь в фосфоенол-
пируват; последний вовлекается в дальнейшие реакции глюконео­
67. Вы обнаружили вирус, содержащий 10 % аденина, 24 % урацила,
генеза. Подобная удивитель­ная расточительность клетки (когда
30 % гуанина и 36 % цитозина. Вы делаете вывод, что генетический
АТР и GTP тратятся, а СО2 сначала присоединяется, а затем снова
материал этого вируса представляет собой:
теряется) может объясняться:
а) двухцепочечную ДНК; в) двухцепочечную РНК;
б) одноцепочечную ДНК; г) одноцепочечную РНК. а) необходимостью сделать необратимым протекание реакции,
равновесие ко­торой в живой клетке сильно смещено в сторону
68. Выберите правильные утверждения относительно хроматографии: реагентов, а не продуктов реакции;
1 — хроматография — это метод разделения смесей веществ; 2 — б) несовершенством сравнительно недавно появившегося в про-
в качестве элюента в хроматографии можно использовать этило- цессе эволюции метаболического пути, состоящего из несколь-
вый спирт; 3 — с помощью хроматографии можно выделять только ких стадий, приобретен­ных от ранее используемых путей;
окрашенные вещества; 4 — для колоночной хроматографии обыч- в) разделением биохимических путей — если бы данная реакция
но используют оксид алюминия или кремния (алюмогель или си- шла напрямую (с образованием из пирувата фосфоенолпирува-
ликагель); 5 — хроматографический метод основан на воздействии та в одну стадию), то она конкурировала бы с последней реак-
света на вещества. цией гликолиза, приводя к неконтролируе­мой трате АТР;
а) 1, 3, 5; в) 1, 2, 4; д) 1, 4. г) ничем не объясняется, это можно рассматривать как пример из-
б) 1, 2, 3, 4, 5; г) 1, 3; быточности биологических систем.

69. Синтетические аналоги какого стероидного гормона используются 73. Архебактерии в норме обитают в экстремальных для эубактерий
в ка­честве контрацептивов? услови­ях — при высоких температурах (кипящие водяные источ-
а) Фолитропина; ники) и низких значениях рН. Липидный состав мембраны архе-
б) лютропина; бактерий так же сильно от­личается от других бактерий наличием
в) хорионического гонадотропина; в качестве основного компонента мембраны особых соединений,
г) прогестерона. структурная формула которых приведена ниже.
70. АТФазная активность в саркомере при мышечном со­кращении
локализуется в: O СH
а) I-диске; в) М-диске;
б) А-диске; г) нет правильного ответа. СH O

71. Процесс анаэробного окисления глюкозы происходит в: HO СH2

а) цитоплазме; в) глиоксисомах; Эти соединения являются производными изопреноидного спирта

б) матриксе митохондрий; г) мембранах митохондрий. фитола (С32) и имеют на обоих концах связанные остатки глице-
72. Известно, что животные могут фиксировать углекис­лый газ для рола, таким обра­зом они могут пронизывать архебактериальную
получения углеводов. Одним из примеров такой «фиксации» слу- мембрану насквозь, а  по­лярные головы одной молекулы будут
жит процесс глюконеогенеза — синтеза глюкозы из пировиноград- находиться по разные стороны мембраны. Чем с биохимической
ной кислоты. На первом этапе этого пути пируват претерпевает точки зрения можно объяснить исполь­зование архебактериями
200 Областная олимпиада. 2006/2007 учебный год 11 класс 201

столь необычных соединений в качестве строи­тельного материала 75. Какие метаболические изменения происходят в цитоплазме мы-
мембран? шечной клетки при утомлении?
а) Необходимостью увеличения механической прочности мембра- 1 — увеличение концентрации креатинфосфата; 2 — уменьшение
ны за счет на­сквозь пронизывающих ее изопреноидных произ- количества гликогена; 3 — увеличение концентрации ионов Н+;
водных; 4 — увеличение концентрации АТФ;
б) большей устойчивостью простых эфирных связей к гидролизу а) 1, 2; б) 1, 4; в) 2, 3; г) 3, 4.
по сравне­нию со сложноэфирными связями бактериальных ли-
пидов; 76. Какие три аминокислоты формируются непосредственно в один
в) высокой температурой плавления углеводородов (за счет их на- этап из пирувата, оксалоацетата и a-оксоглутарата соответственно?
сыщености и  разветвленности), что  снижает проницаемость Пируват Оксалоацетат α-оксоглутарат
мембраны для неспецифиче­ского тока воды при высоких тем- а  Алании Аспартат Глутамат
б  Лизин Аспарагин Глутамин
г) утратой архебактериями ферментативных систем синтеза мем-
в  Серин Аргинин Тирозин
бранных липидов.
г  Треонин Глицин Триптофан
74. Относительно недавно группа исследователей идентифицирова- 77. Крымский эдельвейс (ясколка Биберштейна) в  естественных
ла новое семейство мембранных белков. Эти белки чрезвычайно условиях встречается только в Крыму. Такой вид называют:
важны, так как обеспечивают проникновение в клетку воды («во- а) эндемик; в) эврибионт;
дные каналы»), за что им дали название — аквапорины. Оказалось, б) убиквист; г) космополит.
что вода в основном проникает в клетку именно через аквапорины,
а не путем диффузии через липидный бислой, как считалось ра- 78. Согласно гипотезе А. И. Опарина первыми живыми организмами
на на­шей планете были:
нее. Основной проблемой, с которой сталкиваются аквапорины
при транспорте воды в клетку, является то, что ион Н+ всегда свя- а) анаэробные гетеротрофы; в) автотрофы;
зан с водой, образуя гидроксоний ион Н3+O. И если бы аквопори- б) аэробные гетеротрофы; г) организмы-паразиты.
ны про­пускали ионы гидроксония так же свободно, как и моле- 79. Главное событие палеозойской эры:
кулы воды, то клетка погибла бы от невозможности поддержи- а) выход растений на сушу;
вать разность потенциалов Н+ на цитоплазматической мембране. б) появление первичных хордовых;
Какими свойствами, по вашему мне­нию, должны обладать кана- в) появление беспозвоночных;
лы аквапоринов, чтобы селективно пропускать только молеку- г) появление настоящих птиц.
лы воды?
80. Начало биологической эволюции связывают с появлением на Земле:
а) Иметь маленький диаметр канала и положительно заряженные
а) доклеточных форм жизни — вирусов;
аминокис­лотные остатки в составе «стенки канала»;
б) клеточных форм жизни;
б) иметь маленький диаметр канала и отрицательно заряженные
в) биополимеров;
аминокислот­ные остатки в составе «стенки канала»;
г) фазовообособленных систем.
в) иметь большой диаметр канала, чтобы пропускать молекулы
воды в составе гидратных оболочек положительно заряженных 81. Межвидовых гибридов нет между животными:
ионов щелочных металлов; а) хорьком и колонком; в) ослицей и конем;
г) иметь широкий и гидрофобный канал. б) тетеревом и глухарем; г) верблюдом и ослом.
202 Областная олимпиада. 2006/2007 учебный год 11 класс 203

82. Основным фактором, ограничивающим возрастание биомассы 2. Запишите термины, соответствующие определениям.
на плане­те, является(-ются):
Определение Термин
а) дефицит углекислого газа;
Устойчивая группа тесно связанных друг с другом
б) дефицит воды;
расте­ний, произрастающих на одной территории
в) интенсивность потока солнечной энергии;
г) биотические взаимоотношения. Биологически активные вещества, выделяемые
железами внутренней секреции или скоплениями
83. На каждом трофическом уровне 10 % энергии: специализирован­ных клеток организма и оказыва-
ющие целенаправленное действие на другие органы
а) поступает от Солнца; и ткани
б) рассеивается в виде тепла;
Способность к хранению и воспроизведению про-
в) запасается в тканях организма;
шлого индивидуального опыта, одно из основных
г) выделяется с экскрементами. свойств нерв­ной системы
Способность клетки поддерживать слабощелочную
Часть В реак­цию своего содержимого на постоянном уровне
1. Отметьте верное высказывание знаком «+», а ошибочное — знаком Гликопротеиновый комплекс, включенный в  на-
«–». ружную поверхность плазматической мембраны
животных клеток
Головной мозг у позвоночных возникает из того же слоя клеток Расхождение признаков у родственных организмов
зароды­ша, что и эпидермис
в процессе их эволюции, ведущее к возникновению
У ресничных червей нет анального отверстия новых систематиче­ских категорий
У некоторых современных птиц на крыльях есть свободные паль-
цы с когтями для лазанья по деревьям Внезапные естественные или  вызванные искус-
ственно на­следуемые изменения генетического
Зубы акул являются видоизмененными плакоидными чешуями
материала, приводя­щие к изменению тех или иных
Тип корневой системы может меняться по мере развития растений признаков организма
и в за­висимости от различных жизненных обстоятельств
Новейшие эволюционные концепции, основанные
Разделение почки на мозговой и корковый слой делает возмож-
ным кон­центрирование вторичной мочи на при­знании естественного отбора единственным
направлен­ным фактором эволюции
К  фотосинтезу способны большинство бактерий, водорослей
и высших растений Нуклеопротеидные нити, из которых состоят хро-
Заростки всех папоротникообразных способны к фотосинтезу мосомы клеток эукариот
У  папоротников в  жизненном цикле гаметофит преобладает
над спорофи­том 3. Сопоставьте два утверждения или показателя (обо­значены бук-
Споры плаунов образуются в корневище вами А и Б), приведенные в соответствующих столбцах таблицы
Риккетсии являются внутриклеточными паразитами животных и дайте от­вет в форме: А > Б; А < Б; А = Б. Знак «>», «<» или «=»
Генетическая информация у  всех живых организмов хранится внесите в средний столбец таблицы.
в виде ДНК
Инвазия — заболевание, обусловленное заражением организма А. Скорость прохождения ве- Б. Скорость прохождения ве-
болезнетвор­ными микроорганизмами ществ через поры ществ че­рез перфорации
Увеличение содержания углекислого газа в атмосфере может быть А. Количество отделов по­ Б. Количество отделов позво-
при­чиной кислотных дождей звоноч­ника у земноводных ночника у млекопитающих
204 Областная олимпиада. 2006/2007 учебный год 11 класс 205

А. Количество пальцев на ко­ Б. Количество пальцев на ко­ Характерные черты Организм

неч­ностях у парнокопытных нечно­стях у непарнокопыт-
млеко­питающих ных млекопи­тающих Присоединение РНК-полимеразы к  про-
мотору требует набора белков, называемых
А. Прочность зубной эмали Б. Прочность дентина зубов общими факторами транскрипции, кото­
А. Иммунитет младенца при Б. Иммунитет младенца при рые присоединяются к промотору до начала
вскарм­ливании грудным мо- искусст­венном вскармлива- транскрипции
локом нии
В процессинге мРНК к 5'-концу добавляет-
А. Количество сперматозоидов, Б. Количество яйцеклеток, ся метилгуанозиновый кэп, а  к  3'-концу  —
фор­мирующихся при гаме- формирую­щихся при гаме- поли-А хвост
тогенезе из сперматоцита тогенезе из ооцита I по­рядка
I порядка Большинство структурных генов содержат
интроны, которые вырезаются в  результате
А. Энергетический выход при Б. Энергетический выход при сплайсинга перед трансляцией
брожении дыха­нии
Синтез белка начинается еще до окончания
А. Степень внутривидовой Б. Степень внутривидовой кон­
конку­ренции у имаго чешуе- курен­ции у личинок чешуе-
крылых крылых Синтез белка всегда начинается на  свобод-
ных рибосомах в цитоплазме
4. В эукариотической клетке рибосомы, локализован­ные в цитозоле,
Уровень деградации мРНК регулируется вне-
эндоплазматическом ретикулуме, митохондриях и хлоропластах,
клеточными сиг­налами
осуществляют синтез определенных белков. Оп­ределите локали-
зацию рибосом, осуществляющих синтез указанных белков. Рибосома узнает последовательность Шай-
на — Дальгарно на 5'-конце мРНК для запу-
1 — цитозоль; 2 — эндоплазматический ретикулум; 3 — митохон- ска процесса трансляции
дрии; 4 — хлоропласты.
Белок Локализация рибосом 6. Поставьте знак «+» перед верным утверждением о транспор-
Фибронектин те веществ через плазматическую мембрану животной клетки
и знак «–» — перед неверным.
Комплекс цитохромов b6-f
Стероидные гормоны попадают внутрь клетки путем эндоцитоза
Аминокислоты попадают внутрь клетки путем простой диффу­зии
Метаболические отходы попадают внутрь клетки путем эндоци-
5. Укажите, какие черты синтеза РНК, процессинга мРНК и синтеза
белка характерны для: Ионы проходят через белки-каналы путем пассивного транс­порта
1 — прокариот; 2 — эукариот; 3 — обеих групп. Холестерол включается в клетку как липопротеин низкой плот­
ности (ЛНП) путем эндоцитоза, опосредованного рецептором
Характерные черты Организм
Одна РНК-полимераза катализирует синтез Na+/K+-насос транспортирует 3 иона Na+ в  клетку и  2  иона K+
трех типов РНК из клетки
206 Областная олимпиада. 2006/2007 учебный год 11 класс 207

7. На  рисунке изображен круговорот азота. Установите соответ-

Альдостерон АДГ*  Реабсорбция Реабсорбция
ствие между стадиями 1—4 круговорота азота и процессами, про- в плазме в плазме Na+ воды
текающими в это время, или микроорганизмами, их иницииру-






*АДГ — антидиуретический гормон.
NH 4
9. Используя цифровую нумерацию и буквенные обозначения, соот-
NO 3 несите следующую информацию по схеме:
витамин — группа витаминов (жирорастворимые или водо­раст­
+ воримые) — проявление авитаминоза — источник витамина.
NH 4
I — В6 (пиридоксин);
NO 2
NO 3
II — А (ретинол);
III — D (эргокальциферол, или кальциферол);
1  — аммонифицирующие бактерии; 2  — денитрифицирующие IV — B1 (тиамин);
бактерии; 3 — восстановление нитрата; 4 — нитрифицирующие V — В12 (цианокобаламин);
бактерии; 5 — синтез белка.
VI — С (аскорбиновая кислота).
Стадия Ответ Проявление авитаминоза:
1 1 — анемия; 2 — заболевание «куриная слепота», замедление роста,
ухудшение зрения, пораже­ние кожи, роговицы глаза, кишечни-
ка; 3 — цинга, снижение сопротивляемости к заболеваниям, по-
3 вышенная утомляе­мость, боль в  суставах, мышцах, поражение
4 капилляров, десен зубов, местные кровоизлияния; 4 — заболева-
ние «бери-бери» (полиневрит), исхудание, нарушение координа-
8. Через 48 ч после начала диеты, характеризующейся почти пол- ции движений, паралич конечностей, атрофия мышц, поражение
ным отсутствием ионов натрия в пище, у человека были исследо­ нервной системы; 5 — развитие рахита у детей (искривление ног,
ваны моча и уровень гормонов в плазме крови. Определите, какие уплощение груди, большая голова); у  взрослых  — уменьшение
показате­ли будут верно отражать изменения в его организме. минерализации костей; 6  — дерматит, анемия, судороги, поте-
Заполните таблицу, используя обозначения: «+» — возрастание; ря аппетита, сонливость или, наоборот, повы­шенная раздражи-
«–» — снижение; «=» — нет изменений. тельность.
208 Областная олимпиада. 2006/2007 учебный год

Источник витамина: Областная олимпиада.

а) печень, яичный желток, рыбий жир;
б) сливочное масло, яичный желток, морковь, помидоры, печень; 2007/2008 учебный год
в) плоды шиповника, красного перца, цитрусовых, черной сморо-
дины, лук, лис­товые овощи, молоко, печень; 11 класс
г) мясо, рыба, молоко, печень, дрожжи;
д) печень рыб и млекопитающих, почки, яйца, соя;
е) дрожжи, хлеб из муки грубого помола, гречневая, овсяная кру-
Часть А
пы, картофель, печень.
1. Прикрепление к почве и всасывание воды с минеральными веще-
Жирорастворимый (Ж)
или водорас­творимый
Проявление Источник  ствами у маршанции осуществляется за счет:
мин ави­таминоза вита­мина
(В) а) ксилемы; в) простых ризоидов;
I б) флоэмы; г) язычковых ризоидов.
II 2. На спорофите ламинарии формируются:
III а) женские гаметангии (оогонии);
б) мужские гаметангии (антеридии);
в) спорангии;
V г) оогонии и антеридии.
VI 3. Лист растет на протяжении всей жизни у:
а) кокосовой пальмы; в) вельвичии;
б) сосны; г) пихты.

4. Среди семенных растений сперматозоиды образуются у:

а) гинкго двулопастного; в) орхидеи;
б) финиковой пальмы; г) лиственницы.
5. В начале XX в. датский ботаник К. Раункиер выделил у растений:
а) две жизненные формы;
б) три жизненные формы;
в) четыре жизненные формы;
г) пять жизненных форм.
6. Наличие у наземных растений развитых механических тканей яв-
ляется приспособлением к:
а) рассеянной солнечной радиации;
б) недостатку или избытку влаги в окружающей среде;
в) низкой плотности воздуха как среды обитания;
г) поглощению питательных веществ из почвенного раствора.
210 Областная олимпиада. 2007/2008 учебный год 11 класс 211

7. У хламидомонады светочувствительный глазок: 14. В отличие от покрытосеменных у всех голосеменных отсутству-

а) находится в оболочке; ет(-ют):
б) целиком погружен в цитоплазму; а) камбий; в) перикарпий;
в) находится в выделительной вакуоли; б) вторичная ксилема; г) семядоли.
г) находится на хроматофоре.
15. Грамположительные и грамотрицательные бактерии различа­ются:
8. К хамефитам (по К. Раункиеру) относят: а) строением клеточной стенки;
а) пастушью сумку; в) бруснику; б) строением цитоплазматической мембраны;
б) мятлик однолетний; г) тюльпан. в) количеством рибосом;
г) способом спорообразования.
9. Клетки трансфузионной ткани голосеменных выполняют функ-
цию: 16. Актиномицеты относятся к:
а) синтеза белка; а) грибам;  в) микоплазмам;
б) фотосинтеза; б) цианобактериям; г) бактериям.
в) проведения веществ; 17. Не имеют клеточной стенки:
г) образования гемицеллюлозы. а) бациллы; в) стрептококки;
10. Элементарные (простые) соцветия головки образуют сложное ки- б) риккетсии; г) микоплазмы.
стевидное соцветие у: 18. Микроорганизмы, нуждающиеся в факторах роста, называются:
а) пижмы обыкновенной;  в) акации серебристой; а) ауксотрофы; в) олиготрофы;
б) сирени обыкновенной; г) костра безостого. б) прототрофы; г) фототрофы.
11. На рисунке изображен поперечный срез корня 19. Бациллы — это:
ириса (Iris germanika). а) грамположительные спорообразующие палочки;
Тип пучка в центральном цилиндре: б) грамотрицательные спорообразующие палочки;
а) концентрический; в) грамотрицательные неспорообразующие палочки;
б) коллатеральный; г) грамположительные неспорообразующие палочки.
в) радиальный; 20. У семенных растений начало образованию бокового корня дает:
г) биколлатеральный.
а) экзодерма;  в) перицикл;
12. Масло получают из околоплодника: б) эндодерма; г) паренхима коры.
а) подсолнечника; в) маслин; 21. Запасное вещество багрянковый крахмал характерно для водо­
б) кукурузы; г) горчицы. рослей:
а) зеленых; в) бурых;
13. У диатомовых водорослей:
б) красных; г) диатомовых.
а) преобладает гаплоидное поколение;
б) преобладает диплоидное поколение; 22. Формула цветка ландыша:
в) диплоидна только зигота; а) *Ч3Л3Т6П1; в) *О3 + 3Т6П(1);
г) гаплоидны только гаметы. б) *Ч3Л3Т3 + 3П(3); г) *О(3 + 3)Т3 + 3П(3).
212 Областная олимпиада. 2007/2008 учебный год 11 класс 213

23. Самец медоносной пчелы (трутень) имеет хромосомный набор: 29. Некоторые виды мух-журчалок имеют такую же черно-желтую
а) гаплоидный; полосатую окраску тела, как и осы. Это проявление:
б) диплоидный; а) бейтсовской мимикрии; в) дивергентного сходства;
в) триплоидный; б) мюллеровской мимикрии; г) случайного сходства.
г) тетраплоидный.
30. Челюсти для захвата пищи в ходе эволюции хордовых впервые
24. Насекомоядные растения получают из насекомых: появились у:
а) воду, которая необходима для жизненных процессов при про- а) щитковых; в) хрящевых рыб;
б) панцирных рыб; г) костных рыб.
израстании на сухой почве;
б) фосфор, который необходим для синтеза белка; 31. У птиц строение легких:
в) углеводы, так как они не могут образовываться в достаточном а) в виде простых мешков; в) ячеистое;
количестве при фотосинтезе; б) губчатое; г) альвеолярное.
г) азот, который необходим для синтеза белка.
32. Диким предком домашней кошки является:
25. Системой гигантских аксонов обладают представители типов:
а) камышовый кот;
а) Стрекающие, Плоские черви, Хордовые; б) манул;
б) Плоские черви, Круглые черви, Губки; в) степная переднеазиатская кошка;
в) Кольчецы, Членистоногие, Моллюски; г) рысь.
г) Моллюски, Членистоногие, Хордовые.
33. Основной конечный продукт обмена, выводимый из организма,
26. Свободноплавающие планктонные личинки имеются у таких бен- у рептилий:
тосных морских организмов, как: а) аммиак; в) мочевина;
а) нематоды, иглокожие, многощетинковые черви; б) креатин; г) мочевая кислота.
б) коловратки, коралловые полипы, иглокожие;
34. На рисунке изображен силуэт хищной
в) оболочники, иглокожие, коралловые полипы; птицы:
г) двустворчатые моллюски, оболочники, нематоды.
а) сокола; в) ястреба;
27. К животным с билатеральным типом симметрии относятся: б) луня; г) коршуна.
а) аскарида, актиния, майский жук; 35. Термиты известны тем, что разрушают постройки в тропиках, по-
б) губка-бадяга, дождевой червь, устрица; едая древесину. Эта способность объясняется тем, что:
в) каракатица, луна-рыба, офиура; а) в их кишечнике есть симбиотические микроорганизмы, пере-
г) краб, ланцетник, аскарида. рабатывающие целлюлозу;
б) у них эпителий кишечника секретирует особые ферменты, рас-
28. Органы слуха (тимпанальные органы) у цикад расположены:
щепляющие растительную клетчатку;
а) на голенях передних ног; в) кормя друг друга, они осуществляют более эффективное «кол-
б) у основания крыльев; лективное пищеварение»;
в) по бокам первого членика брюшка; г) взрослые термиты не питаются, а лишь измельчают древесину,
г) по бокам головы. используя ее при строительстве термитников.
214 Областная олимпиада. 2007/2008 учебный год 11 класс 215

36. Прямые предки ластоногих: 42. На рисунке буквой А обозначен череп:

а) хоботные; А Б а) Homo sapiens sapiens;
б) грызуны; б) Homo sapiens neanderthalensis;
в) насекомоядные; в) Homo erectus;
г) хищные. г) Australopithecus.

37. Одним из основных отличий зайцеобразных от грызунов является:

а) отсутствие когтей на задних конечностях;
б) наличие второй пары резцов на верхней челюсти;
в) наличие подшерстка;
г) отсутствие желез внешней секреции.

38. На  рисунке изображены артери- 43. Центры слюноотделения находятся в:

альные дуги: а) среднем мозге; в) промежуточном мозге;
а) двоякодышащей рыбы; б) мозжечке; г) продолговатом мозге.
б) бесхвостого земноводного;
в) хвостатого земноводного; 44. Регуляция движений желудка может осуществляться гумораль-
ным путем. Тормозит движения желудка:
г) пресмыкающегося.
а) гастрин; в) гистамин;
39. Происхождение крыла птицы от свободной передней конечности, б) холин; г) адреналин.
свойственной четвероногим позвоночным, наглядно иллюстриру-
ется на примере птенцов: 45. Синтез какого(-их) нейромедиатора(-ов) будет нарушен, если ла-
бораторным крысам ввести ингибитор протеолиза?
а) страуса; в) гоацина;
а) Ацетилхолина;
б) киви; г) пингвина.
б) норадреналина;
40. Использование огня и зачатки членораздельной речи впервые по- в) энкефалинов и эндорфинов;
явились у: г) дофамина;
д) g-аминомасляной кислоты.
а) австралопитеков (Australopithecus);
б) человека умелого (Homo habilis); 46. Гормоном, взаимодействующим не с мембранными, а с ядерными
в) человека прямоходящего (Homo erectus); рецепторами клетки-мишени, является:
г) человека неандертальского (Homo neanderthalensis). а) адреналин; в) гормон роста;
б) инсулин; г) трийодтиронин.
41. Возбудители кожного лейшманиоза могут передаваться чело-
веку: 47. Основное положение принципа Дейла состоит в том, что:
а) при укусе москита; а) в каждом нейроне количество «входных» синапсов равно коли-
б) при поедании непрожаренного мяса; честву «выходных»;
в) при купании в зараженных водоемах; б) во всех синаптических окончаниях нейрона выделяется один
г) воздушно-капельным путем. и тот же медиатор;
216 Областная олимпиада. 2007/2008 учебный год 11 класс 217

в) один нейрон может иметь только один аксон; в) перемещение химических веществ и органоидов вдоль аксона
г) нервный импульс возникает с наибольшей вероятностью в ак- с помощью специальных внутриклеточных белковых систем;
сонном холмике нейрона. г) система обратного поглощения медиатора из  синаптической
48. Запястно-пястный сустав I пальца руки является:
а) двуосным седловидным; 52. По теории о центрах происхождения культурных растений (Н. И. Ва-
б) двуосным эллипсовидным; вилов) родиной капусты и свеклы является центр:
в) трехосным шаровидным; а) южно-азиатский; в) средиземноморский;
г) трехосным плоским. б) восточно-азиатский; г) абиссинский.
49. На рисунке изображена соединительная ткань: 53. Голубая сорока (Cyanopica cyanus) обитает на Пиренейском полу-
а) костная; острове, а также в Восточном Китае и на Дальнем Востоке. Такая
б) хрящевая; конфигурация видового ареала объясняется:
в) жировая; а) выселением из общего центра видообразования в двух направ-
г) волокнистая. лениях;
б) миграцией с востока на запад и образованием вторичной по-
в) резким сокращением и разрывом ранее единого ареала во время
последнего оледенения (дизъюнкцией);
г) существованием видов-двойников.
54. Популяция может увеличивать численность экспоненциально:
а) когда ограничена только пища;
50. Синхронность сокращения мышечных клеток левого желудочка б) при освоении новых мест обитания;
сердца достигается за счет того, что: в) только в случае отсутствия хищников;
а) волокна проводящей системы иннервируют каждую клетку г) только в лабораторных условиях.
сердца; 55. На самочувствие человека оказывает(-ют) положительное воз­дей­
б) клетки миокарда желудочков связаны между собой электриче- ст­вие:
скими синапсами, что обеспечивает быстрый охват возбужде-
а) полное отсутствие звуков (полнейшая тишина);
нием всех клеток;
в) активность пейсмекеров желудочков синхронизируется волок- б) положительно заряженные ионы;
нами симпатического отдела вегетативной нервной системы; в) отрицательно заряженные ионы;
г) возбуждение клеток миокарда желудочков развивается в ответ г) ультра- и инфразвуки.
на наполнение желудочков кровью и поэтому возникает прак- 56. На рисунке представлен пример межвидовых отношений.
тически одновременно во всех клетках.
Наездник по отношению к тле является:
51. Аксонный транспорт — это: а) паразитом;
а) система транспортных белков в мембране аксона; б) паразитоидом;
б) проведение нервного импульса вдоль аксона от аксонного хол- в) хищником;
мика до окончания; г) жертвой.
218 Областная олимпиада. 2007/2008 учебный год 11 класс 219

57. Вид или  любая другая систематическая категория, возникшая 62. Фермент супероксиддисмутаза, участвующий в метаболизме су-
и пер­воначально эволюционирующая в данном месте, называется: пероксид-радикала, отсутствует у:
а) эндемик; а) крысы; в) всех аэробов;
б) автохтон; б) беспозвоночных; г) облигатных анаэробов.
в) реликт;
г) аллохтон. 63. В постабортивный период:
а) снижается инсулин-глюкагоновый индекс (отношение ин-
58. Человеческий инсулин, необходимый для лечения больных сахар- сулин / глюкагон в  периферической крови), увеличивается
ным диабетом, можно производить в промышленных масштабах внутриклеточная концентрация сАМР, ускоряется распад гли­-
при помощи Escherichia coli. Этого удалось добиться, применив ко­гена;
метод: б) увеличивается инсулин-глюкагоновый индекс, уменьшается вну-
а) искусственного мутагенеза; триклеточная концентрация сАМР, ускоряется распад глико­гена;
б) клеточной гибридизации; в) снижается инсулин-глюкагоновый индекс, ингибируется фос-
в) переноса одной хромосомы человека в клетки E. coli; фодиэстераза, ускоряется глюконеогенез;
г) генной инженерии. г) увеличивается инсулин-глюкагоновый индекс, увеличивается
внутриклеточная концентрация сАМР, стимулируется глюко-
59. Фиксация бактериями N2 ведет к: неогенез.
а) образованию ионов аммония и синтезу аминокислот;
б) образованию ионов аммония и выделению их клетками (аммо- 64. Рестриктазы узнают в ДНК симметричную последовательность
нификации); (палиндром). Сколько разных рестриктаз, узнающих последова-
в) образованию аммония, который затем может быть окислен тельность из шести нуклеотидов, может существовать?
до нитрата с получением энергии; а) 64; в) 1296;
г) накоплению азота в газовых вакуолях. б) 216; г) 4096.

60. В триптофановой тРНК антикодон 3'ЦЦА5'. Кодоном для трип­ 65. Биохимик получил образец растения от коллеги, который заметил,
тофана является: что у данного растения устьица днем закрыты. Биохимик устано-
а) 5'УГГ3'; вил, что радиоактивная двуокись углерода, поглощенная ночью,
б) 5'ААЦ3'; сначала находится в органических кислотах вакуоли, а в течение
в) 3'ГГТ5'; дня метка переходит в сахара, образуемые в хлоропластах. Био-
г) 5'ГТА3'; химик сделал вывод:
д) 5'ГГУ3'. а) растение фиксирует углерод по типу САМ;
б) растение является растением типа С4;
61. Белок состоит из одной полипептидной цепи, начинающейся с ти-
в) реакции фиксации углерода происходят в разных клетках;
розина, и содержит 56 аминокислот. Длина его мРНК должна быть
г) растение использует митохондрии вместо хлоропластов.
не менее, чем:
а) 152 нуклеотида; 66. При скрещивании мутантов хламидомонады, лишенных фототак-
б) 171 нуклеотид; сиса (рецессивная мутация), с хламидомонадами с нормальным
в) 112 нуклеотидов; фототаксисом половина потомства имела фототаксис, а полови-
г) 205 нуклеотидов. на — нет. Это может объясняться тем, что:
220 Областная олимпиада. 2007/2008 учебный год 11 класс 221

а) признак кодируется цитоплазматическими генами; 71. Роль вторичного мессенджера в клетках млекопитающих не вы-
б) имел место геномный импринтинг; полняет:
в) хламидомонада — гаплоидный организм; а) цАМФ; в) ион SO42–;
г) мутантные хламидомонады — гетерозиготы, а дикого типа — б) цГМФ; г) NО (оксид азота(II)).
72. β-адренэргический рецептор человека и бактериородопсин объ-
67. В Японии обнаружены две популяции черных крыс (Rattus rattus), единяет то, что они оба:
имеющих в кариотипе 38 и 42 хромосомы. Они могли возникнуть а) являются продуктами альтернативного сплайсинга одного и то­
в результате: го же гена;
б) чувствительны к повышению концентрации адреналина во вне-
а) аллопатрического видообразования;
клекточной среде;
б) автополиплоидии; в) относятся к суперсемейству белков, пронизывающих плазмати-
в) межвидовой гибридизации; ческую мембрану ровно 7 раз;
г) хромосомных аберраций. г) нет правильного ответа.
68. Перечислены процессы: 73. В результате исследования МАР-киназного каскада у дрожжей был
1 — плавление; 2 — рестрикция; 3 — отжиг; 4 — элонгация; 5 — тер- выявлен белок Ksr, способный связываться сразу с несколькими
минация; 6 — инициация. ферментами каскада. Молекулярные биологи предположили, что:
Один цикл полимеразной цепной реакции (ПЦР) последователь- а) Ksr выступает в  роли «каркаса», опосредующего взаимодей-
ствие киназ;
но включает в себя:
б) Ksr способен ингибировать весь киназный каскад сразу;
а) 3 → 1 → 4 → 2; в) 1 → 3 → 2; в) киназный каскад связан с плазмалеммой;
б) 6 → 1 → 3 → 4; г) 3 → 1 → 2 → 5. г) Ksr является протоонкогеном.

69. В тканях бифосфоглицерат (БФГ) связывается с гемоглобином, 74. Обычный способ иммунизации против бактериальных инфекций
облегчая выделение О2 из его окисленной формы, причем: включает использование живых вакцин. Живые вакцины — это:
а) 2,3-БФГ может присоединяться только к оксигемоглобину; а) низкая доза инфекционных бактерий, принимаемых для про-
б) 2,3-БФГ может присоединяться только к дезоксигемоглобину, филактики;
имеющему большую центральную полость; б) доза модифицированного штамма бактерий, сохраняющих им-
в) 2,3-БФГ может связываться только с карбоксигемоглобином; муногенность, но не патогенных;
в) низкая доза токсина, продуцируемого бактерией;
г) основная масса 2,3-БФГ синтезируется в тканях из 1,3-БФГ.
г) пробы клеток человека, который ранее был вылечен от этого
70. Бактерии могут использовать самые разнообразные реакции заболевания.
для обеспечения энергией. Укажите реакцию, которая не исполь- 75. Экспрессия генов эукариот может контролироваться:
зуется живыми организмами:
а) только на уровне транскрипции;
а) СН4 + Н2О → СО2 + Н2; б) только на уровне трансляции;
б) Н2 + NO3– + Н+ → N2 + Н2О; в) только на уровнях транскрипции и трансляции;
в) СО2 + Н2 → СН4 + Н2О; г) на уровнях транскрипции, трансляции, процессинга РНК, про-
г) FeS2 + О2 + Н2О → Fe(OH)3 + SO42– + Н+. цессинга белка.
222 Областная олимпиада. 2007/2008 учебный год 11 класс 223

76. Геномный импринтинг заключается в том, что: 81. С  помощью генеалогического метода изучали два сцепленных
а) гены, «доставшиеся» организму от матери, экспрессируются, с  X-хромосомой генетических дефекта: дальтонизм и  отсут-
а «доставшиеся» от отца — нет; ствие фермента в эритроцитах. Генеалогический анализ показал,
б) гены, «доставшиеся» организму от  отца, экспрессируются, что произошел кроссинговер при образовании гамет. Определи-
а «доставшиеся» от матери — нет; те, фенотипы каких потомков в  этой родословной являются ре-
в) в одних случаях экспрессируются гены, «доставшиеся» от ма- зультатом кроссинговера, произошедшего при образовании гамет
тери, а в других — «доставшиеся» от отца; у их матери.
г) в клетках организма экспрессируется половина генов, «достав-
шихся» от матери, а вторая половина генов — от отца.
Нормальная женщина
1 2
77. Фиксированные комплексы движений (ФКД) — важнейший ком-
Нормальный мужчина
понент поведения. Укажите утверждение, неверное по отношению
к ФКД: Мужчина-дальтоник
а) ФКД — высокостереотипное инстинктивное поведение; 3 4 5 6
б) ФКД осуществляются по  принципу триггера в  ответ на  сти- Мужчина с отсутствием фермента
мулы внешней среды и, однажды начавшись, продолжаются
Мужчина с обоими дефектами
до своего завершения;
7 8 9
в) ФКД уменьшают адаптивное значение поведения;
г) обычно ФКД вызывают один или два ключевых стимула, кото- а) 8, 9;    в) 7, 8;
рые связаны с важным объектом. б) 1;       г) 7, 9.

78. Вероятность того, что среди четырех детей гетерозиготных родите- 82. Основное отличие между гетерохроматином и эухроматином со-
лей (Аа × Аа) трое будут иметь доминантный фенотип, составляет: стоит в том, что:
а) 42 %; б) 56 %; в) 36 %; г) 60 %. а) гетерохроматин находится только около центромер; эухроматин
находится недалеко от конца хромосом;
79. После кораблекрушения 20 человек (соотношение полов 1 : 1) до- б) Х-хромосома состоит из эухроматина; гетерохроматин находит-
брались до необитаемого острова и образовали новую, полностью
ся в Y-хромосоме;
изолированную популяцию. Двое из них были носителями гена
в) гетерохроматин находится в ДНК у прокариот; эухроматин на-
цистофиброза (т. е. они были гетерозиготны по этому гену). Этот
ген в гомозиготном состоянии вызывает заболевание. Учитывая, ходится только в ДНК у эукариот;
что частота этого аллеля с ростом популяции не меняется, опреде- г) гетерохроматин не  транскрибируется, а  эухроматин может
лите, какова будет частота встречаемости цистофиброза на острове: транскрибироваться.
а) 0,0025 %; б) 0,05 %; в) 0,25 %; г) 0,5 %. 83. При скрещивании двух растений с красными цветками в потом-
80. Аллель b, сцепленный с полом, рецессивен и летален в гомозигот- стве наблюдались растения с красными и белыми цветками в со-
ном состоянии (летальный ген вызывает гибель зиготы или эмбрио- отношении 9 : 7. Окраска цветков контролируется:
на). Здоровый мужчина вступил в брак с женщиной, гетерозиготной а) одним геном, аллель красного цветения доминантен;
по данному гену. Если у этой супружеской пары будет несколько де- б) двумя генами, действующими независимо;
тей, то соотношение полов среди них (девочки : мальчики) составит: в) двумя сцепленными генами;
а) 1 : 1; б) 2 : 0; в) 3 : 1; г) 2 : 1. г) двумя комплементарными генами.
224 Областная олимпиада. 2007/2008 учебный год 11 класс 225

84. При  дигибридном скрещивании гетерозигот и  неполном доми- 89. Мужчина, у  отца которого была группа крови 0, а  у  матери  —
нировании по  одному гену количество возможных фенотипов группа крови А, имеет группу крови А. Он женился на женщине
равно: с группой крови АB. Вероятность рождения в этом браке ребенка
а) 4;  в) 8; с группой крови А:
б) 6; г) 16. а) 0,125; в) 0,5;
б) 0,375; г) 0,25.
85. При скрещивании двух линий белых мышей все мыши первого по-
коления были черными, а во втором были белые и черные мыши. 90. У человека темные волосы доминируют над светлыми, а раннее
Окраска шерсти: облысение — наследственный доминантный признак. Гены обо-
а) контролируется одним геном, аллель белой окраски доминан- их признаков находятся на аутосомах и не сцеплены. Темново-
тен; лосый мужчина с  ранним облысением женился на  блондинке
б) контролируется одним геном, аллель белой окраски рецессивен; с нормальными волосами. От этого брака родились светловоло-
в) контролируется двумя генами, аллель белой окраски доминан- сый сын с  ранним облысением и  темноволосая девочка с  нор-
тен; мальными волосами. Вероятность того, что  следующим ребен-
г) контролируется двумя генами, аллель белой окраски рецесси- ком в этой семье будет светловолосый мальчик с нормальными
вен. волосами:
86. Количество вариантов генотипов, которое получается во  вто- а) 0,125; в) 0,375;
ром поколении при  дигибридном скрещивании гетерозигот, б) 0,25; г) 0,5.
91. У  человека серый цвет глаз является доминантным признаком
а) 4; в) 8;
по отношению к голубому, а отсутствие потовых желез — рецес-
б) 6; г) 9.
сивным признаком, сцепленным с полом. У сероглазой женщины
87. Частота кроссинговера между генами А и В равна 5 %, а между с нормальными потовыми железами и сероглазого мужчины, ли-
генами В и С — 3 %. Кроссинговер между генами А и С равен: шенного потовых желез, родился голубоглазый сын, не имеющий
а) 1,66 %; в) 4 %; потовых желез. Вероятность рождения у этой пары сероглазого
б) 2 %; г) 6 %. сына с нормальными потовыми железами:
а) 1/8; в) 3/16;
88. При  скрещивании растений душистого горошка с  красны- б) 1/4; г) 1/16.
ми и белыми цветками в первом поколении все растения были
с  розовыми цветками, а  во  втором имелись растения с  белы-
Часть B (задания с несколькими правильными ответами)
ми, розовыми и  красными цветками. Скрещивание растений
с красными и розовыми цветками дало в третьем поколении рас- 1. В бактериальной клетке могут быть компоненты:
тения с:
а) пили;
а) белыми, красными и розовыми цветками, 1 : 1 : 2; б) рибосома;
б) белыми и красными цветками, 1 : 3; в) лизосома;
в) красными и розовыми цветками, 1 : 1; г) хромосома;
г) красными и розовыми цветками, 1 : 3. д) хлоросома.
226 Областная олимпиада. 2007/2008 учебный год 11 класс 227

2. Конечными продуктами бактериальных брожений могут быть кис- 8. Автогамия встречается у таких простейших, как:
лоты: а) корненожки;
а) молочная; г) серная; б) жгутиконосцы;
б) полигидроксимасляная; д) муравьиная. в) солнечники;
в) масляная; г) споровики;
д) инфузории.
3. К микроскопическим грибам относятся:
9. Способность китообразных нырять на большую глубину и долго
а) пенициллы; находиться под водой связана с:
б) сахаромицеты;
в) микромицеты; а) повышенной кислородной емкостью крови;
б) высоким содержанием в мышцах белка миоглобина;
г) планктомицеты;
в) пониженной чуствительностью дыхательного центра к накопле-
д) актиномицеты.
нию в крови углекислого газа;
4. Представителями домена (царства) Bacteria являются: г) перераспределением больших объемов крови от мышц к сосу-
дам мозга и сердечной мышцы;
а) микоплазмы;
д) «чудесной сетью» капилляров.
б) молочнокислые бактерии;
в) актиномицеты; 10. Какие события произойдут после резкого повышения давления
г) цианобактерии; у человека?
д) галобактерии. а) Активация барорецепторов;
б) торможение сосудосуживающего центра по механизму песси-
5. У ламинарии сахарной: мального торможения Введенского;
а) в оогонии образуется одна яйцеклетка; в) снижение частоты импульсов в симпатических волокнах, ин-
б) в оогонии формируется несколько яйцеклеток; нервирующих кожные артериолы;
в) в каждом антеридии образуется по одному сперматозоиду; г) рефлекторное повышение минутного объема сердца;
г) в каждом антеридии формируется несколько (много) сперма- д) повышение тонуса эфферентного симпатического нерва сердца.
11. У человека клетки крови берут начало от стволовых клеток. Ука-
д) гаметофит обоеполый.
жите утверждения, верные в отношении стволовых клеток крови:
6. К гемикриптофитам относят: а) В-клетки происходят от лимфоидных стволовых клеток;
а) чай луговой; б) Т-клетки происходят от лимфоидных стволовых клеток;
б) веронику лекарственную; в) эритропоэтин стимулирует образование эритроцитов из миело-
в) тюльпан Грейга; идных стволовых клеток;
г) клевер ползучий; г) нейтрофилы и базофилы происходят из одних и тех же стволо-
вых клеток;
д) майник двулистный.
д) лимфоидные стволовые клетки происходят из  миелоидных
7. Васкулярные меристемы образуют: стволовых клеток.
а) протофлоэму; г) метаксилему; 12. Периодические колебания численности (популяционные волны),
б) протоксилему; д) эпидерму. наблюдаемые у хищников и растительноядных животных, входя-
в) метафлоэму; щих в состав одного биоценоза:
228 Областная олимпиада. 2007/2008 учебный год 11 класс 229

а) никак не связаны друг с другом; 15. Хемолитотрофы могут использовать в качестве источника энер-
б) полностью совпадают по времени и амплитуде; гии:
в) находятся в противофазе; а) молекулярный водород;
г) у хищников всегда запаздывают по отношению к растительно- б) сульфат аммония;
ядным; в) сульфид железа;
д) у  хищников имеют меньшую амплитуду, чем  у  растительно­ г) Na-соли 3-валентного фосфора;
ядных. д) хлорид ртути (сулему).
13. Большие гнездовые колонии чистиковых птиц на севере называют 16. Роль внеклеточных полисахаридов у бактерий заключается в обес­
«птичьими базарами». Их возникновение связано с тем, что: печении:
а) не хватает удобных мест для устройства гнезд; а) прикрепления клетки к частицам субстрата;
б) гнездящиеся здесь птицы всегда охотятся большими стаями; б) образования биопленки;
в) птенцам легче выжить, так как  возвращающиеся с  добычей в) антигенных свойств;
взрослые птицы кормят не только своих птенцов, но и всех под- г) защиты от высыхания;
ряд; д) защиты от выедания животными.
г) в таких скоплениях температура среды всегда выше, поэтому
17. Микоплазмы устойчивы к пенициллину, действующему на синтез
меньше энергии тратится на обогрев птенцов;
муреина, так как они:
д) коллективная защита птенцов от хищников более эффективна.
а) не имеют клеточной стенки;
14. Окраска по Граму включает этапы: окраска клеток на мазке ген- б) синтезируют псевдомуреин;
циановым фиолетовым, последующая обработка иодом, затем в) не образуют стеролы, взаимодействие с которыми необходимо
обработка спиртом, докрашивание красителем красного цвета для активации антибиотика;
(фуксином). Различие в  окраске грамположительных и  грам­ г) содержат в клеточной стенке хитин;
д) синтезируют внеклеточные ферменты, разлагающие антибио-
отрицательных бактерий (красная окраска у  грамотрицатель-
тик до проникновения в клетку.
ных бактерий, синяя  — у  грамположительных) обусловлено
тем, что: 18. Приведенные реакции описывают определенный процесс:
а) у грамположительных бактерий комплекс генцианового фи- 1. ROOH + Me(n)+ → ROO• + Me (n – 1)+ + Н+;
олетового с  иодом за  счет толстого муреинового слоя проч- 2. R• + О2 → ROO•;
но удерживается внутри клеток, а  у  грамотрицательных  — 3. ROO• + RH → ROOH + R•;
нет; 4. ROO• + ROO• → ROOR + О2;
б) грамотрицательные бактерии не содержат муреин, поэтому свя- 5. ROO• + R• → ROOR;
зывания не происходит; 6. R• + R• → RR.
в) клеточная стенка грамотрицательных бактерий очень тонка Данный процесс:
и легко разрушается под действием спирта; а) альдольная конденсация;
г) грамотрицательные бактерии, как правило, окружены капсулой, б) перекисное окисление липидов;
непроницаемой для иода; в) тормозится липооксигеназами;
д) проявляются разные пигменты у грамположительных и грам­ г) тормозится антиоксидантами;
отрицательных бактерий. д) не протекает в тканях без патологических изменений.
230 Областная олимпиада. 2007/2008 учебный год 11 класс 231

19. За счет работы дыхательной цепи на внутренней митохондриаль- а) пируват восстанавливается до лактата;
ной мембране создается трансмембранньй градиент протонов, яв- б) пируват восстанавливается до оксалоацетата;
ляющийся по сути запасенной энергией. Энергия этого градиента в) НАДН + H+ поступает в цепь переноса электронов, взаимодей-
в живых клетках используется напрямую для: ствуя с комплексом II (сукцинатдегидрогеназой);
а) синтеза АТФ из АДФ и неорганического фосфата F0/F1-АТФ- г) отношение НАДН + Н+/ НАД+ — главный показатель, характе-
синтазным комплексом; ризующий энергетический заряд клетки;
б) синтеза пирофосфата пирофосфатазой; д) НАДН + H+ непосредственно взаимодействует с оксидоредук-
в) переноса глюкозы через митохондриальную мембрану; тазой в цепи переноса электронов.
г) переноса через митохондриальную мембрану адениловых ну- 23. цАМФ-зависимая протеинкиназа (А-киназа) мышц:
клеотидов; а) фосфорилирует большую часть молекул гликогенфосфорилазы,
д) обратного переноса электронов с  хинона на  НАД+ в  НАДН- обеспечивающей фосфоролиз гликогена;
дегидрогеназном комплексе. б) активирует и фосфорилирует киназу фосфорилазы, фосфори-
лирующую и активирующую гликогенфосфорилазу, осущест-
20. Реакционная смесь для проведения полимеразной цепной реакции
вляющую фосфоролиз гликогена;
(ПЦР) кроме исследуемой ДНК должна содержать в буферном
в) активируется комплексом Са2+-кальмодулин и ионами Са2+;
г) активирует гликогенсинтазу с помощью ее фосфорилирования;
а) ДНК-полимеразу III; д) фосфорилирует ингибитор-I, предотвращающий дефосфорили-
б) дАТФ, дГТФ, дЦТФ, дТТФ; рование регуляторных ферментов.
в) два различных праймера в больших концентрациях;
г) Taq-полимеразу; 24. В лаборатории N выведены мутантные мыши, у которых отсут-
д) ионы Mg2+. ствует киназа фосфорилазы. В обычных условиях они не отлича-
ются по двигательной активности от мышей контрольной группы,
21. Концентрация субстрата, при которой скорость реакции состав-
так же долго плавают, но при этом гликоген в их мышцах расхо-
ляет половину максимальной, обозначается KМ (константа Миха-
дуется. Охарактеризуйте особенности метаболизма и поведения
элиса). v = Vmax| S |/(KМ + | S |).
данных мышей:
Охарактеризуйте сущность процессов, зависящих от  ее вели-
а) если такую мышь напугать (например, кошкой), то вместо стре-
мительного бега у нее начнутся судороги в результате невоз-
а) чем больше KМ, тем меньше сродство фермента к субстрату;
можности срочной и интенсивной мобилизации гликогена;
б) чем меньше KМ, тем больше сродство фермента к субстрату;
б) если такую мышь напугать (например, кошкой), то ее двига-
в) если реакция обратима, то взаимодействие фермента с субстра-
тельная реакция не будет отличаться от мышей контрольной
том прямой реакции отличается от такового для субстрата об-
ратной реакции;
в) если такую мышь напугать (например, кошкой), то вместо стре-
г) реакции, носящие ярко выраженный экзеэргонический харак-
мительного бега у нее начнутся судороги в результате сердечной
тер, рассматриваются как физиологически необратимые;
д) физиологически необратимыми являются реакции, имеющие
г) при умеренных нагрузках нефосфорилированная фосфорилаза
ярко выраженный эндеэргонический характер.
может активироваться аллостерически без фосфорилиро­вания;
22. В анаэробных условиях НАДН + H+, образовавшийся в гликолизе, д) при умеренных нагрузках возможно фосфорилирование глико-
идет на восстановление пирувата. Укажите утверждение, характе- генфосфорилазы без участия киназы фосфорилазы с помощью
ризующее этот процесс: киназы С.
232 Областная олимпиада. 2007/2008 учебный год 11 класс 233

Часть С В скелетной мускулатуре человека есть нексусы

Отметьте верное суждение знаком «+», а ошибочное — знаком «–». У  взрослых людей длина тонких кишок относительно больше,
чем в раннем детском возрасте
Гаметы у мхов образуются в результате мейоза В годы с недостаточными пищевыми ресурсами корм получают
главным образом старшие птенцы, в то время как младшие («за-
Млечный сок растений — это эмульсия
пасные птенцы») погибают
Эндоспоры являются способом размножения бактерий
Все прокариоты — микроорганизмы
Гелиофиты являются экологической группой растений, сформи-
Образование метана свойственно только прокариотам, а окисле-
ровавшихся в условиях избытка солнечного света
ние — только эукариотам
Удаление плодового тела трутовика со ствола дерева избавляет
Среди бактерий очень быстро распространяется устойчивость
растение от паразита
к  антибиотикам, так как гены, обеспечивающие устойчивость,
Эндосперм покрытосеменных растений является видоизменен- находятся в плазмидах
ным женским гаметофитом
Кишечная палочка (Е. coli) — санитарно-показательный микроор-
Якобсонов орган рудиментарен или отсутствует у взрослых кито- ганизм, присутствие которого в среде рассматривают как показа-
образных, приматов и человека тель свежего фекального загрязнения, так как фекалии являются
для нее благоприятной средой и E. coli быстро в них размножается
У губоногих многоножек, стрекоз и некоторых перепончатокры-
лых вертлуг двучлениковый При активации транскрипции эукариотических генов происходит
ацетилирование гистонов
У сверчков одна и та же «песня» (стрекотание) может обеспечи-
вать встречу полов, инициировать начало спаривания, а  также Выход цитохрома С из митохондрий в цитоплазму вызывает апоп-
способствовать охране территории тоз клетки
Птицы, для которых характерен гнездовой паразитизм, не могут
воспроизводить движения, связанные с гнездованием
Металлически-синяя окраска перьев птиц обусловлена их струк- Часть D
турными особенностями
1. Сопоставьте физиологическую группу организмов в левом столб-
Киты не могут ощущать запахи, так как они не втягивают воду це и их местообитание.
через носовые отверстия и у них не развиты обонятельные доли
переднего мозга
Младших птенцов в гнезде волнистые попугаи кормят чаще, и они группа
в процессе развития догоняют старших 1. Хламидии А. Открытые сульфидные месторождения
В отличие от большинства млекопитающих для человека харак- 2. Метаногены Б. Поверхностный слой болотной воды и рас-
терно наличие семи шейных позвонков и двух затылочных мы- 3. Метанотрофы тительности
щелков 4. Сульфатредукторы B. Клетки позвоночных
5. Тионовые бактерии Г. Прибрежные морские осадки
Суставная губа придает суставу большую прочность, но умень- Д. Рубец жвачных, метантенк, установка для
шает размах движений получения биогаза
234 Областная олимпиада. 2007/2008 учебный год 11 класс 235

2. Установите соответствие между номерами анатомических частей

сердца и буквенными обозначениями на рисунке.
К 1. Двустворчатый митральный
1 A
И клапан
2. Правое предсердие 1
3. Вены легочные 2
Б 4. Трехстворчатый клапан
5. Аорта
В 6. Верхняя полая вена
Г 7. Правый желудочек 3
Ж 8. Левое предсердие 4
Д 9. Легочная артерия
10. Левый желудочек

3. Заполните пустые ячейки в схеме. Установите соответствие между

номерами и буквенными обозначениями. 5. Установите соответствие между структурами растений и их при-
Феллема знаками.

A. Перидерма Феллоген Признак Структура

Б. Первичная флоэма 1. Регулирует в  корнях горизонтальный ток A. Трахеиды
B. Лубяные волокна 2 минеральных веществ Б. Эпидерма
1 B. Эндодерма
Г. Феллобласт Вторичная 2. Органеллы, образующиеся в клетках расте-
кора Ситовидные трубки Г. Смоляной ход
Д. Феллодерма 3 ний в темноте
Д. Ксилема
Е. Вторичная флоэма Клетки-спутницы 3. Обеспечивают основную механическую Е. Лейкопласты
Ж. Трахеиды прочность древесины голосеменных расте- Ж. Этиопласты
3. Ксилема Запасающая ний З. Хлоропласты
4. Обеспечивает восходящее передвижение
4 воды по стеблю

4. На рисунке (с. 235) представлен поперечный разрез ксилемы стеб­

ля голосеменного древесного растения. Определите, какие струк-
туры (А—Е) обозначены цифрами 1—4.
А. Ранняя (весенне-летняя) древесина
Б. Ситовидная трубка
В. Поздняя (осенняя) древесина
Г. Смоляной ход
Д. Клетка-спутница
Е. Паренхима
11 класс 237

Областная олимпиада. 5. Укажите органеллу, в которой происходит превращение сахарозы,

поступающей из флоэмы, в крахмал:
2008/2009 учебный год а) вакуоль; в) пероксисома;
б) пластида; г) лизосома.
11 класс
6. Благодаря снижению фотодыхания и повышению эффективности
фотосинтеза С4-растения могут:
а) снижать степень открытости устьиц, вследствие чего уменьша-
Часть А
ется расход воды;
б) снижать степень открытости устьиц, вследствие чего снижается
1. Какая из двумембранных органелл содержит сложную систему
температура листьев;
внутренних мембран, кольцевую ДНК и рибосомы, подобные тем,
в) повышать степень открытости устьиц, вследствие чего снижа-
что встречаются у бактерий?
ется температура листьев;
а) Шероховатый эндоплазматический ретикулум; г) повышать степень открытости устьиц, вследствие чего умень-
б) гладкий эндоплазматический ретикулум; шается расход воды.
в) митохондрия;
г) пластида. 7. Цинк является необходимым элементом минерального питания
растений прежде всего потому, что он:
2. Какие структуры животных клеток напоминают плазмодесмы?
а) необходим для транскрипции;
а) Десмосомы; б) входит в состав ферментов;
б) пальцевые соединения; в) входит в состав молекулы хлорофилла;
в) нексусы. г) необходим для поддержания ионного баланса.
г) ионные каналы.
8. Какое количество воды, поглощенной злаками, может быть по-
3. Не является необходимым процессом преобразования пропласти- теряно ими при транспирации?
ды в хлоропласт: а) 10 %; в) 50 %;
а) увеличение размеров; б) 25 %; г) 90 %.
б) сборка тилакоидов;
в) синтез пигментов; 9. Укажите признаки, характерные для мхов.
г) обесцвечивание хлорофилла. 1 — имеются антеридии; 2 — имеются сперматозоиды; 3 — домини-
рует спорофит; 4 — имеются архегонии; 5 — образуется первичный
4. У растений важнейшими процессами обмена веществ являются эндосперм; 6 — имеются только придаточные корни.
фотосинтез и дыхание. Укажите верное утверждение об этих двух
а) 1, 2, 4; г) 1, 4, 6;
б) 2, 3, 5; д) 1, 2, 4, 6.
а) продукты фотосинтеза подавляют дыхание; в) 1, 4;
б) продукты фотосинтеза являются и продуктами дыхания;
в) исходные вещества фотосинтеза являются также субстратами 10. Укажите утверждение, корректное для многих растений:
дыхания; а) фитохром транспортирует электроны при фотосинтезе;
г) продукты фотосинтеза являются субстратами дыхания. б) фитохром опосредует цветение в зависимости от длины дня;
238 Областная олимпиада. 2008/2009 учебный год 11 класс 239

в) фитохром вызывает изгиб стебля вследствие избирательной 15. Укажите неверное утверждение:
миграции на одну сторону стебля; а) одним из конечных продуктов обмена веществ является диок-
г) фитохром стимулирует дедифференциацию широкопросветных сид углерода;
сосудов ксилемы в кольцесосудистой древесине. б) вторичная моча здорового человека содержит мочевую кис­лоту;
в) на процесс синтеза гликогена из аминокислот тратится энергия;
11. Созревание плодов яблони стимулирует гормон: г) в митохондриях не осуществляется пластический обмен;
а) ауксин; в) цитокинин; д) избыточное количество углеводов в  организме приводит
б) гиббереллин; г) этилен. к их превращению в жиры.

12. Укажите утверждение, неверное в отношении семядолей огород- 16. Укажите вещество, образующееся, когда в нуклеотиде фосфат свя-
зывает 2 атома кислорода рибозного остатка:
ных бобов:
а) аденозин-5'-монофосфат;
а) являются источниками энергии для прорастающего растения;
б) циклический 3', 5'-аденозинмонофосфат;
б) высыхают и опадают на стадии проростка;
в) аденозин-5'-дифосфат;
в) составляют большую часть семени; г) аденилил-гуанидиндифосфат.
г) имеют апикальную меристему.
17. В комплексе Гольджи происходит процессинг гликопротеинов:
13. Укажите утверждение, подтверждающее «донорно-акцепторную» 1 — лизосомальных мембран; 2 — плазмолеммы; 3 — цистерн гра-
концепцию транспорта сахаров по флоэме: нулярной эндоплазматической сети; 4 — цитозоля; 5 — лизосом-
а) сахара загружаются в акцепторе; ных ферментов; 6 — секреторных гранул.
б) сахара движутся от акцептора к донору по флоэме; а) 1, 2, 3, 5; г) 2, 5, 6;
в) сахара разгружаются в доноре; б) 1, 2, 4, 6; д) 2, 3, 5.
г) развивающиеся молодые листья являются акцепторами, а пол- в) 1, 2, 5, 6;
ностью развитые листья — донорами;
д) полностью развитые листья являются акцепторами, а развива- 18. Чем фитофтора отличается от хламидомонады?
ющиеся молодые листья — донорами. 1 — питается фототрофно; 2 — образует зооспоры; 3 — имеет хло-
ропласты; 4 — на спорангиеносцах располагаются лимоновидные
14. Установите соответствие между гормонами и органами (структу- зооспорангии; 5 — является паразитом; 6 — является одноклеточ-
рами), в которых они синтезируются. ным организмом; 7 — встречается в хорошо прогреваемых пресных
1. Глюкагон А. Щитовидная железа водоемах; 8 — способна развиваться на поверхности снега.
2. Меланотропин Б. Гипофиз а) 1, 4, 5; г) 4, 5;
3. Кальцитонин В. Поджелудочная железа б) 3, 4, 5, 7; д) 1, 3, 6, 7, 8;
4. Норадреналин Г. Эпифиз в) 1, 2, 4, 5; е) 2, 4, 5.
5. Тироксин Д. Мозговое вещество надпочечников
6. Мелатонин 19. Растение-хищник росянка растет на верховых болотах с недоста-
а) 1 — Б, 2 — Г, 3 — Б, 4 — В, 5 — А, 6 — Д; точным минеральным питанием. Какое из утверждений кажется
б) 1 — В, 2 — Б, 3 — А, 4 — Д, 5 — А, 6 — Г; вам наименее вероятным?
в) 1 — Г, 2 — Б, 3 — А, 4 — Г, 5 — Б, 6 — Д; а) Хищничество росянки — вторичное явление;
г) 1 — В, 2 — Г, 3 — Б, 4 — Д, 5 — Г, 6 — Г; б) возможным стимулом к формированию этого приспособления
д) 1 — Г, 2 — Б, 3 — Г, 4 — Д, 5 — Д, 6 — Б. был дефицит минерального питания в местах произрастания;
240 Областная олимпиада. 2008/2009 учебный год 11 класс 241

в) хищничество росянки — пример идиоадаптации; 23. Найдите среди перечисленных аминокислот незаменимые.
г) как растение-хищник росянка способна существовать за счет 1 — триптофан; 2 — аланин; 3 — метионин; 4 — серин; 5 — валин;
органического вещества своих жертв, поэтому в эксперименте 6 — треонин; 7 — пролин; 8 — изолейцин; 9 — аргинин; 10 — гисти-
будет расти даже в условиях полного затемнения, прекращая дин; 11 — аспарагиновая кислота.
а) 2, 4, 7, 9, 10, 11;
д) листья росянки выделяют особые вещества, которые у других
б) 1, 3, 4, 6, 7, 9;
растений (не хищников) не образуются.
в) 1, 3, 5, 6, 8, 10;
20. Лицевой нерв: г) 4, 5, 6, 7, 8, 11;
1 — смешанный; 2 — чувствительный; 3 — двигательный; 4 — вы- д) 2, 5, 7, 10;
ходит из среднего мозга; 5 — выходит из продолговатого мозга; 6 — е) 3, 6, 8, 9, 11.
является XII парой черепно-мозговых нервов; 7 — является VII 24. Редукция числа хромосом в оогенезе происходит при:
парой черепно-мозговых нервов; 8 — иннервирует мимическую а) формировании оогониев;
мускулатуру; 9 — иннервирует мускулатуру глотки; 10 — иннер- б) образовании ооцита 1-го порядка;
вирует глазные мыщцы.
в) образовании ооцита 2-го порядка;
а) 3, 5, 7, 8; г) 2, 4, 7, 9; г) образовании оотиды;
б) 1, 5, 7, 8; д) 1, 4, 7, 8, 10. д) созревании яйцеклетки.
в) 1, 5, 6, 10;
25. Как  известно, концентрация низкомолекулярных соединений
21. Общими признаками пресмыкающихся и птиц являются: в плазме крови и первичной моче одинакова. Исключением из это-
1 — наличие роговых чешуй на коже; 2 — защита эмбриона зароды- го правила являются лишь некоторые двухвалентные ионы, напри-
шевыми оболочками; 3 — постоянная температура тела; 4 — выде- мер Са2+, концентрация которых в плазме крови намного выше,
ление мочевой кислоты; 5 — трехкамерное сердце; 6 — отсутствие чем в моче (эффект Доннана). Это связано с (со):
мочевого пузыря; 7 — наличие клоаки. а) избирательностью прохождения ионов при фильтрации мочи;
а) 1, 2, 4, 7; г) 1, 2, 3, 4, 5, 7; б) поглощением ионов Са2+ клетками эндотелия сосудов;
б) 2, 4, 5, 7; д) 1, 4, 6, 7. в) связыванием ионов Са2+ с белками плазмы крови;
в) 2, 3, 5, 6; г) активностью процесса реабсорбции в  капсулах Боумана —
22. На электронной микрофотографии эукариотической клетки обна- д) всеми перечисленными выше причинами.
ружена одномембранная органелла, которая имеет сферическую
или овальную форму и диаметр от 0, 1 до 1, 5 μм. При дальнейшем 26. Известно, что  по  химической природе гормоны делят на  три
исследовании было выяснено, что она принимает участие в раз- груп­пы: пептидные (I), производные аминокислот (II) и стероид-
личных метаболических процессах, интенсивно разлагает Н2О2 ные (III). Распределите гормоны согласно их химической при-
и окисляет жирные кислоты. Что это за органелла? роде.
а) Комплекс Гольджи; 1 — адреналин; 2 — тироксин; 3 — эстроген; 4 — инсулин; 5 — трий-
б) лизосома; одтиронин; 6 — прогестерон; 7 — соматотропин; 8 — фолликуло-
в) митохондрия; стимулирующий гормон; 9 — кортизон; 10 — вазопрессин; 11 —
г) пероксисома. андроген; 12 — глюкагон.
242 Областная олимпиада. 2008/2009 учебный год 11 класс 243

I II III 30. Среди перечисленных классов к  типу Моллюски не относят-

а) 2, 5, 9, 10 а) 1, 2, 5 а) 1, 3, 7, 8
1 — Bivalvia; 2 — Cephalopoda; 3 — Сrustacea; 4 — Gastropoda; 5 —
б) 4, 7, 8, 10, 12 б) 2, 5, 8, 10 б) 2, 4, 6, 10 Monoplacophora; 6 — Amphineura.
в) 1, 3, 6, 8, 10 в) 4, 6, 7, 9 в) 3, 5, 7, 12 а) 1, 4; в) 3; д) 3, 5, 6;
б) 2; г) 2, 5; е) 1, 4, 5.
г) 3, 7, 9, 11, 12 г) 3, 4, 11, 12 г) 3, 6, 9, 11
31. Каким типом плацентации и гинецея наиболее вероятно обладали
д) 2, 6, 8, 9, 11 д) 2, 4, 7 д) 4, 8, 9, 12
первые цветковые растения?
а) Ламинальная плацентация, апокарпный гинецей;
27. Какова роль микротрубочек в клетке?
б) сутуральная плацентация, апокарпный гинецей;
а) Участвуют в построении клеточной стенки растений; в) ламинальная плацентация, паракарпный гинецей;
б) входят в состав ядерной мембраны; г) сутуральная плацентация, паракарпный гинецей;
в) участвуют в образовании веретена деления; д) ламинальная плацентация, синкарпный гинецей;
г) участвуют в образовании комплекс Гольджи. е) сутуральная плацентация, синкарпный гинецей.
28. Гемолитическая болезнь плода может возникнуть, если беремен- 32. Каким типом проводящих пучков представлена проводящая си-
ность: стема корней цветковых растений?
а) вторая; кровь плода Rh+, кровь матери Rh–; а) Амфивазальным; г) коллатеральным;
б) вторая; кровь плода Rh+, кровь матери Rh+; б) амфикрибральным; д) радиальным.
в) вторая; кровь плода Rh-, кровь матери Rh–; в) биколлатеральным;
г) первая; кровь плода Rh-, кровь матери Rh–;
д) первая; кровь плода Rh+, кровь матери Rh+. 33. Для животных с незамкнутой кровеносной системой характерны
29. Распределите животных на две группы согласно принадлежности а) имеются гемоглобин, гемоцель, лимфа;
к первичноротым (I) и вторичноротым (II). б) имеются гемоцианин, гемоцель, гемолимфа;
1 — кольчатые черви; 2 — хордовые; 3 — моллюски; 4 — морские в) имеются гемоглобин, гемолимфа, гемоцель отсутствует;
стрелки; 5 — членистоногие; 6 — круглые черви; 7 — иглокожие; г) имеются гемоцианин, гемолимфа, гемоцель отсутствует;
8 — полухордовые; 9 — плоские черви. д) имеются кровь, тканевая жидкость, хлорокруорин.

I II 34. Через 1–2 ч после полного удаления печени уменьшится кон­

центрация в крови:
а) 1, 3, 5, 6, 9 а) 1, 2, 3, 9
1 — глюкозы; 2 — аммиака; 3 — аминокислот; 4 — мочевины; 5 —
б) 1, 2, 3, 4, 7 б) 2, 6, 7, 9
билирубина; 6 — гемоглобина; 7 — креатина; 8 — альбумина; 9 —
в) 2, 4, 5, 6, 7 в) 2, 4, 7, 8 инсулина.
г) 3, 4, 6, 8, 9 г) 3, 5, 6, 9 а) 1, 3, 5, 7, 8; г) 3, 4, 5, 6, 8;
д) 4, 5, 7, 8, 9 д) 2, 3, 8, 9 б) 1, 2, 4, 5, 9; д) 3, 6, 7, 8, 9.
в) 2, 3, 6, 7, 9;
244 Областная олимпиада. 2008/2009 учебный год 11 класс 245

35. Установите правильную последовательность усложнения крове- 42. Сколекс — это:

носной системы в процессе эволюции позвоночных животных: а) отдельный членик тела цестод;
а) окунь → варан → тритон → кит; б) второе название головки тела цестод;
б) кит → тритон → варан → окунь; в) совокупность члеников тела цестод;
в) окунь → тритон → варан → кит; г) второе название шейки цестод.
г) варан → тритон → окунь → кит.
43. Головная лопасть Annelida:
36. Основным сигналом, вызывающим у птиц инстинкт перелета, яв- а) простомиум; г) рострум;
ляется: б) перистомиум; д) тельсон.
а) уменьшение корма; в) похолодание; в) пигидий;
б) исчезновение насекомых; г) уменьшение длины дня.
44. Количество предсердий у низших головоногих моллюсков:
37. Основу поведения птиц составляют: а) 1;    в) 4;    д) 8.
а) условные и безусловные рефлексы; б) 2;    г) 6;    
б) элементарная рассудочная деятельность;
в) раздражимость, инстинкты; 45. Органы выделения моллюсков:
г) перелеты. а) протонефридии; г) нефромиксии;
б) метанефридии; д) ктенидии.
38. Образование условных рефлексов у  млекопитающих связано в) почки;
с развитием:
а) мозжечка; в) продолговатого мозга; 46. Личиночная стадия пресноводных двустворчатых моллюсков:
б) коры больших полушарий; г) промежуточного мозга. а) прототрох; г) парусник;
б) трохофора; д) глохидий;
39. Среди перечисленных групп животных клоака отсутствует у: в) метатрохофора; е) мюллеровская личинка.
а) млекопитающих;
б) рептилий; 47. Полость тела членистоногих:
в) птиц; а) гастроцель; г) первичная;
г) амфибий; б) схизоцель; д) заполнена паренхимой.
д) головохордовых; в) миксоцель;
е) встречается у всех перечисленных.
48. Гиостилический череп характерен для:
40. Первые хордовые появились в: а) ланцетника и миног;
а) палеозое; в) мезозое; б) большинства хрящевых и костных рыб;
б) кайнозое; г) протерозое. в) амфибий и рептилий;
г) птиц и млекопитающих.
41. Совокупность ресничек звездчатой клетки протонефридия назы-
вается: 49. Жизненную форму терофит имеют растения, у которых:
а) цирри; в) соленоцит; а) почки возобновления находятся высоко над землей;
б) мерцательное пламя; г) пальпон. б) почки возобновления находятся в земле;
246 Областная олимпиада. 2008/2009 учебный год 11 класс 247

в) почки возобновления находятся в воде; 57. На  сокращение численности и  исчезновение некоторых видов
г) почек возобновления нет, так как переносят неблагоприятные млекопитающих в современных условиях в наименьшей степени
условия в виде семян. влияют(-ет):
а) различные виды охоты;
50. К одномембранным органоидам взрослой растительной клетки
б) завоз хищников;
в) ухудшение кормовой базы;
а) эндоплазматическая сеть; в) ядро; г) потепление климата Земли.
б) рибосомы; г) ядрышко.
58. В состав лицевого отдела черепа входят кости:
51. Вторично утолщенной целлюлозной клеточной оболочки не име- а) скуловая, височная, теменная, лобная, затылочная;
ют клетки ткани: б) парные — височная, теменная; непарные — затылочная, лобная,
а) механической; в) пробки; клиновидная, решетчатая;
б) проводящей; г) хлорофиллоносной. в) парные — слезная, верхнечелюстная; непарные — подъязычная,
52. Выберите утверждение, относящееся ко всем высшим растениям: г) парные — верхнечелюстная, скуловая; непарные — нижнече-
а) имеются архегонии; люстная, подъязычная.
б) гетероморфная смена поколений;
в) доминирует бесполое поколение; 59. Атлантозатылочный сустав относится к:
г) вегетативные органы — корень, стебель, лист; а) одноосным; в) комплексным;
д) доминирует половое поколение. б) сложным; г) комбинированным.

53. Первичное строение корня связано с отсутствием у него камбия, 60. Наибольшей преломляющей способностью обладает:
поэтому такое строение можно наблюдать только на уровне зоны а) роговица; в) хрусталик;
всасывания у: б) стекловидное тело; г) сетчатка.
а) тыквы; в) ландыша;
б) ириса; г) пшеницы. 61. Наибольшая вероятность оплодотворения яйцеклетки наблюда-
ется на:
54. Образование соплодия (производное соцветия) характерно для: а) 1–7-й день менструального цикла;
а) малины; в) ананаса; б) 8–14-й день менструального цикла;
б) земляники; г) кукурузы. в) 15–21-й день менструального цикла;
г) 21–28-й день менструального цикла.
55. Заболевания, причиной которых являются паразитические грибы,
называются: 62. Межвидовых гибридов нет между животными:
а) гельминтозы; в) лейкозы; а) хорьком и колонком; в) ослицей и конем;
б) диартрозы; г) микозы. б) тетеревом и глухарем; г) верблюдом и ослом.

56. Гермафродиты отсутствуют среди представителей типа: 63. На каждом трофическом уровне 10 % энергии:
а) Стрекающие; в) Кольчатые черви; а) поступает от Cолнца;
б) Нематоды; г) Моллюски. б) рассеивается в виде тепла;
248 Областная олимпиада. 2008/2009 учебный год 11 класс 249

в) запасается в тканях организма; в) амеба сохранится, а эритроцит погибнет;

г) выделяется с экскрементами. г) обе клетки сохранятся.

64. Выделение веществ из клетки при участии пузырьков комплекса 69. Какое из положений не соответствует истине?
Гольджи называется: а) Вирусы могут проявлять свойства живых организмов только
а) эндоцитоз; в) облегченная диффузия; в клетке;
б) активный транспорт; г) экзоцитоз. б) у вирусов отсутствует собственная система метаболизма и био­
синтеза белка;
65. Органы выделения у моллюсков: в) клеточный организм содержит две нуклеиновые кислоты  —
а) одним концом открываются в мантийную полость, другим — ДНК и РНК, а вирусы — только одну из них;
во внешнюю среду; г) геном вируса не участвует в синтезе мРНК, необходимой для об-
б) одним концом открываются в околосердечную сумку, другим — разования на рибосомах клетки-хозяина белков капсида;
д) все положения верны.
в мантийную полость;
в) одним концом открываются в заднюю кишку, другим — в ман- 70. Основным фактором, ограничивающим возрастание биомассы
тийную полость; на планете, является(-ются):
г) одним концом открываются в мантийную полость, другим — а) дефицит диоксида углерода;
в мочевой пузырь. б) дефицит воды;
в) интенсивность потока солнечной энергии;
66. Рудиментами являются:
г) биотические взаимоотношения.
1 — более сложно организованные структуры по сравнению с гомо-
логичными структурами предковых форм; 2 — структуры, утратив- 71. Цвет пигмента не имеет никакого отношения к его функции у:
шие свое основное значение в организме в процессе филогенеза; а) хлорофиллов;
3 — недоразвитые структуры, встречающиеся у некоторых особей б) фитохрома;
вида; 4 — структуры, не закладывающиеся во время зародышевого в) фикобилинов;
развития. г) гемоглобинов;
д) у всех перечисленных пигментов цвет имеет отношение к его
а) 2; г) 4;
б) 1; д) 2, 3, 4.
в) 2, 3; 72. Динофлагеллаты представляют собой группу водорослей, пигмен-
ты которых сходны с пигментами бурых водорослей. Чему подоб-
67. Опорная функция нехарактерна для соединительной ткани: ны пигменты типичных динофлагеллат?
а) костной; а) Пигментам хламидомонад;
б) хрящевой; б) пигментам вольвокса;
в) волокнистой; в) пигментам диатомовых водорослей;
г) жировой. г) пигментам красных водорослей.
68. Если амебу и эритроцит поместить в дистиллированную воду, то: 73. Какие из признаков характерны для двудольных растений?
а) обе клетки разрушатся; 1  — проводящие пучки образуют кольцо; 2  — листья простые,
б) амеба погибнет, а эритроцит сохранится; обычно без  черешка и  прилистников; 3  — стебель не  способен
250 Областная олимпиада. 2008/2009 учебный год 11 класс 251

к вторичному утолщению; 4 — имеется камбий; 5 — цветки пяти-, 77. Эволюционный процесс, связанный с ароморфозом, — это:
реже четырехчленные. а) появление цветка;
а) 2, 3, 5; в) 1, 3, 5; б) формирование колючек у кактусов;
б) 1, 4, 5; г) 2, 3, 4. в) переход некоторых растений к жизни в водной среде;
г) возникновение гетеротрофности у растений.
74. Вам нужны груши для мероприятия, которое состоится через три
дня. Груши, купленные для этой цели, еще не созрели. Каким спо- 78. Какие из абиотических факторов лимитируют распространение
жизни в океане, но обычно не лимитируют распространение жизни
собом можно наиболее эффективно ускорить процесс созревания?
на суше?
а) Положить груши в темное место;
1 — минеральные вещества; 2 — свет; 3 — азот; 4 — кислород.
б) положить груши в холодильник;
а) 1, 3; в) 1, 4;
в) разложить груши на подоконнике;
б) 2, 3; г) 2, 4.
г) положить груши в бумажный мешок вместе со спелыми ябло-
ками. 79. Центры голода и жажды в организме человека находятся в:
75. От ветви ивы отрезали часть и посадили нижним (базальным) кон- а) больших полушариях; в) промежуточном мозге;
цом в почву, а верхним (апикальным) — вверх. Корни начали про- б) продолговатом мозге; г) мозжечке.
растать из базального конца, а побеги — из апикального. Укажите 80. Некоторый рецессивный генотип (mm) встречается в популяции
верное утверждение: с частотой 16 %. Рассчитайте частоты аллелей М и m в данной по-
а) отрезанная часть побега не имеет полярности; пуляции.
б) концентрация ауксина в отрезанной части побега одинаковая а) Частота рецессивного аллеля (m) равна 4, а  доминантного
по всей длине; (М) — 16;
в) первым шагом в процессе образования корней и побегов явля- б) рецессивного 0,2, доминантного 0,8;
ется дедифференцировка тканей; в) рецессивного 0,4, доминантного 0,6;
г) для апикального конца побега характерны особые корнеобразу- г) рецессивного 0,32, доминантного 0,68;
ющие структуры, которых нет в его базальной части. д) рецессивного 0,04, доминантного 0,96;
е) рецессивного 0,8, доминантного 0,2.
76. Выберите положение(-я), верно характеризующее(-ие) фотоды-
хание. 81. На каких рисунках изображен поверхностный слой эпидермиса
1 — это совокупность процессов, при которых под действием света однодольного растения?
в растительной клетке поглощается кислород и выделяется ди-
оксид углерода; 2 — у ряда тропических растений фотодыхание
отсутствует; 3 — у некоторых растений на фотодыхание расходу-
ется до  50 % образуемого при  фотосинтезе НАДФ ⋅ Н; 4  — по-
давление фотодыхания с помощью специфических ингибиторов
могло бы увеличить продуктивность ряда сельскохозяйственных 1 2 3
растений. а) 1; в) 3; д) 2, 3.
а) 1; в) 2, 4; б) 2; г) 1, 2;
б) 1, 3; г) 1, 2, 3, 4.
252 Областная олимпиада. 2008/2009 учебный год 11 класс 253

82. Рисунок демонстрирует результаты эксперимента по изучению 2. Напишите названия терминов, соответствующие определениям.
дыхания прорастающих семян. Какое из утверждений об этом экс-
перименте является ошибочным? 1 Утрата белковой молекулой своей структур-
ной организации
а) KOH поглощает CO2, который вы-
2 Направленное ростовое движение органов
свобождается в процессе дыхания
растений, вызванное односторонним действи-
проростков; ем какого-либо раздражителя
б) уменьшенное давление в колбе вы-
3 Пространственная взаимодополняемость мо-
зывает поглощение определенного лекул или их частей, приводящая к образова-
объема воды; нию водородных связей
в) объем поглощенного кислорода ра-
4 Наука о сезонных явлениях природы, сроках
вен объему выделенного CO2; их  наступления и  причинах, определяющих
H 2O г) увеличение объема проростков эти сроки
равно объему поглощенного кис- 5 Упрощение организмов в процессе эволюции
Прорастающие семена
д) объем поглощенной воды равен
объему выделенного CO2. 3. Сопоставьте два утверждения или показателя (обозначены бук-
вами А и Б), приведенные в соответствующих столбцах таблицы,
и дайте ответ в форме: А > Б; А < Б; А = Б. Знак «>», «<» или «=»
Часть В внесите в средний столбец таблицы.

1. Отметьте верное суждение знаком «+», а ошибочное — знаком «–». А. Число аминокислотных Б. Число аминокислотных
остатков в молекуле ге- остатков в молекуле мио-
Строение парных плавников кистеперых рыб гомологично строе- моглобина глобина
нию конечностей у наземных позвоночных животных А. Число нуклеотидных Б. Число нуклеотидных
Прудовики, живущие в пресных водоемах, являются хорошими звеньев в молекуле РНК звеньев в молекуле ДНК
фильтраторами с относительной молеку- с относительной молеку-
лярной массой 5 · 105 лярной массой 5 · 105
Первичные зрительные центры расположены в затылочной доле А. Скорость обновления Б. Скорость обновления бел-
коры больших полушарий белков плазмы крови че- ков печени человека
Основные запасы воды в клетках растений находятся в пластидах ловека
А. Концентрация мочевины Б. Концентрация мочевины
Среди хордовых есть виды, ведущие сидячий образ жизни
во вторичной моче в первичной моче
АТФ может играть роль нейромедиатора А. Число аминокислотных Б. Число кодонов в молекуле
остатков в молекуле ри- мРНК, кодирующей син-
Как и рибосомы, митохондрии эукариотов крупнее, чем у прока-
бонуклеазы тез рибонуклеазы
риотов, и имеют больший коэффициент осаждения
А. Отношение размеров Б. Отношение размеров ядра
Получившаяся в результате митоза клетка не может сразу, без пе- ядра к цитоплазме у спер- к цитоплазме у яйцеклетки
риода интерфазы, поделиться еще раз матозоида
254 Областная олимпиада. 2008/2009 учебный год 11 класс 255

А. Поверхность корневой Б. Поверхность корневой си- Производ­ Гомопо­ Гетеро­

Альдо­ Альдо­ Альдо­ Дисаха­
системы томата при есте- стемы томата того же воз- ные моноса­ лисаха­ полиса­
триозы пентозы гексозы риды
ственном развитии раста, развившейся после харидов риды хариды
пикировки (условия вы-
ращивания одинаковые)
А. Количество шейных по- Б. Количество шейных по-
звонков у вороны звонков у страуса 7. На рисунке показано распределение концентраций пяти гипоте-
А. Влияние альдостерона Б. Влияние кортизола на об- тических белков в эмбрионе Drosophila. Передний конец эмбриона
на обмен углеводов мен углеводов показан в левой части рисунка, а задний — в правой части. Продук-
А. Количество икринок, от- Б. Количество икринок, от- ты генов A и B активируют экспрессию гена Q, а продукты генов C
ложенных за один нерест ложенных за один нерест и D — репрессируют.
щукой лещом

Концентрация белка
4. Укажите, в какой последовательности перечисленные фермен- а
ты осуществляют реакции негидролитического распада глюкозы d
в ходе гликолиза:
1 — альдолаза; 2 — фосфофруктокиназа; 3 — лактатдегидрогеназа; b
4 — гексокиназа (или глюкокиназа); 5 — фосфоглицераткиназа;
6 — фосфоглицеромутаза. 

5. Отметьте в таблице верные в отношении липидов характеристики c

знаком «+», а неверные — знаком «–».
1 — в маслах, как правило, присутствует больше ненасыщенных 1 2 3 4 5
жирных кислот, чем насыщенных; 2 — к стероидам относятся гор-
моны коры надпочечников; 3 — ацилглицерины рыб, обитающих Передний конец Тело эмбриона Задний конец
в теплых экваториальных водах, содержат больше ненасыщенных
жирных кислот, чем ацилглицерины рыб арктических морей; 4 — Если один из генов A, B, C или D будет мутирован, как изменится
многие липиды при окислении дают в среднем в 2 раза больше концентрация белка q? Выберите правильный ответ из предло-
энергии, чем белки; 5 — липиды подкожной жировой клетчатки женных вариантов и впишите его в таблицу.
выполняют функцию теплоизоляции, так как  обладают высо-
кой теплопроводностью; 6 — температура плавления липидов 1 — Продолжится к переднему концу эмбриона;
тем ниже, чем выше в них доля насыщенных жирных кислот. 2 — продолжится к заднему концу эмбриона;
3 — без изменений;
1 2 3 4 5 6 4 — уменьшенная экспрессия.
Характер экспрессии гена Q

6. Впишите в таблицу номера перечисленных углеводов в соответ- Мутантный A

ствии с их местом в современной классификации. Мутантный B
1 — мальтоза; 2 — фруктозо-1,6-дифосфат; 3 — глицеральдегид; Мутантный C
4 — гликоген; 5 — гепарин; 6 — галактоза; 7 — хитин; 8 — лактоза;
Мутантный D
9 — сорбит; 10 — дезоксирибоза.
256 Областная олимпиада. 2008/2009 учебный год 11 класс 257

8. У бактерий Bacillus subtilis получены ауксотрофные мутанты, нуж- 9. Установите соответствие.

дающиеся в аминокислотах — аспарагине, треонине и метионине.
Характеристики мутантов приведены в таблице. 1) а) пуриновое основание 1) адениловая кислота
б) пиримидиновое основание 2) РНК
в) нуклеозид 3) аденозин
Требуется для роста
г) нуклеотид 4) аденин
д) рибонуклеиновая кислота 5) урацил


вая кислота



метаболит а б в г д

aspA + – – – – – Фумаровая кислота 2) а) родопсин 1) рибонуклеопротеин, содержащий 6 % РНК

metA – – – – + + Гомосерин б) вирус табач- 2) белок с Mg-содержащей простетической груп-
metH – – – – – + Гомоцистеин ной мозаики пой
в) ферритин 3) хромопротеин, содержащий ретиналь
thrC – – – + – – Гомосеринфосфат
г) хлорофилл 4) белок — депо железа в организме
thrB – – + + – – Гомосерин д) глюкагон 5) полипептид, регулятор углеводного обмена
thrA – + + + – – Аспарагиновая кислота
а б в г д
«+» — рост на минимальной среде с добавлением соответствующего метаболита;
«–» — отсутствие роста.

Изучите схему биосинтеза аминокислот и их предшественников

и укажите в пустых квадратах схемы гены, которые соответствуют 3) а) ковалентные связи 1) осуществляют связь между белко-
каждому из этапов. Для обозначения генов пользуйтесь указанны- б) ионные связи и гидро- вой и небелковой составляющими
ми в таблице кодами. фобные взаимодей- в молекулах сывороточных липо-
ствия протеинов
1 2 3 4 5 6 в) внутримолекулярные 2) соединяют аминокислоты в моле-
thrA thrB thrC aspA metA metH водородные связи кулах белков
г) межмолекулярные во- 3) принимают участие в  поддержа-
Фумаровая кислота дородные связи нии складчатой β-структуры по-
липептидных цепей
4) поддерживают α-спиральную кон-
Аспарагиновая кислота фигурацию полипептидной цепи

а б в г

Гомоцистеин Гомосеринфосфат
10. Установите соответствие между группой, к которой относится ве-
щество, и его функцией.
Метионин Треонин
258 Областная олимпиада. 2008/2009 учебный год

Группа веществ Функция

A. Белки 1. Защищают организм от переохлаждения
Б. Липиды 2. Защищают организм от чужеродных веществ
3. Являются регуляторными веществами
4. Обеспечивают организм метаболической водой
5. Осуществляют транспорт веществ


11. Найдите среди перечисленных утверждений те, которые касаются

капилляров, артерий и вен. Результаты внесите в таблицу, обозна-
чив знаком «+» верные утверждения, знаком «–» — неверные.
1 — эти сосуды являются элементами проводящей системы; 2 — эти
сосуды имеют хотя бы один мышечный слой; 3 — эти сосуды по на-
правлению движения крови разветвляются на все более мелкие;
4 — в этих сосудах практически отсутствует пульсовое давление
крови; 5 — эти сосуды имеют самый большой суммарный просвет;
6 — у этих сосудов средний слой тонкий или вообще отсутствует;
7 — эти сосуды по направлению движения крови собираются во все
более широкие и крупные; 8 — эти сосуды не содержат полулунных
клапанов; 9 — в этих сосудах движению крови способствует работа
скелетной мускулатуры; 10 — в этих сосудах происходит газооб-
мен; 11 — эти сосуды несут в печень кровь, насыщенную кислоро-
дом; 12 — в этих сосудах эластические волокна немногочисленны
или вовсе отсутствуют; 13 — в мембранах клеток этих сосудов в не-
которых органах имеются мельчайшие отверстия или поры.
1 2 3 4 5 6 7 8 9 10 11 12 13
11 класс 261

Республиканская олимпиада. Норма Цистофиброз

2003/2004 учебный год G C A T G C A T

11 класс
Часть А 10
1. Какая из перечисленных точковых мутаций не приведет к измене- 8
нию аминокислотного состава полипептида? 7
а) UCA UAA; 6
б) UCA CCA; 5
в) UCA UCU; 4
г) UCA ACA; 3
д) UCA GCA. 2
2. Основное отличие между гетерохроматином и эухроматином со-
стоит в том, что: Предположим, что 5'-конец секвенированного участка начинается
а) гетерохроматин находится только около центромер; эухроматин слева и первым нуклеотидом является номер 1. Определите тип
находится недалеко от конца хромосом; мутации, которая вызвала заболевание цистофиброзом и найдите
б) Х-хромосома состоит из эухроматина; гетерохроматин находит- правильный ответ.
ся в Y-хромосоме; 1 — нет никакой гомологии между нормальным геном ЦФ и му-
в) гетерохроматин находится в ДНК у прокариот; эухроматин на- тантным геном; 2 — первые восемь нуклеотидов в мутантном гене
ходится только в ДНК у эукариот; такие же, как и в нормальном гене; 3 — пять нуклеотидов в по-
г) гетерохроматин не транскрибируется, а эухроматин часто транс- ложениях 11—15 нормального гена такие же, как в положениях
крибируется. 8—12 мутантного гена; 4 — мутантный ген имеет 3-нуклеотидную
3. Мутантный ген цистофиброза (ЦФ) был изолирован из клеток вставку; 5 — мутантный ген имеет 4-нуклеотидную делецию; 6 —
больного человека, и затем проведено его секвенирование (опре- мутантный ген имеет 4-нуклеотидную вставку; 7 — мутантный ген
деление последовательности нуклеотидов). Аналогичным обра- имеет 3-нуклеотидную делецию.
зом был изолирован нормальный ген (ЦФ) из клеток здорового а) 1, 2, 4, 6; в) 2, 3, 7; д) 2, 3, 6.
человека. Картина электофоретического разделения нуклеотидов б) 2, 3, 5; г) 1, 5, 7;
определенного фрагмента мутантного гена и  нормального гена
представлена на рисунке (с. 261). Сравнение двух образцов позво- 4. Какой из  четырех участков (А, В, C или  D) нитей ДНК может
ляет заметить, что нуклеотидная последовательность мутантного служить в качестве матрицы для синтеза мРНК, содержащей ини-
гена ЦФ у больного цистофиброзом отличается от нормального циирующий кодон для начала трансляции белка, длина которого
гена здорового человека. должна быть более четырех аминокислот?
262 Республиканская олимпиада. 2003/2004 учебный год 11 класс 263

A B 9. Полипептидные цепи синтезируются на рибосомах, находящихся:

а) в цитозоле, и модифицируются в комплексе Гольджи;
5' . . . . . . A G A T G C C C T A A G G T C A T T G T T . . . . 3'
б) на  мембране эндоплазматической сети, и  модифицируются
3' . . . . . . T C T A C G G G A T T C C A G T A A C A A . . . .5 '
в комплексе Гольджи;
D C в) в цитозоле, и модифицируются в люмене лизосомы;
г) в цитозоле, и модифицируются в цитозоле.
а) A; б) B; в) C; г) D.

5. Какой полипептид будет транскрибироваться с мРНК следующего 10. Фиксация бактериями N2 ведет к:
вида: а) образованию ионов аммония и синтезу аминокислот;
AUGUUCUUCUUCUUCUUCUUCUAA? б) образованию ионов аммония и выделению их клетками (аммо-
а) Met-Phe-Phe-Phe-Phe-Phe-Phe-Leu;
в) образованию аммония, который затем может быть окислен
б) Met-Ser-Ser-Ser-Ser-Ser-Ser;
до нитрата с получением энергии;
в) Met-Leu-Leu-Leu-Leu-Leu-Leu;
г) накоплению азота в газовых вакуолях.
г) Met-Phe-Phe-Phe-Phe-Phe-Phe;
д) Met-Phe- Met-Phe- Met-Phe-Ser-Leu. 11. Для триптофановой тРНК антикодоном является CCA. Кодоном
6. Реакционная смесь для проведения полимеразной цепной реакции для триптофана является:
(ПЦР) кроме исследуемой ДНК в буферном растворе должна со- а) UGG; в) GGT;
держать: б) ААC; г) GGC.
1 — ДНК-полимеразу III; 2 — dАТP, dGТP, dCТP, dТТP; 3 — два раз-
12. Белок состоит из одной полипептидной цепи, начинающейся с ти-
личных праймера в больших концентрациях; 4 — Taq-полимеразу;
розина, и содержит 56 аминокислот. Длина его мРНК может быть:
5 — ионы Mg2+.
а) 152 нуклеотида; в) 112 нуклеотидов;
а) 1, 2, 3, 4, 5; г) 1, 2, 3, 4;
б) 158 нуклеотидов; г) 205 нуклеотидов.
б) 1, 2, 3, 5; д) 2, 4.
в) 2, 3, 4, 5; 13. Если на мембране опухолевых клеток присутствуют антигены ги-
7. Перечислены процессы: 1) плавление; 2) рестрикция; 3) отжиг; стосовместимости MHCI, то эти клетки будут хуже уничтожаться:
4) элонгация; 5) терминация; 6) инициация. Один цикл ПЦР по- а) Т-киллерами;
следовательно включает: б) активированными макрофагами;
а) 3 → 1 → 4 → 2; в) 1 → 3 → 2; в) факторами некроза опухолей (TNF);
б) 1 → 3 → 4; г) 3 → 1 → 2 → 5. г) натуральными киллерами (NK-клетками).

8. Человеческий инсулин, необходимый для лечения больных са- 14. Из перечисленных веществ роль вторичного мессенджера в клет-
харным диабетом, сейчас производят в промышленных масштабах ках млекопитающих не выполняет:
при помощи бактерии Escherichia coli. Этого удалось добиться, при- а) цАМФ;
менив метод: б) цГМФ;
а) искусственного мутагенеза; в) клонирования; в) ион SO42–;
б) клеточной гибридизации; г) генной инженерии. г) NO (оксид азота(II)).
264 Республиканская олимпиада. 2003/2004 учебный год 11 класс 265

15. β-адренэргический рецептор человека и бактериородопсин объ- (например, красным) цвета. Различие в окраске грамположи-
единяет то, что они оба: тельных и грамотрицательных бактерий (отсутствие окрашива-
а) являются продуктами альтернативного сплайсинга одного ния у грамотрицательных бактерий) обусловлено тем, что:
и того же гена; а) у грамположительных бактерий комплекс генцианового фио-
б) чувствительны к  повышению концентрации адреналина летового с иодом не вымывается из клетки спиртом, посколь-
во внеклекточной среде; ку муреиновый каркас достаточно толстый, а у грамотрица-
в) относятся к суперсемейству белков, пронизывающих плазма- тельных — вымывается;
тическую мембрану 7 раз; б) грамотрицательные бактерии не содержат муреин, и поэтому
г) нет верного ответа. связывания не происходит;
в) клеточная стенка грамотрицательных бактерий очень тонка
16. Основное различие между гуморальным и клеточным иммуни- и легко разрушается под действием спирта;
тетом состоит в том, что: г) грамотрицательные бактерии, как правило, окружены капсу-
а) гуморальный иммунитет неспецифичен, а клеточный проявля- лой, непроницаемой для иода;
ет специфичность в отношении каждого определенного анти- д) у грамположительных и грамотрицательных бактерий про-
гена; являются разные пигменты.
б) только в гуморальном иммунитете участвуют лимфоциты;
в) гуморальный иммунитет не  может функционировать само- 19. Экспрессия генов эукариот может контролироваться:
стоятельно, а его наступление всегда вызывается клеточным а) только на уровне транскрипции;
иммунитетом; б) только на уровне трансляции;
г) гуморальный иммунитет действует против антигенов, находя- в) только на уровнях транскрипции и трансляции;
щихся во внеклеточном пространстве и крови, а клеточный — г) на  уровнях транскрипции, трансляции, процессинга РНК
против тех, которые проникли в клетку; и белка.
д) только гуморальный иммунитет обеспечивает иммунологиче-
скую память. 20. Донором электрона при  фотосинтезе у  бактерий могут(-жет)
17. Один из способов иммунизации включает использование живых 1  — вода; 2  — сероводород; 3  — аммоний; 4  — молекулярный
вакцин. Живые вакцины — это: водород; 5 — двухвалентное железо.
а) низкие дозы патогенных бактерий, применяемых для профи-
а) 2, 5; г) 1, 2;
б) 1, 3; д) 4;
б) дозы модифицированного штамма бактерий, сохраняющих
в) 1, 2, 4, 5; е) 1, 2, 3, 4, 5.
иммуногенность, но не патогенность;
в) низкие дозы токсина, продуцируемого бактериями; 21. Двигательная единица — это:
г) препарат клеток человека, который ранее был вылечен от этой а) совокупность мышечных волокон одной мышцы;
болезни. б) совокупность мышечных волокон, иннервируемых одним мо-
18. Окраска по Граму включает этапы: окраска клеток на мазке ген- тонейроном;
циановым фиолетовым, последующая обработка иодом, затем в) совокупность мотонейронов, иннервирующих одну мышцу;
обработка спиртом, докрашивание красителем альтернативного г) совокупность мышц-синергистов.
266 Республиканская олимпиада. 2003/2004 учебный год 11 класс 267

22. Хемолитотрофы могут использовать в качестве источника энер- 28. В отличие от всех покрытосеменных у голосеменных отсутству-
гии: ет(-ют):
1 — молекулярный водород; 2 — сульфат аммония; 3 — сульфид а) камбий; в) перикарпий;
железа; 4 — Na-соли 3-валентного фосфора; 5 — хлорид ртути (су- б) вторичная ксилема; г) семядоли.
а) 1, 2, 5; г) 1, 2, 3; 29. Биохимик получил образец растения от коллеги, который заметил,
б) 3; д) 1, 2, 4, 5. что у данного растения устьица днем закрыты. Биохимик устано-
в) 1, 2, 3, 4, 5; вил, что радиоактивная двуокись углерода, поглощенная ночью,
сначала находится в органических кислотах вакуоли, а в течение
23. Микоплазмы устойчивы к пенициллину, действующему на синтез дня метка переходит в сахара, образуемые в хлоропластах. Био-
муреина, так как они: химик сделал вывод, что:
а) не имеют клеточной стенки; а) растение фиксирует углерод по САМ-пути;
б) синтезируют псевдомуреин; б) растение имеет С4-путь;
в) не образуют стеролы, взаимодействие с которыми необходимо в) реакции фиксации углерода происходят в разных клетках;
для активации антибиотика; г) растение использует митохондрии вместо хлоропластов.
г) содержат в клеточной стенке хитин;
д) синтезируют внеклеточные ферменты, разлагающие антибио- 30. У ламинарии:
тик до проникновения в клетку. 1 — в оогонии образуется одна яйцеклетка; 2 — в оогонии форми-
24. Общим промежуточным продуктом при превращении глицерина руется несколько яйцеклеток; 3 — в каждом антеридии образуется
в глюкозу и лактата в глюкозу является: по одному сперматозоиду; 4 — в каждом антеридии формируется
несколько (много) сперматозоидов; 5 — гаметофит обоеполый.
а) пируват; г) глюкозо-6-фосфат;
б) оксалоацетат; д) аспартат. а) 2, 4; г) 1, 3, 5;
в) малат; б) 1, 3; д) 1, 4.
в) 1, 5;
25. Среди семенных растений сперматозоиды образуются у:
а) гинкго двулопастного; в) орхидеи; 31. К гемикриптофиту(-ам) относят:
б) пальмы финиковой; г) лиственницы. 1 — чай луговой; 2 — веронику лекарственную; 3 — тюльпан Грейга;
4 — клевер ползучий; 5 — майник двулистный.
26. Укажите последовательность расположения отделов головного
мозга, начиная от спинного мозга. а) 2; г) 3;
1 — мост и мозжечок; 2 — большие полушария; 3 — продолговатый б) 1, 2, 3, 4, 5; д) 1, 2, 4;
мозг; 4 — промежуточный мозг; 5 — средний мозг. в) 1, 2, 3, 4; е) 3, 4.

а) 1 → 5 → 4 → 3 → 2; в) 3 → 1 → 5 → 4 → 2; 32. Васкулярные меристемы образуют:

б) 2 → 3 → 1 → 4 → 5; г) 4 → 1 → 5 → 4 → 2. 1 — протофлоэму; 2 — протоксилему; 3 — метафлоэму; 4 — мета­
27. В составе чего преганглионарные волокна выходят из ЦНС? Най- ксилему; 5 — эпидерму.
дите неверное утверждение: а) 1, 2, 3, 4, 5; г) 3, 4;
а) задних корешков; в) передних корешков; б) 1, 2, 3, 4; д) 5.
б) некоторых черепных нервов; г) б, в. в) 1, 2;
268 Республиканская олимпиада. 2003/2004 учебный год 11 класс 269

33. Для клеток большинства высших растений характерны: 39. Наличие устьичных комплексов характерно для:
1 — клеточная стенка; 2 — вакуоль с клеточным соком; 3 — хрома- а) ризодермы; г) эпидермы;
тофоры; 4 — движение цитоплазмы; 5 — пластиды; 6 — пульсиру- б) ритидома; д) эндодермы;
ющая вакуоль. в) эпиблемы; е) перидермы.
а) 1, 3, 4, 6; в) 1, 2, 4, 5; 40. В корне первичного строения различают:
б) 2, 4, 5, 6; г) 1, 2, 5, 6. 1 — первичные сердцевинные лучи; 2 — ризодерму; 3 — крахмало-
34. Какие вещества входят в состав первичной клеточной стенки рас- носное влагалище; 4 — стель; 5 — первичную кору; 6 — сердцевину;
тений? 7 — периблему; 8 — колленхиму.
1 — пектин; 2 — гемицеллюлоза; 3 — лигнин; 4 — хитин; 5 — висцин; а) 1, 6, 7; б) 2, 4, 8; в) 2, 4, 5; г) 3, 6, 8.
6 — суберин; 7 — муреин; 8 — целлюлоза. 41. Появление годичных колец связано с функционированием:
а) 1, 2, 8; в) 1, 4, 5; а) перицикла; г) колленхимы;
б) 3, 5, 7; г) 5, 7, 8. б) паренхимы; д) прокамбия.
в) камбия;
35. Какое вещество вызывает одревеснение клеточной стенки?
а) Суберин; 42. Охарактеризуйте особенности трахеид.
б) алантоин; 1 — живые клетки; 2 — конечные стенки скошены; 3 — поры распо-
в) лигнин; ложены на вертикальных стенках; 4 — клеточная оболочка вторич-
г) кутин. ная; 5 — клеточная оболочка первичная; 6 — горизонтальные пере-
городки между трахеидами отсутствуют; 7 — клетки мертвые; 8 —
36. Корневой чехлик образуется из: выполняют водопроводящую функцию; 9 — проводят продукты
а) дерматогена; ассимиляции; 10 — клеточная оболочка одревесневшая; 11 — кле-
б) периблемы; точная оболочка опробковевшая; 12 — клетки прозенхимного типа.
в) калиптрогена; а) 2, 3, 4, 7, 8, 10, 12;
г) перидермы. б) 1, 3, 5, 6, 9, 11, 12;
37. К пластидам относятся: в) 3, 5, 6, 8, 9, 11, 12.
1 — хромопласт; 2 — лейкопласт; 3 — хлоропласт; 4 — протопласт; 43. Первичная кора корня подразделяется на:
5 — олеопласт; 6 — амилопласт; 7 — тонопласт; 8 — фрагмопласт; 1 — экзодерму; 2 — ризодерму; 3 — перидерму; 4 — паренхиму пер-
9 — протеопласт. вичной коры; 5 — периблему; 6 — эндодерму.
а) 1, 2, 4, 5, 6, 7; в) 1, 3, 4, 6, 8, 9; а) 2, 3, 4; б) 1, 4, 6; в) 3, 4, 5; г) 2, 5, 6.
б) 1, 2, 3, 5, 6, 9; г) 4, 5, 6, 7, 8, 9.
44. Отметьте вариант, в котором представлены только метаморфозы
38. К первичным тканям относятся: корня.
1 — феллоген; 2 — перидерма; 3 — колленхима; 4 — эпиблема; 5 — 1 — клубень; 2 — корневые шишки; 3 — корневище; 4 — лукови-
прокамбий; 6 — камбий; 7 — ритидом; 8 — метафлоэма; 9 — про- ца; 5 — корнеплод; 6 — корень-присоска; 7 — дыхательные корни;
токсилема. 8 — фотосинтезирующие корни; 9 — колючки; 10 — филлокладии.
а) 1, 3, 5, 6, 9; в) 2, 4, 6, 7, 9. а) 1, 4, 5, 7; в) 2, 6, 7, 8;
б) 3, 4, 5, 8, 9; б) 2, 4, 7, 9; г) 1, 3, 6, 10.
270 Республиканская олимпиада. 2003/2004 учебный год 11 класс 271

45. Какой тип ветвления характерен для ботрических (неопределен- 51. Клетки колонии вольволькса имеют:
ных) соцветий? а) гаплоидный набор хромосом;
а) Дихотомическое; б) диплоидный набор хромосом;
б) симподиальное; в) полиплоидный набор хромосом;
в) моноподиальное; г) тетраплоидный набор хромосом;
г) ложнодихотомическое. д) триплоидный набор хромосом.

46. Тычинка представляет собой: 52. Раковина у пресноводной раковинной амебы арцеллы (Arcella sp.)
состоит из:
а) видоизмененный микроспорофилл с микроспорангиями;
а) хитиноидного органического вещества;
б) мужской половой орган высших растений;
б) карбоната кальция;
в) метаморфизированный вегетативный лист;
в) кремнезема;
г) мегаспорофилл с мегаспорангиями.
г) песчинок кварца;
47. Положение завязи в цветке определяют по отношению ее к: д) органического вещества, пропитанного CaCO3.
а) цветоножке; в) околоцветнику; 53. Свободноплавающие планктонные личинки имеются у таких бен-
б) тычинкам; г) цветоложу. тосных морских организмов, как:
а) нематоды, иглокожие, многощетинковые черви;
48. Какие типы полового процесса характерны для высших растений?
б) коловратки, коралловые полипы, иглокожие;
1 — изогамия; 2 — хологамия; 3 — оогамия; 4 — гетерогамия; 5 — в) оболочники, иглокожие, коралловые полипы;
сифоногамия; 6 — коньюгация. г) двустворчатые моллюски, оболочники, нематоды.
а) 1, 4, 5; б) 2, 4; в) 6; г) 1, 3, 6.
54. К животным с билатеральным типом симметрии относятся:
49. У каких животных впервые в процессе эмбрионального развития а) аскарида, актиния, майский жук;
появляется группа клеток (крестообразная группа клеток), рас- б) губка-бадяга, дождевой червь, устрица;
положенная между эктодермой и энтодермой? в) каракатица, луна-рыба, морской еж;
а) У шестилучевых кораллов; г) краб, ланцетник, нереис.
б) у восьмилучевых кораллов; 55. Органы слуха (тимпанальные органы) у цикад расположены:
в) у гребневиков;
а) на голенях передних ног;
г) у бескишечных турбеллярий;
б) у основания крыльев;
д) у мюллеровской личинки. в) по бокам первого членика брюшка;
50. У какого из видов одноклеточных в цитоплазме расположен аксо- г) по бокам головы.
стиль (опорный тяж)? 56. Некоторые виды мух-журчалок имеют такую же черно-желтую
а) У опалины лягушечьей; полосатую окраску тела, как и осы. Это проявление:
б) у трипаносомы гамбийской; а) бейтсовской мимикрии;
в) у пресноводного солнечника; б) мюллеровской мимикрии;
г) у трихомонады вагинальной; в) дивергентного сходства;
д) у лейшмании тропической. г) случайного сходства.
272 Республиканская олимпиада. 2003/2004 учебный год 11 класс 273

57. Синхронность сокращения мышечных клеток левого желудочка а) 2, 3, 4; в) 5; д) 2, 4.

сердца достигается за счет того, что: б) 1, 3, 5; г) 1, 5;
а) волокна проводящей системы иннервируют каждую клетку
63. Какова роль ионов кальция в механизме сокращения поперечно-
полосатого мышечного волокна?
б) клетки миокарда желудочков связаны между собой электриче-
скими синапсами, что обеспечивает быстрый охват возбужде- а) Обеспечивают развитие потенциала действия;
нием всех клеток; б) изменяют конформацию белка миозина;
в) активность пейсмекеров желудочков синхронизируется волок- в) изменяют конформацию белка тропонина;
нами симпатического отдела вегетативной нервной системы; г) обеспечивают связывание АТФ с актин-миозиновым комплек-
г) возбуждение клеток миокарда желудочков развивается в ответ сом.
на наполнение желудочков кровью и поэтому возникает прак- 64. Некоторые амфифильные вещества могут способствовать перене-
тически одновременно во всех клетках. сению ионов Н+ через внутреннюю мембрану митохондрий, минуя
58. Челюсти для захвата пищи в ходе эволюции хордовых впервые Н+-АТФ-синтазу и уничтожая таким образом Δμ Н+. Охарактери-
появились у: зуйте данные соединения.
а) миног; в) хрящевых рыб; 1 — эти вещества названы разобщителями; 2 — данный процесс на-
б) миксин; г) костных рыб. зван дыхательным контролем; 3 — в этом процессе могут участво-
вать стеариновая и пальмитиновая жирные кислоты; 4 — при этом
59. Прямые предки китообразных и ластоногих: коэффициент Р/О снижается, большая часть энергии выделяется
а) хоботные; в) насекомоядные; в виде квантов света; 5 — в этом процессе может принимать уча-
б) грызуны; г) хищные. стие динитрофенол.
а) 1, 5; в) 3, 5; д) 1, 2, 3, 4.
60. Одним из основных отличий зайцеобразных от грызунов явля- б) 2, 4, 5; г) 3, 4;
а) отсутствие когтей на задних конечностях; 65. Приведенные реакции описывают определенный процесс:
б) наличие второй пары резцов на верхней челюсти; 1. ROOH + Me (n)+ → ROO• + Me (n –1)+ + H+;
в) наличие подшерстка; 2. R• + O2 → ROO•;
г) отсутствие желез внешней секреции. 3. ROO• + RH → ROOH + R•;
4. ROO• + ROO• → ROOR + O2;
61. Происхождение крыла птицы от свободной передней конечности, 5. ROO• + R• → ROOR;
свойственной четвероногим позвоночным, наглядно иллюстриру- 6. R• + R• → RR.
ется на примере птенцов:
Данный процесс:
а) страуса; в) гоацина;
б) киви; г) пингвина. 1 — называется альдольной конденсацией; 2 — называется пере-
кисным окислением липидов; 3 — тормозится липооксигеназами;
62. В состав гиппарионовой (или чикермийской) фауны входили сле- 4  — тормозится антиоксидантами; 5  — не  протекает в  тканях
дующие виды животных: без патологических изменений.
1 — пещерный медведь; 2 — носорог; 3 — мастодонт; 4 — жираф; а) 2, 4; в) 3; д) 5;
5 — овцебык. б) 1, 3; г) 1, 2, 3, 4; е) 3.
274 Республиканская олимпиада. 2003/2004 учебный год 11 класс 275

66. За счет работы дыхательной цепи на внутренней митохондриаль- 1 — пируват при этом восстанавливается до лактата; 2 — пируват
ной мембране создается трансмембранный градиент протонов, яв- при этом восстанавливается до оксалоацетата; 3 — НAДН + H+ по-
ляющийся по сути запасенной энергией. Энергия этого градиента ступает в цепь переноса электронов, взаимодействуя с комплексом
в живых клетках используется напрямую для: II (сукцинатдегидрогеназой); 4 — отношение НAДН + H+/ НАД+ —
главный показатель, характеризующий энергетический заряд
1 — синтеза АТФ из АДФ и неорганического фосфата F0/F1-АТФ-
клетки; 5 — НAДН + H+ непосредственно взаимодействует с ок-
синтазным комплексом; 2 — переноса глюкозы через митохондри-
сидоредуктазой в цепи переноса электронов.
альную мембрану; 3 — переноса через митохондриальную мембрану
адениловых нуклеотидов; 4 — обратного переноса электронов с хи- а) 5; г) 2, 3, 4, 5;
нона на НАД+ в НАДН-дегидрогеназном комплексе. б) 1, 3, 4; д) 3, 4.
в) 1;
а) 1, 3, 4; в) 1, 2, 3, 4;
б) 1, 2, 3; г) 1, 2. 70. Фермент супероксиддисмутаза, участвующий в метаболизме су-
пероксид-радикала, отсутствует у:
67. Ферментативная реакция окисления сукцината в фумарат: а) крыс; в) всех аэробов;
1  — сопряжена с  восстановлением ФАД; 2  — сопряжена с  вос- б) беспозвоночных; г) облигатных анаэробов.
становлением НАД+; 3 — необратимо ингибируется малонатом;
71. Какое из утверждений является верным?
4 — сопряжена с гидролизом АТФ; 5 — конкурентно ингибируется
малонатом. а) Глицерофосфатдегидрогеназа в качестве кофермента содержит
а) 1, 3, 4; г) 2, 3; ФАД+;
б) 2; д) 1, 2, 3, 4. б) в результате гидролиза β-моноацилглицерола образуются гли-
церол и две молекулы высшей жирной кислоты;
в) 1, 5;
в) первой реакцией в обмене ацилглицеринов является их фермен-
68. Концентрация субстрата, при которой скорость реакции состав- тативный гидролиз;
ляет половину максимальной, обозначается КМ (константа Миха- г) ацил-КоА-дегидрогеназа содержит в  качестве кофермента
элиса). НАД+.
v = Vmax| S |/(KМ + | S |). 72. Бактерии могут использовать самые разнообразные реакции
для получения энергии. Какая из реакций не используется живы-
Охарактеризуйте сущность процессов, зависящих от ее величины.
ми организмами?
1 — чем больше KМ, тем меньше сродство фермента к субстрату;
2 — чем меньше KМ, тем больше сродство фермента к субстрату; а) CH4 + H2O → CO2 + H2;
3  — реакции, носящие ярко выраженный экзеэргонический ха- б) H2 + NO3– + H+ → N2 + H2O;
рактер, рассматриваются как физиологически необратимые; 4 — в) CO2 + H2 → CH4 + H2O;
г) FeS2 + O2 + H2O → Fe(OH)3 + SO42– + H+.
физиологически необратимыми являются реакции, имеющие ярко
выраженный эндеэргонический характер. 73. Общеизвестно, что маргарин вреднее для здоровья, чем сливочное
а) 1, 3; г) 1, 2; масло. Это связано с тем, что в маргарине по сравнению с маслом:
б) 2, 4; д) 4. а) больше нейтральных жиров и меньше фосфолипидов;
в) 1; б) больше жирных кислот с нечетным числом углеродных атомов,
которые являются разветвленными;
69. В анаэробных условиях НAДН + H+, образовавшийся в гликолизе, в) больше холестерина;
идет на восстановление пирувата. Охарактеризуйте этот процесс. г) больше машинного масла.
276 Республиканская олимпиада. 2003/2004 учебный год 11 класс 277

74. Фосфатидная кислота синтезируется в результате: нахождения в течение 30 мин под красным светом они были под-
а) гидролиза диацилглицерола; вергнуты освещению синим светом в течение 30 с. Во время всего
б) восстановления диоксиацетонфосфата; эксперимента регистрировали pH среды, в которой выращивали
в) трансацилирования глицерол-3-фосфата; протопласты.
г) фосфорилирования глицерола. Щелочная Синий свет

75. На рисунке приведен участок цикла трикарбоновых кислот, в ко-

pH среды
тором соединение А превращается в соединение В. Рассмотрите
схему и найдите верное утверждение.

OOC CH CH CH2 COO– 10 20 30 40 50 60 Время, мин

COO– Исходя из представленных результатов, определите, какой вывод

Компонент А является наиболее правильным:
а) синий свет может способствовать поглощению замыкающей

CH CH COO– клеткой устьица протонов из среды;
Компонент В б) синий свет может способствовать выкачиванию протонов из за-
мыкающих клеток устьиц;
а) В ходе этой реакции образуется пять молекул высоко энергези- в) синий свет может быть очень эффективным для дыхания за-
рованного фосфата на одну молекулу соединения А; мыкающих клеток устьиц;
б) для осуществления этой реакции необходим кофактор, образу- г) синий свет может активировать протопласты для выделения
ющийся из никотинамида; энергии;
в) эта реакция происходит только в мембранах митохондрий; д) не только синий свет, но и свет с другой длиной волны также
г) при окислении каждой молекулы соединения А образуется одна может способствовать переносу протонов из замыкающих кле-
молекула СО2; ток устьиц.
д) для реакции необходим ГТФ.
78. Периодические колебания численности (популяционные волны),
76. Известно, что кофеин ингибирует фермент 3'-, 5'-цАМФ фосфо- наблюдаемые у хищников и фитофагов, входящих в состав одного
диэстеразу, которая превращает цАМФ в АМФ. Какой процесс биоценоза:
будет наблюдаться в организме человека в присутствии кофеина? 1 — никак не связаны друг с другом; 2 — полностью совпадают
а) Cнизится активность протеинкиназы в печени; по времени и амплитуде; 3 — находятся в противофазе; 4 — у хищ-
б) снизится активность мышечной протеинкиназы А; ников всегда запаздывают по отношению к фитофагам; 5 — у хищ-
в) увеличится активность пируваткиназы в печени; ников имеют меньшую амплитуду, чем у фитофагов.
г) снизится активность гликогенсинтазы в печени. а) 1; г) 3, 4;
б) 2; д) 2, 5.
77. На рисунке (с. 277) показан результат эксперимента, в котором в) 4, 5;
использовали протопласты замыкающих клеток устьиц Vicia
faba. Протопласты инкубировали в виде суспензионной культу- 79. Большие гнездовые колонии чистиковых птиц на севере называют
ры в среде с соответствующим осмотическим давлением. После «птичьими базарами». Их возникновение связано с тем, что:
278 Республиканская олимпиада. 2003/2004 учебный год 11 класс 279

1 — место гнездования должно быть вблизи моря; 2 — гнездящи- 84. В пробирку с питательной смесью поместили 5 гомозиготных са-
еся здесь птицы всегда охотятся большими стаями; 3 — птенцам мок дрозофилы с нормальными крыльями и 3 гомозиготных самца
легче выжить, так как взрослые птицы кормят их чаще; 4 — птицы с укороченными крыльями. Потомков каждого поколения изоли-
кормят не только своих птенцов, но и всех подряд; 5 — в таких ско- ровали от родителей и позволяли им свободно скрещиваться. От-
плениях температура среды всегда выше, поэтому меньше энергии ношение мух с нормальными и укороченными крыльями в пятом
тратится на обогрев птенцов. поколении будет:
а) 2, 4; г) 4; а) 5 : 3; в) 1 : 1;
б) 1, 3; д) 1, 5.
б) 3 : 1; г) 8 : 3.
в) 3, 4, 5;
80. При  скрещивании двух растений с  белыми цветками в  потом- 85. Мужчина, у  отца которого была группа крови 0, а  у  матери  —
стве  F2 наблюдались растения с  красными и  белыми цветками группа крови А, имеет группу крови А. Он женился на женщине
в соотношении 9 : 7. Окраска цветков контролируется: с группой крови АВ. Вероятность рождения от этого брака ребенка
а) одним геном, аллель красного цветения доминантен; с группой крови А:
б) двумя генами, действующими независимо; а) 0,125; в) 0,5;
в) двумя сцепленными генами; б) 0,375; г) 0,25.
г) двумя комплементирующими генами.
81. При  дигибридном скрещивании и  неполном доминировании 86. У  человека серый цвет глаз является доминантным признаком
по одному гену количество возможных фенотипов в F2 равно: по отношению к голубому, а отсутствие потовых желез — рецес-
а) 4; в) 8; сивным признаком, сцепленным с полом. У сероглазой женщины
б) 6; г) 16. с нормальными потовыми железами и сероглазого мужчины, ли-
шенного потовых желез, родился голубоглазый сын, не имеющий
82. Частота встречаемости альбиносов в европейской популяции че-
потовых желез. Вероятность рождения у этой пары сероглазого
ловека равна примерно 1 : 17 000. Альбиносы являются гомозиго-
тами по рецессивному аллелю а. Определите частоту гетерозигот сына с нормальными потовыми железами:
в этой популяции при допущении соблюдения закона Харди — а) 1/8; в) 3/16;
Вайнберга: б) 1/4; г) 1/16.
а) примерно 1,5 %; г) определить невозможно;
б) примерно 0,7 %; д) примерно 0,006 %. 87. У человека темные волосы доминируют над светлыми, а раннее
в) примерно 99 %; облысение — наследственный доминантный признак. Гены обоих
признаков находятся на аутосомах и не сцеплены между собой.
83. При скрещивании растений душистого горошка с красными и бе-
Темноволосый мужчина с ранним облысением женился на блон-
лыми цветками в первом поколении все растения были с розовы-
динке с нормальными волосами. От этого брака родились светло-
ми цветками, а во втором имелись растения с белыми, розовыми
и красными цветками. Скрещивание растений с красными и розо- волосый сын с ранним облысением и темноволосая девочка с нор-
выми цветками даст в третьем поколении растения с: мальными волосами. Вероятность того, что следующим ребенком
в этой семье будет светловолосый мальчик с нормальными воло-
а) белыми, красными и розовыми цветками, 1 : 1 : 2;
б) белыми и красными цветками, 1 : 3; сами:
в) красными и розовыми цветками, 1 : 1; а) 0,125; в) 0,375;
г) красными и розовыми цветками, 1 : 3. б) 0,25; г) 0,5.
280 Республиканская олимпиада. 2003/2004 учебный год 11 класс 281

88. В пробирку с питательной смесью поместили 9 самок дрозофилы фиброз. Учитывая, что частота этого аллеля с ростом популяции
с белыми глазами и 3 самца с красной окраской глаз. Потомков не меняется, определите, какова будет частота встречаемости ци-
каждого поколения изолировали от  родителей и  позволяли им стофиброза на острове:
свободно скрещиваться. Отношение самцов с красными и белыми а) 0,0025 %; в) 0,25 %;
глазами в восьмом поколении будет: б) 0,05 %; г) 0,5 %.
а) 1 : 1; в) 1 : 3;
б) 1 : 2; г) 1 : 4. 93. При скрещивании мутантов хламидомонады, лишенных фототак-
сиса, с хламидомонадами с нормальным фототаксисом половина
89. Геномный импринтинг заключается в том, что: потомства имела фототаксис, а половина — нет. Это может объ-
а) гены, «доставшиеся» организму от матери, экспрессируются, ясняться тем, что:
а «доставшиеся» от отца — нет; а) мутация доминантна;
б) гены, «доставшиеся» организму от  отца, экспрессируются, б) мутация рецессивна;
а «доставшиеся» от матери — нет; в) хламидомонада — гаплоидный организм;
в) одни гены организма экспрессируются в  его клетках только г) мутантные хламидомонады гетерозиготны.
в том случае, если они достались ему от матери, а другие — если
достались ему от отца; 94. В Японии обнаружены две популяции черных крыс (Rattus rattus),
г) в клетках организма экспрессируется половина генов, «достав- имеющих в кариотипе 38 и 42 хромосомы. Наиболее вероятной
шихся» ему от матери, и вторая половина генов отца. причиной их возникновения является:
а) аллопатрическое видообразование;
90. Фиксированные комплексы движений (ФКД) — важнейший ком-
б) автополиплоидия;
понент поведения. Из приведенных утверждений неверным по от-
в) межвидовая гибридизация;
ношению к ФКД является:
г) хромосомные аберрации.
а) ФКД — высокостереотипное инстинктивное поведение;
б) ФКД осуществляются по принципу тригера в ответ на стимулы 95. Видовая самостоятельность трех видов бабочек из семейства бе-
внешней среды и, однажды начавшись, продолжаются до своего лянок — капустницы, брюквенницы и репницы — поддерживается
завершения; существованием между ними изоляции:
в) ФКД уменьшают адаптивное значение поведения; а) географической; в) этологической;
г) обычно ФКД вызывают один или два ключевых стимула, кото- б) экологической; г) хронологической.
рые связаны с важным объектом.
96. Голубая сорока (Cyanopica cyanus) обитает на Пиренейском полу-
91. Вероятность того, что среди четырех детей гетерозиготных родите- острове, а также в Восточном Китае и Приморье. Такая конфигу-
лей (Аа × Аа) трое будут иметь доминантный фенотип, составляет: рация видового ареала объясняется:
а) 42 %; в) 36 %; а) выселением из общего центра видообразования в двух направ-
б) 56 %; г) 60 %. лениях;
92. После кораблекрушения 20 человек (соотношение полов 1 : 1) до- б) миграцией с востока на запад и образованием вторичной по-
брались до необитаемого острова и образовали новую, полностью пуляции;
изолированную популяцию. Двое из них были носителями гена в) резким сокращением и разрывом ранее единого ареала во время
цистофиброза (мутантного гена — с) (т. е. они были гетерозиготны последнего оледенения;
по этому гену). Ген с в гомозиготном состоянии вызывает цисто- г) существованием видов-двойников.
282 Республиканская олимпиада. 2003/2004 учебный год 11 класс 283

97. Популяция может увеличивать численность экспоненциально: Семейство

а) когда ограничена только пища; Признак Кресто­ Пасле- Сложно­ Лилей-
б) при освоении новых мест обитания; цветные новые цветные ные
в) только в случае отсутствия хищников; Камбий
г) только в лабораторных условиях. Листья: простые
98. Какова вероятность того, что два близнеца являются двуяйцевы- сложные
ми, если оба ребенка обладают генотипом aaBbCcDdEeFf (каждая Жилкование:
пара генов наследуется независимо друг от друга), а у родителей обычно сетчатое
были генотипы AaBbCCDDEeFf и AaBBccddeeFF? обычно дуговое
а) Определить невозможно; г) 1/32; обычно линейное
б) 1/2; д) 1/1024; Цветок: чаще трехчленный
в) 1/10  000; е) 1/128.
чаще четырехчленный
чаще пятичленный
Часть B
Тычинки: обычно три
1. На  рисунке приведены схемы пяти типов гинецея покрыто­ обычно четыре
семенных растений. Назовите их. Отметьте также типы плацен-
обычно пять
тации, характерные для них. Заполните таблицу.
обычно шесть
обычно десять
Завязь: верхняя
1 2 3 4 5
Тип гинецея Тип плацентации Соцветие: кисть
1 колос
2 щиток
3 корзинка
монохазий (завиток)
2. В таблице перечислены признаки, характерные для растений четы-
рех различных семейств. Изучите эти признаки и внесите ответы
по каждому признаку в таблицу, используя знак «+» или «–».
284 Республиканская олимпиада. 2003/2004 учебный год 11 класс 285

3. Бактерии Escherichia coli поместили в среду с лактозой и выдержа- 5. На рисунке представлены делеционные варианты хромосомы 5
ли некоторое время для индукции лактозного оперона. В таблице человека, на  которой необходимо установить местоположение
указаны отдельные компоненты, участвующие в функционирова- гена микрофибриллярного белка. Предположим, что каждый де-
нии лактозного оперона, под соответствующим номером. леционный вариант находится в гаплоидном состоянии в соответ-
ствующей клеточной линии, культивируемой in vitro. ПЦР-анализ
1. Ген b-галактозидазы 10. Клеточная мембрана показал наличие этого гена во всех клеточных линиях, а биохи-
2. Белок репрессор 11. РНК-полимераза мический анализ  — наличие соответствующего белка. Исходя
3. Оператор 12. Рибосомы
из имеющихся данных, определите локализацию гена и укажите
стрелкой его местоположение на целой хромосоме.
4. Лактоза 13. Ген трансацетилазы (lacA)
5. Пермеаза лактозы 14. Трансацетилаза
6. Ген, кодирующий репрессор 15. b-галактозидаза
7. Ген-регулятор 16. Глюкоза
8. Промотор 17. мРНК, b-галактозидаза, пер-
меаза и трансацетилаза
9. Ген пермеазы лактозы 18. Галактоза
6. Мутация в гене, кодирующем синтез гемоглобина (HbS), вызыва-
ет заболевание, называемое серповидноклеточной анемией. Это
Что из перечисленного (1—18) присутствует в бактериях, расту-
заболевание сопровождается рядом симптомов, к числу которых
щих на среде с глюкозой? (Поставьте знак «+» или «–» в соответ-
ствующей клетке. Результаты впишите в таблицу.)
1 — анемия; 2 — серповидная форма эритроцитов; 3 — разрушение
Таблица ответов
эритроцитов; 4 — образование агрегатов клеток и закупорка не-
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 больших кровеносных сосудов; 5 — сердечная недостаточность;
6 — почечная недостаточность; 7 — нарушения работы головного
мозга; 8 — повреждения других органов; 9 — паралич.
На  диаграмме каждый
Появление аномального
4. Укажите в соответствующем столбце таблицы, из каких зароды- гемоглобина
сим­п ­т ом, расположенный
шевых листков у Metazoa развиваются указанные ниже органы. над  стрелкой, вызывает по-
явление симптома, располо-
Головной мозг 1. Эктодерма 2 женного под  стрелкой. До-
2. Эндодерма полните диаграмму, вписав
3. Мезодерма 4 в  пустые ячейки номера со-
Вегетативные ганглии
ответствующих симптомов.
Легкие 5 7
Сердечная мышца
286 Республиканская олимпиада. 2003/2004 учебный год 11 класс 287

7. В правом столбце таблицы 1 перечислены витамины, а в левом — Таблица ответов

их условные обозначения. В таблице 2 перечислены функции ви-
таминов под соответствующими номерами. Определите функцию Условное обозначе­ Функции витамина и (или) физиологическое
ние витамина проявление его дефицита (укажите номер)
каждого витамина и (или) последствия дефицита его (или его про-
изводного) в организме. Результаты внесите в таблицу ответов. A

Таблица 1 Б
Условное обозначение Витамин Г
A В1 (тиамин) Д
Б В2 (рибофлавин) Е
В В6 (пиридоксин) Ж
Г Фолиевая кислота
Д А (ретинол)
Е D (кальциферол)
Ж Е (токоферол)
З К (менахинон) Л

И С (аскорбиновая кислота)
8. Заболевание человека — альбинизм — наследуется по аутосомно-
К В12 (кобаламин)
рецессивному типу (см. рисунок).
Л РР (никотиновая кислота)

Таблица 2 А А

Функция витамина и (или) физиологическое  а а

проявление его дефицита
1 Антиоксидант
2 Регуляция метаболизма кальция и фосфатов
3 Перенос групп от аминокислот или на них А А а
4 Предшественник светопоглощающей группы зрительных пигментов
5 Свертывание крови А а а
Проба Проба Проба
6 Цинга Маркеры ДНК РНК Белок Маркеры ДНК РНК Белок Маркеры ДНК РНК Белок

7 Бери-бери 10К 10К 10К

8 Пеллагра 5К 5К 5К
9 Анемия 2К 2К 2К
10 Кофермент дегидрогеназ
Саузерн Нозерн Вестерн
11 Рахит
Участок разрезания рестриктазой Стоп-кодон
288 Республиканская олимпиада. 2003/2004 учебный год 11 класс 289

Причиной заболевания является появление аллеля рецессивного Термин Утверждение

типа (а) в результате мутации в гене А. Мутация приводит к по- 3. Отбор В. Степень различий возрастает между
явлению терминирующего кодона в гене и синтезу укороченного субпопуляциями и  уменьшается вну-
пептида. В результате мутации возникает дополнительный сайт три субпопуляций
для одной из рестриктаз, что делает возможным обнаружение му- 4. Аутбредная депрессия Г. Наблюдается снижение жизнеспособ-
тантных генов по результатам рестрикционного картирования. ности в результате возрастания гомози-
Изобразите на рисунках ожидаемые результаты Саузерн-, Нозерн- готности, возрастает степень экспрес-
и Вестерн-гибридизации при анализе всех возможных генотипов сии вредных аллелей как  следствие
(АА, Аа, аа). Результаты Саузерн-блоттинга изобразите в соот- скрещиваний между близкородствен-
ветствии с длиной самого крупного рестрикционного фрагмента ными организмами
(11 kb) и маркерами длины, которые приведены слева. Учтите, 5. Дрейф генов Д. Снижается приспособленность как ре-
что маркеры приведены только для ДНК-фрагментов. Результаты зультат скрещиваний между генетиче-
Нозерн- и Вестерн-гибридизации изобразите без учета масшта- ски различными организмами
ба, но учитывайте при этом относительное положение различных 6. Мутация Е. Наблюдаются снижение степени раз-
фрагментов для разных генотипов. личий между субпопуляциями и  уве-
личение внутри субпопуляций
9. Для того чтобы оценить размер популяции одного из видов водя-
ных жуков в небольшом пруду, было отловлено 30 экземпляров; Таблица ответов
их пометили, а затем выпустили обратно в пруд. Через 24 ч снова
отловили 30 экземпляров и изучили их. Среди отловленных жуков Термин 1 2 3 4 5 6
оказалось 14 меченых. Рассчитайте размер популяции жуков, учи- Утверждение
тывая, что за это время не родилось и не погибло ни одного жука
и ни один из них нe мигрировал. Ответ внесите в прямоугольник.

10. В таблице (слева) перечислены термины, широко используемые

в генетике популяций, а справа даны утверждения, касающиеся
этих терминов. Найдите правильные сочетания.

Термин Утверждение
1. Инбредная депрессия А. Закрепляются благоприятствующие
аллели и элиминируются неблагопри-
2. Поток генов Б. Такое событие происходит редко и при-
водит к  возрастанию генетического
разнообразия внутри субпопуляций
и между ними
11 класс 291

Республиканская олимпиада. Признак I II III IV V VI VII

2004/2005 учебный год Собака + + + + + + +
Лиса – + + – + + –
11 класс Шакал + – + – + – –
Волк + + + – + + +
Вопросы 1–3. В питомниках, где занимаются разведением собак из- Гиена – – – + – – –
вестных пород, работники часто сталкиваются с  различными
сложностями, связанными с заболеваниями собак, а также с вы- Основываясь на приведенных данных, определите, какая из фено-
ведением щенков нужного окраса. грамм указывает на филогенетические связи между исследуемыми
Порода золотистый ретривер выводится путем близкородствен- группами животных.
ных скрещиваний. Приведенная ниже родословная составлена
для редкой, но относительно мягкой формы наследственного за- а) собака в) собака
болевания кожи у собак. лиса лиса
волк шакал
1 2 шакал волк
гиена гиена
1 2 3 1 б) собака г) собака
волк волк
III лиса лиса
1 2 3 4 5 6 7 8
шакал шакал
IV гиена гиена
1 2 3 4 5 6 7 8 9
Вопросы 4–8. Плазмида размером 2800 п. н. была выделена из клеток
1. Каков механизм наследования этого заболевания? бактерий. Затем ДНК данной плазмиды разрезали тремя рестрик-
а) Аутосомальный, рецессивный; тазами в разных комбинациях: 1) с помощью BamHI и HindIII;
б) аутосомальный, доминантный; 2) с помощью ВаmIII и ЕсоRI; 3) с помощью HindIII и ЕсоRI. По-
в) рецессивный, сцепленный с полом; сле этого рестрикционные фрагменты плазмиды были разделены
г) доминантный, сцепленный с полом. с использованием электрофореза и на основании полученных ре-
зультатов построена рестрикционная карта. Изучите представлен-
2. Вероятность того, что среди четырех щенков гетерозиготных ро- ные ниже материалы и дайте ответы на поставленные вопросы.
дителей (Dd × Dd) трое будут иметь доминантный фенотип, со-
ставляет: 4. Какое из утверждений неверно?
а) 42 %; в) 36 %; а) Плазмиды не имеют белковых оболочек;
б) 56 %; г) 60 %. б) плазмиды являются кольцевыми молекулами двуцепочечной
3. У  собак, лис, шакалов, волков и  гиен исследовали наличие (+) в) плазмиды могут быть встроены в хромосому клетки-хозяина;
или отсутствие (–) семи фенотипических признаков (I—VII). Ре- г) гены плазмид необходимы для размножения бактерий;
зультаты приведены в таблице. д) плазмиды полезны для их клеток-хозяев.
292 Республиканская олимпиада. 2004/2005 учебный год 11 класс 293

Б а) . . . CG в) . . . TGAATT
Маркерная BamHI BamHI BamIII . . . GCAATT . . . АС
лестница + + + начало б) AATTCG . . . г) GT . . .
HindIII EcoRI EcoRI репликации 2
1600 bp GC . . . ТТААСА . . .
1 0 200
1400 bp 8. Каким образом плазмиды получают гены множественной устой-
1200 bp чивости к антибиотикам?
1000 bp 2800 п. н.
5 плазмида а) Транспозицией; г) трансформацией;
800 bp 3
2000 800 б) конъюгацией; д) трансдукцией.
600 bp
в) транскрипцией;
400 bp 1600
200 bp Вопросы 9–13. Исследователь подвергал образцы трех различных ти-
bp — пары нуклеотидов пов растений воздействию света десяти различных интенсивно-
Г стей (от полной темноты до прямого солнечного света) в течение
нескольких дней. Растения находились на воздухе при темпера-
5. Какие из участков рестрикции (1—5) на карте плазмиды соответ- туре 30 °С и при хорошем поливе. Характеристика испытуемых
ствуют каждой из рестриктаз (А, Б или В)? Ответ внесите в соот- типов растений:
ветствующую графу таблицы, указав нужную букву. – растения типа С3, адаптированные к росту при прямом солнеч-
ном свете («солнечные растения»);
Рестриктаза Участок Ответ [А/Б/В] – растения типа С3, которые могут расти только в условиях низкой
А ВаmHI 1 освещенности («теневые растения»);
Б EcoRI 2 – растения типа С4, которые подобно большинству С4-растениий
адаптированы к росту при прямом солнечном свете.
В HindIII 3
Затем исследователь провел измерения уровня фотосинтеза в ли-
4 стьях растений каждого типа (обозначив их буквами A, B и C)
5 и построил графики для каждого из них.

6. Четыре стороны электрофоретического геля обозначены на схеме

(относительные единицы)
буквами А, Б, В и Г. Какая из них соответствует катоду?

Уровень фотосинтеза
а) A; г) Г; В
б) Б; д) невозможно определить.
в) В;
7. Рестриктаза EcoRI разрезает двойную спираль ДНК следующим
5' ... G AATTC ... 3' 0 20 40 60 80 100
...СTTAA G... Интенсивность света (% от прямого солнечного)

Какой из фрагментов мог бы связаться по месту рестрикции фер- Примечание. Во всех вопросах обозначения растений А, В или С соответствуют
ментом EcoRI (лигироваться)? кривым на графике.
294 Республиканская олимпиада. 2004/2005 учебный год 11 класс 295

9. Какому типу растений соответствует каждый из графиков — А, 12. Проходил бы фотосинтез значительно быстрее, если бы листья
В и С? Нужную букву внесите в графу ответов в таблице. трех растений, находящихся при освещенности в 60 % от макси-
мального уровня солнечного света, получали дополнительное ос-
вещение (D) или больше углекислого (C)?
1. С3 солнечное растение Ответ
2. С3 теневое растение [D/C]
3. С4-растение Растение А
Растение B
10. Какой из графиков (А, В или С) соответствует следующим типам Растение C
13. Фотодыхание наблюдается в хлоропластах растения, если кон-
Ответ центрация О2 значительно превышает концентрацию СО2. В этом
[А/В/С ]
случае О2 включается вместо СО2 в цикл Кальвина посредством
1. Пшеница, рис, овес, ячмень, горох и фасоль фермента РуБисКо. Субстратом для РуБисКо, который обычно
2. Растения, которые обычно имеют самую малую связывается с СО2, является:
толщину листьев
а) 3-фосфоглицерат;
3. Растения с  самой высокой эффективностью ис-
б) гликолат-2-фосфат;
пользования воды
в) глицеро-1,3-дифосфат;
4. Растения, преимущественно использующие азот г) 3-фосфоглицероальдегид;
(N) для образования тилакоидных белков и хло-
д) рибулозо-1,5-дифосфат.
рофилла, а не для ферментов фиксации СО2
5. Растения, у которых в некоторых хлоропластах от- Вопросы 14–18. Кариотип представляет собой набор хромосом, нахо-
сутствует фермент РуБисКо дящихся в клетках эукариот. Приведенная диаграмма демонстри-
рует нормальный кариотип мужчины.
11. Кривая С на графике показывает, что уровень фотосинтеза у этих
растений понижается при  возрастании интенсивности прямого
солнечного света с 60 до 100 %. Почему? 1 2 3 4 5
а) В растениях недостаточно хлорофилла а;
б) растение не закрывает устьица при недостатке воды и, следова- 6 7 8 9 10 11 12
тельно, обезвоживается под ярким светом;
в) количество РуБисКо недостаточно для того, чтобы использо- 13 14 15 16 17 18
вать яркий свет, и последующее накопление свободных ради-
калов кислорода приводит к повреждению мембран; 19 20 21 22 X Y
г) яркий свет стимулирует митохондриальное (ночное) дыха-
ние, вследствие этого ночью растение выделяет больше СО2, 14. Кариотипы можно наблюдать в  клетках, которые находятся
чем фиксирует его в течение дня посредством фотосинтеза; на стадии:
д) хлоропласты растения перемещаются к периферии клеток ли- а) профазы мейоза; г) телофазы митоза;
ста, делая листья прозрачными и неспособными поглощать свет б) анафазы митоза; д) интерфазы.
для фотосинтеза. в) метафазы митоза;
296 Республиканская олимпиада. 2004/2005 учебный год 11 класс 297

15. Сколько аутосом изображено на рисунке (с. 295)? 19. Каждое столетие риф заселяют в среднем десять видов кораллов,
а) 22; в) 4